Antievolution.org :: Antievolution.org Discussion Board The Critic's Resource on Antievolution

Antievolution.org Discussion Board > From the Panda's Thumb > After the Bar Closes... > Joe G.'s Tardgasm

Pages: (919) < ... 123 124 125 126 127 [128] 129 130 131 132 133 ... >

OgreMkV Posts: 3668 Joined: Oct. 2009 (Permalink) Posted: Mar. 08 2012,07:32    [quote=Joe G,Mar. 08 2012,06:51] [quote=OgreMkV,Mar. 07 2012,17:15]Hmm.. interesting.. so, Joe, before the knowledge of stall speed and wing vortexes... bees really couldn't fly?   The laws ARE Joe.  We don't have to know how they work to make use of them.  No one knows exactly how mass warps spacetime to create what we call gravity.  As has been stated several times, that doesn't stop anyone from using the known principles of gravity to determine a result. Speaking of which, hey Joe.  has anyone ever used a principle of ID to determine a result (other than 'it looks designed'). Since you have absolutely failed chemistry and brought up the concept of "information", I guess it's time to begin the test.  Are you ready.  This is going to be so much fun. Joe, here are two DNA sequences.  Since I know how big you are on context, I'll tell you a little bit about them.  Both of the sequences are exactly the same length.  Indeed, except for the bolded nucleotide, they are exactly the same.  Both produce a protein that is required for humans to live.  Both produce a slightly different form of that protein, but a person with either one will live a long live (all other things being equal... this protein won't prevent you from tearing you anus and bleeding to death while kicking yourself in the ass). What I'd like is you to use some principles of ID to tell me something about these two sequences.  Which came first?  Which is more functional, etc. However, because we both know that you will never do this.  What I'd like you to do is define information and then tell us which sequence has more information.  You get to pick which kind of information we talk about.  We just need a definition so that we're all on the same page. So, define information and which one has more information. Sequence the first: ATG GTG GAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT GAG AAC TTC AGG GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA Sequence the second ATG GTG GAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT GAG AAC TTC AGG GTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA Feel free to compare them using grep (you do know what grep is right?) BTW: While we're talking about it.  I would like to remind you that using the known laws of science... There is NOTHING that would prevent life from arising from non-live.  Believe me, I've studied this for years.  There's a lot of exciting research coming out.  Not only is it possible, it is likely to have happened via multiple pathways. Again, this is how science works.  You make a claim, you support it. My claim is that there is nothing in the laws of the universe that would prevent life coming from non-life.  So far, 50 years of research and thousands of scientific papers support my views. Your claim is that it is impossible.  However, your requirements are hypocritical in that you demand stuff from science that you don't demand from your own notions.  Again, you are making the claim that thousands of experiments are wrong.  You support it. All it takes is one experiment to prove me wrong, yet it hasn't ever happened yet.  Why don't you learn what a mole is, get a degree in chemistry, and then do the experimental world to prove me wrong. Oh that's right, your too scared it will alter your world view.  You aren't interested in science, you are just interested in playing internet tough guy. I fully expect you to run away from this challenge too. Quote Umm you still have retard issues kevin- 1- I need to see those DNA sequences HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA I thought it couldn't get better after the mole statement.  But this is freaking awesome. Hey Joe, Do you know A T C and G are?  Maybe the codes for the nucleotides in D N A?!?!?!? HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA Quote 2- There isn't any evidence that demonstrates blind and undirected processes can produce any sequence of DNA- so that would be a problem for you. Fine, no requirement that have to. Again, it's called chemistry and you don't understand how it works, so you obviously don't understand that it actually does work. I can point you to some 200 papers that describe chemical reactions that create... from scratch long sequences of RNAs. Quote 3- Yes I know the laws are kevin- but just saying that is not scientific You're right... which is why you're a hypocrite.  Just saying that things are designed is not scientific.  You have to support these things with evidence... of which you have none. Perhaps you should read an 8th grade science text.  It should cover the basics of gravity, electromagnetism, and forces for you. Quote 4- Design principles are used on a daily basis to determine design Yeah... of things known in advance to be designed. You (and your fellow IDiots) have universally failed to actually be able to use those principles to distinguish between something that is designed and something that is NOT designed. Of course, if you already know something is designed... then the entire argument is kind of wasted effort. Quote 5- YOUR position also claims to be able to determine design from nature, operating freely- duh Nope.  We can determine repeating processes that result in complex systems.  Not design. Quote 6- And you need something that ALOLOWS for a living organism to arise from non-living matter via purely chemical and physical reactions Yes, it's called Chemistry and no where in the last 65 or so years of research has anyone been able show that it is impossible to happen. Referencing number 1... just saying it isn't scientific. You have to be able to show it.  You claim that it is impossible, going against 65 years of research... then you show it. Quote 7- All it takes is ONE experiment to falsify ID yet evotards are too agraid to conduct it You are right... and we're been conducting those experiments since the 1950s. Tell us Joe, what experiment would unequivocally prove that the development of life from non-life is impossible.  Describe it detail, then tell us why you haven't done it. Quote 8- mole- can be a unit of measure - basically a measure of the amount of elemetary entities some substance has as there are in 12 grams of pure carbon-12 Yay, you can read.  Of course, you're too late.  The whole point of that was to show you don't have a clue about the 2nd Law of Thermodynamics... which I think we've proven beyond the shadow of a doubt. Quote 9- Your sorry-ass position can't even explain the existrence of water beyond saying "it just is"- again your position is unscientific But you wouldn't know because you are ignorant of science. Joe, water exists because is more energetically stable than pure hydrogen mixed with pure oxygen. The fact that you don't even understand this just continues to demonstrate that you don't have a clue about Chemistry, Physics or the 2nd Law... or science for that matter. BTW: Thanks for the own goal at #1 HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA eta: fix quotes and "Hey Joe... I notice you didn't actually answer any of the questions or comments I posed... again. What's the matter scared or stupid? Edited by OgreMkV on Mar. 08 2012,07:44 -------------- Ignored by those who can't provide evidence for their claims. http://skepticink.com/smilodo....retreat

OgreMkV Posts: 3668 Joined: Oct. 2009 (Permalink) Posted: Mar. 08 2012,07:41    Quote (Joe G @ Mar. 08 2012,06:54) Quote (OgreMkV @ Mar. 07 2012,21:44) Quote (Henry J @ Mar. 07 2012,21:37) But on a more serious note, the atoms of which organisms are made are the same types of atoms of which the planet around us is made. Those atoms and molecules have the same reactions inside an organism as they do elsewhere. There is therefore no reason to assume a priori that the formation of a simple self replicating system couldn't have happened using some of those same chemical processes. Plus, there's no other observed process that even begins to explain any of the observed patterns in the relevant evidence. Henry Which is why Joe is a big ole hypocrite. He demands levels of evidence for science that he can't even begin to show for his own notions. He demands that science prove every step of every possible chemical reaction (and physics principle) that explains all life, all proteins, and (indeed) all the universe, yet refuses to provide the simplest evidence that his ideas are even testable. Go ahead Joe, prove me wrong.  But we both know you won't and you can't. Fuck you kevbo- You don't have anything- No one has gone into a lab and had a new protein complex "evolve" No one has gone into a lab and performed targeted mutagenesis on fish embryos to see if a fishapod would develop. IOW don't blame me because your position is unscientific- no testable hypotheses and no supporting evidence- then again you don't know what evidence is. Poor Joe... so ignorant... Directed evolution of novel binding proteins Concerted evolution of two novel protein families in Caenorhabditis species Now, Joe, remember you directly said "gone into a lab and had a new protein complex evolve"... well here you go. It all depends on what you mean by complex.  I don't know if that's a calculated attempt to get away from the hundreds of peer-reviewed articles found when searching for 'novel protein evolution'.  Or if you actually don't just understand what you said.  Perhaps you should describe what you mean more clearly and I'll try to help. As far as the fish thing.  It's curious that you would think developing a fish with legs is required evidence.  Of course, we don't have to do this... we already have one.  Tiktaalik.  I know you're too stupid to understand the concept of transitional fossil and I don't want to have to explain why you're wrong for the 10th time.  But it is... a fish... with tetrapod limbs.  Done. No, Joe, you don't know what evidence is or you would understand that it's you against 150 years of scientific research... that curiously continues to advance in spite of your pathetic claims that it's impossible.  New tools, new products using evolutionary principles... none from ID... still. -------------- Ignored by those who can't provide evidence for their claims. http://skepticink.com/smilodo....retreat

Occam's Aftershave Posts: 5287 Joined: Feb. 2006 (Permalink) Posted: Mar. 08 2012,07:46    Hey Joe: Tell us again how Lt. Data on Star Trek TNG is proof that real world cells have teeny weeny GAs built inside them. Tell us how a molecule of H2O isn't water. Tell us how in chemistry mole is short for molecule.       At TSZ you had the best tardgasm EVAH! -------------- "CO2 can't re-emit any trapped heat unless all the molecules point the right way" "All the evidence supports Creation baraminology" "If it required a mind, planning and design, it isn't materialistic." "Jews and Christians are Muslims." - Joke "Sharon" Gallien, world's dumbest YEC.

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,07:49    Quote (OgreMkV @ Mar. 08 2012,07:41) Quote (Joe G @ Mar. 08 2012,06:54) Quote (OgreMkV @ Mar. 07 2012,21:44)   Quote (Henry J @ Mar. 07 2012,21:37) But on a more serious note, the atoms of which organisms are made are the same types of atoms of which the planet around us is made. Those atoms and molecules have the same reactions inside an organism as they do elsewhere. There is therefore no reason to assume a priori that the formation of a simple self replicating system couldn't have happened using some of those same chemical processes. Plus, there's no other observed process that even begins to explain any of the observed patterns in the relevant evidence. Henry Which is why Joe is a big ole hypocrite. He demands levels of evidence for science that he can't even begin to show for his own notions. He demands that science prove every step of every possible chemical reaction (and physics principle) that explains all life, all proteins, and (indeed) all the universe, yet refuses to provide the simplest evidence that his ideas are even testable. Go ahead Joe, prove me wrong.  But we both know you won't and you can't. Fuck you kevbo- You don't have anything- No one has gone into a lab and had a new protein complex "evolve" No one has gone into a lab and performed targeted mutagenesis on fish embryos to see if a fishapod would develop. IOW don't blame me because your position is unscientific- no testable hypotheses and no supporting evidence- then again you don't know what evidence is. Poor Joe... so ignorant... Directed evolution of novel binding proteins Concerted evolution of two novel protein families in Caenorhabditis species Now, Joe, remember you directly said "gone into a lab and had a new protein complex evolve"... well here you go. It all depends on what you mean by complex.  I don't know if that's a calculated attempt to get away from the hundreds of peer-reviewed articles found when searching for 'novel protein evolution'.  Or if you actually don't just understand what you said.  Perhaps you should describe what you mean more clearly and I'll try to help. As far as the fish thing.  It's curious that you would think developing a fish with legs is required evidence.  Of course, we don't have to do this... we already have one.  Tiktaalik.  I know you're too stupid to understand the concept of transitional fossil and I don't want to have to explain why you're wrong for the 10th time.  But it is... a fish... with tetrapod limbs.  Done. No, Joe, you don't know what evidence is or you would understand that it's you against 150 years of scientific research... that curiously continues to advance in spite of your pathetic claims that it's impossible.  New tools, new products using evolutionary principles... none from ID... still. Kevin, Please explain how eithjer of those papers demonstrate that a new protein complex evolved. Compex would mean more than one protein. Also you continue to equivocate as there isn't anything in those 150 years that demonstrates the blind watchmaker didit. As far as Tiktaalik goes well there isn't any evidence is evolved from a regular fish - a fish without robust fin bones- my experiment would help determine if such a thing is possible. -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Occam's Aftershave Posts: 5287 Joined: Feb. 2006 (Permalink) Posted: Mar. 08 2012,07:53    Quote (Joe G @ Mar. 08 2012,07:49) As far as Tiktaalik goes well there isn't any evidence is evolved from a regular fish - a fish without robust fin bones- my experiment would help determine if such a thing is possible. Then why don't you do the experiment yourself Joe?  You claim to be a scientist with your sooper dooper basement science lab.  Afraid the ticks and dragonflies will get jealous? -------------- "CO2 can't re-emit any trapped heat unless all the molecules point the right way" "All the evidence supports Creation baraminology" "If it required a mind, planning and design, it isn't materialistic." "Jews and Christians are Muslims." - Joke "Sharon" Gallien, world's dumbest YEC.

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,07:54    1- I need to see those DNA sequences Quote HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA Exactly what I expected from a person who doesn't understand science. I have to see thejm Kevin- THAT is how science operates. 2- There isn't any evidence that demonstrates blind and undirected processes can produce any sequence of DNA- so that would be a problem for you. Quote Fine, no requirement that have to. Yes, there is. Also I have suppoorted the design inference- OTOH you don't know anything about evidence and are a choking coward. Quote You (and your fellow IDiots) have universally failed to actually be able to use those principles to distinguish between something that is designed and something that is NOT designed. Liar- Forensics, archaeology and YOUR position claim to be able to use those pronciples to distinguish between something that is designed and something that is not designed. Why do you keep ignoring that fact? -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,07:55    Quote (Occam's Aftershave @ Mar. 08 2012,07:53) Quote (Joe G @ Mar. 08 2012,07:49) As far as Tiktaalik goes well there isn't any evidence is evolved from a regular fish - a fish without robust fin bones- my experiment would help determine if such a thing is possible. Then why don't you do the experiment yourself Joe?  You claim to be a scientist with your sooper dooper basement science lab.  Afraid the ticks and dragonflies will get jealous? Right- I should be doing experiments to support evoTARD claims Only a dumbass coward would say that I should be conducting evolutionary experiments. -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,07:58    Quote (Occam's Aftershave @ Mar. 08 2012,07:46) Hey Joe: Tell us again how Lt. Data on Star Trek TNG is proof that real world cells have teeny weeny GAs built inside them. Tell us how a molecule of H2O isn't water. Tell us how in chemistry mole is short for molecule. :D  :D  :D  :D At TSZ you had the best tardgasm EVAH! !- That isn't wjhat i used Data for- again your ignorance is showing 2- one molecule of h2o is neither a liquid, a solid nor a gas- again your ignporance is showing 3- This isn't a chemistry lab and a "mole" can have several meanings and can be someone's shorthand for "molecule" -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

carlsonjok Posts: 3326 Joined: May 2006 (Permalink) Posted: Mar. 08 2012,08:00    Quote (Joe G @ Mar. 08 2012,07:54) 1- I need to see those DNA sequences   Quote HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA Exactly what I expected from a person who doesn't understand science. I have to see thejm Kevin- THAT is how science operates. -------------- It's natural to be curious about our world, but the scientific method is just one theory about how to best understand it.  We live in a democracy, which means we should treat every theory equally. - Steven Colbert, I Am America (and So Can You!)

olegt Posts: 1405 Joined: Dec. 2006 (Permalink) Posted: Mar. 08 2012,08:00    Quote (Joe G @ Mar. 08 2012,07:54) 1- I need to see those DNA sequences Quote HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA Exactly what I expected from a person who doesn't understand science. God, he is really that stupid. Joe, the sequences are right here, on this very page. -------------- If you are not: Galapagos Finch please Logout »

Lou FCD Posts: 5455 Joined: Jan. 2006 (Permalink) Posted: Mar. 08 2012,08:00    Quote (Joe G @ Mar. 08 2012,08:55) Only a dumbass coward would say that I should be conducting evolutionary experiments. Ok, I'll agree with this part, if we add "...that should be taken seriously by anyone." to the end. -------------- “Why do creationists have such a hard time with commas? Linky“. ~ Steve Story, Legend

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:00    Dumbas kevin still ignoring the obvious: 1- Forensics says it can determine design from nature, operating freely 2- Archaeology claims it can determine design from nature, operating freely 3- evotards claim they can determine design from nature, operating freely Yet kevin "thinks" his strawman of a challenge only applies to ID- talk about retarded... -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

olegt Posts: 1405 Joined: Dec. 2006 (Permalink) Posted: Mar. 08 2012,08:01    Quote (Joe G @ Mar. 08 2012,07:58) 3- This isn't a chemistry lab and a "mole" can have several meanings and can be someone's shorthand for "molecule" Citation, please. -------------- If you are not: Galapagos Finch please Logout »

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:02    Quote (olegt @ Mar. 08 2012,08:00) Quote (Joe G @ Mar. 08 2012,07:54) [font=Comic Sans MS]1- I need to see those DNA sequences   Quote HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA Exactly what I expected from a person who doesn't understand science.</span> God, he is really that stupid. Joe, the sequences are right here, on this very page. Yeah oleg- the sequences kevin made-up- they ain't REAL DNA sequences oleg Also your position needs to be able to determine which is designed and which isn't... -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:03    Quote (olegt @ Mar. 08 2012,08:01) Quote (Joe G @ Mar. 08 2012,07:58) 3- This isn't a chemistry lab and a "mole" can have several meanings and can be someone's shorthand for "molecule" Citation, please. :D Yeah oleg needs a citation that this bullshit forum isn't a chemistry lab -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:03    Quote (carlsonjok @ Mar. 08 2012,08:00) Quote (Joe G @ Mar. 08 2012,07:54) 1- I need to see those DNA sequences   Quote HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA Exactly what I expected from a person who doesn't understand science. I have to see thejm Kevin- THAT is how science operates. Yes dickhead - I understand taht you don't have a fucking clue about science. -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

olegt Posts: 1405 Joined: Dec. 2006 (Permalink) Posted: Mar. 08 2012,08:04    Quote (Joe G @ Mar. 08 2012,08:02) Yeah oleg- the sequences kevin made-up- they ain't REAL DNA sequences oleg Yet you are still demanding to see them! LOL And how do you know they are not real? You have any proof? -------------- If you are not: Galapagos Finch please Logout »

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:05    9- Your sorry-ass position can't even explain the existrence of water beyond saying "it just is"- again your position is unscientific But you wouldn't know because you are ignorant of science. Quote Joe, water exists because is more energetically stable than pure hydrogen mixed with pure oxygen. BWAAAAAHAHAHAAAAAAAAAHAHAAAAAAAA That doesn't even address the question you fucking moron. -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

olegt Posts: 1405 Joined: Dec. 2006 (Permalink) Posted: Mar. 08 2012,08:06    Quote (Joe G @ Mar. 08 2012,08:03) Quote (olegt @ Mar. 08 2012,08:01)   Quote (Joe G @ Mar. 08 2012,07:58) 3- This isn't a chemistry lab and a "mole" can have several meanings and can be someone's shorthand for "molecule" Citation, please. Yeah oleg needs a citation that this bullshit forum isn't a chemistry lab No, Joe, I need evidence that there is someone as stupid as you are out there who abbreviates a molecule to a mole. -------------- If you are not: Galapagos Finch please Logout »

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:06    Quote (olegt @ Mar. 08 2012,08:04) Quote (Joe G @ Mar. 08 2012,08:02) Yeah oleg- the sequences kevin made-up- they ain't REAL DNA sequences oleg Yet you are still demanding to see them! LOL And how do you know they are not real? You have any proof? Yes, oleg- that way I demolish his childish game If they are real he will let me see them. -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

carlsonjok Posts: 3326 Joined: May 2006 (Permalink) Posted: Mar. 08 2012,08:07    Quote (Joe G @ Mar. 08 2012,08:03)   Quote (carlsonjok @ Mar. 08 2012,08:00)   Quote (Joe G @ Mar. 08 2012,07:54) 1- I need to see those DNA sequences        Quote HAHAHAHAHAHAHAHAHAHAHAHAHAHAHA Exactly what I expected from a person who doesn't understand science. I have to see thejm Kevin- THAT is how science operates. Yes dickhead - I understand taht you don't have a fucking clue about science. Well, are you sure those aren't DNA sequences? Maybe you could show your CSI calculations to prove they aren't? Edited by carlsonjok on Mar. 08 2012,08:10 -------------- It's natural to be curious about our world, but the scientific method is just one theory about how to best understand it.  We live in a democracy, which means we should treat every theory equally. - Steven Colbert, I Am America (and So Can You!)

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:07    Quote (olegt @ Mar. 08 2012,08:06) Quote (Joe G @ Mar. 08 2012,08:03)   Quote (olegt @ Mar. 08 2012,08:01)   Quote (Joe G @ Mar. 08 2012,07:58) 3- This isn't a chemistry lab and a "mole" can have several meanings and can be someone's shorthand for "molecule" Citation, please. :D Yeah oleg needs a citation that this bullshit forum isn't a chemistry lab No, Joe, I need evidence that there is someone as stupid as you are out there who abbreviates a molecule to a mole. Anyone can use that abbreviation oleg there aren't any rules that prevent it -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:08    Dumbas evoTARDS still ignoring the obvious: 1- Forensics says it can determine design from nature, operating freely 2- Archaeology claims it can determine design from nature, operating freely 3- evotards claim they can determine design from nature, operating freely Yet kevin "thinks" his strawman of a challenge only applies to ID- talk about retarded... -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

olegt Posts: 1405 Joined: Dec. 2006 (Permalink) Posted: Mar. 08 2012,08:08    Quote (Joe G @ Mar. 08 2012,08:06) Yes, oleg- that way I demolish his childish game If they are real he will let me see them. LOL! He did! And you didn't even notice! -------------- If you are not: Galapagos Finch please Logout »

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:09    Quote (olegt @ Mar. 08 2012,08:08) Quote (Joe G @ Mar. 08 2012,08:06) Yes, oleg- that way I demolish his childish game If they are real he will let me see them. LOL! He did! And you didn't even notice! LoL! You are just another lying asshole... LoL! -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Richardthughes Posts: 11178 Joined: Jan. 2006 (Permalink) Posted: Mar. 08 2012,08:10    Still having a meltdown, Joe? That's too bad. -------------- "Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield "You magnificent bastard! " : Louis "ATBC poster child", "I have to agree with Rich.." : DaveTard "I bow to your superior skills" : deadman_932 "...it was Richardthughes making me lie in bed.." : Kristine

olegt Posts: 1405 Joined: Dec. 2006 (Permalink) Posted: Mar. 08 2012,08:11    Quote (Joe G @ Mar. 08 2012,08:07) Anyone can use that abbreviation oleg there aren't any rules that prevent it There is no rule against doing stupid things, Joe. However, anyone remotely familiar with chemistry understands that a mole and a molecule are related, yet quite distinct terms. Abbreviating a molecule to a mole would lead to confusion. So no one does that. You can prove me wrong, of course, by providing a counter example. -------------- If you are not: Galapagos Finch please Logout »

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:11    Quote (Richardthughes @ Mar. 08 2012,08:10) Still having a meltdown, Joe? That's too bad. Still have your head up your ass, RichTARD? That is expected... -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Joe G Posts: 12011 Joined: July 2007 (Permalink) Posted: Mar. 08 2012,08:13    Quote (olegt @ Mar. 08 2012,08:11) Quote (Joe G @ Mar. 08 2012,08:07) Anyone can use that abbreviation oleg there aren't any rules that prevent it There is no rule against doing stupid things, Joe. However, anyone remotely familiar with chemistry understands that a mole and a molecule are related, yet quite distinct terms. Abbreviating a molecule to a mole would lead to confusion. So no one does that. You can prove me wrong, of course, by providing a counter example. Chemistry- I wasn't discussing chemistry I was discussing Kevin's ignorance and dishonesty. Add to that the fact he said it was a trick question- again your ignorance, while amusing, doesn't mean a fucking thing. -------------- "Facts are Stupid"- Timothy Horton aka Occam's Afterbirth "Genetic mutations aren't mistakes"-ID and Timothy Horton Whales do not have tails. Water turns to ice via a molecular code-  Acartia bogart, TARD YEC is more coherent than materialism and it's bastard child, evolutionism

Occam's Aftershave Posts: 5287 Joined: Feb. 2006 (Permalink) Posted: Mar. 08 2012,08:17    Quote (Joe G @ Mar. 08 2012,08:08) Dumbas evoTARDS still ignoring the obvious: 1- Forensics says it can determine design from nature, operating freely 2- Archaeology claims it can determine design from nature, operating freely 3- evotards claim they can determine design from nature, operating freely Yet kevin "thinks" his strawman of a challenge only applies to ID- talk about retarded... 1- Forensics says it can determine HUMAN design from nature, operating freely 2- Archaeology claims it can determine HUMAN design from nature, operating freely 3- evotards claim they can determine HUMAN design from nature, operating freely We can determine HUMAN design only because we have prior knowledge of HUMAN DESIGNERS and the processes they use to compare against. Why do you keep ignoring that obvious point Joe? -------------- "CO2 can't re-emit any trapped heat unless all the molecules point the right way" "All the evidence supports Creation baraminology" "If it required a mind, planning and design, it isn't materialistic." "Jews and Christians are Muslims." - Joke "Sharon" Gallien, world's dumbest YEC.

Pages: (919) < ... 123 124 125 126 127 [128] 129 130 131 132 133 ... >

Track this topic	Email this topic	Print this topic

© 2002-2009 Antievolution.org Powered by Ikonboard 3.0.2a © 2001 Ikonboard