Antievolution.org :: Antievolution.org Discussion Board The Critic's Resource on Antievolution

Antievolution.org Discussion Board > From the Panda's Thumb > After the Bar Closes... > UnReasonable Kansans thread

Pages: (341) < ... 322 323 324 325 326 [327] 328 329 330 331 332 ... >

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: Oct. 06 2008,15:04    Quote (Ftk @ Oct. 06 2008,15:02) I'm not allowed to start a new thread. So fucking what. Just post the awfulness here, post the text that's so bad that it's driven you to distraction. Always some excuse huh FTK? After all, this right here is "your" thread. Go on. For once in your life support your assertions. -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

Ftk Posts: 2239 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,15:05    Quote (Reed @ Oct. 06 2008,14:54) Quote (Ftk @ Oct. 06 2008,12:42) So, since I was polite and have been patiently waiting for Tom's response, I'm avoiding everyone else.  Whatever.  I'll get back to it, and when I do, I'D LIKE TO USE RED LETTER IN SOME PARTS OF IT INSTEAD OF BLACK. IS THAT POSSIBLE, STEVESTORY???? Right, when it is pointed out that you have made fundamental, glaring errors, the "polite" thing to do is ignore that, unless a specific person points them out. For example, after reading http://genomicron.blogspot.com/2007/04/word-about-junk-dna.html would you still consider to your statements about "darwinsts" and "junk DNA" to be correct ? If so, what are the specific errors in the above linked post ? If not, do you agree that your previous statements on the topic were false and ill informed ? You also haven't answered Toms question here: http://www.antievolution.org/cgi-bin....y123775   Quote Given our earlier exchange, I'm curious: do you accept that humans and other great apes share (or could conceivably share) a common ancestor? Because if you don't, all that explaining I did about segmental duplication would have made zero sense to you. The technical details I tried (unsuccessfully, I fear) to convey really have no meaning outside of the context of a phylogenetic tree. If you're still working on digesting the details, I'd suggest in that case that it might not be worth pursuing. ETA: The question is a sincere one, and not meant to put you on the spot. Note that instead of answering this, you started a tangent about the worlds religions supporting "design" You don't need fancy formatting. You need to make coherent, logical points based of facts. No, I did answer that somewhere.  I said I don't know yet if I accept common design.  I DON'T KNOW...ANY EVERYONE HERE SHOULD KNOW THAT BY NOW.  I TEND TO THINK IT'S A CROCK OF SHIT, BUT I'M NOT ENTIRELY CONVINCED OF THAT YET...HENCE ALL THE QUESTIONS. The junk DNA question will be addressed in a more formal post when I address everything else. -------------- "Evolution is a creationism and just as illogical [as] the other pantheistic creation myths"  -forastero

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 06 2008,15:07    Quote (Ftk @ Oct. 06 2008,20:05) Quote (Louis @ Oct. 06 2008,14:02) Quote (Ftk @ Oct. 06 2008,19:37) [SNIP] Louis, in case you've not noticed, Tom has *NOT* responded to a *thing* I've posted.  I wanted to give him ample time to do so without bitching at him like so many of your folks do to me if I don't answer immediately.   [SNIP] O RLY? You must think everyone is as illiterate as you are. Louis Classic Louis response.  Again, need I remind you why I loathe the idea of discussing *anything* with you? Would you like me to link to a post where Tom responds to one of your posts? It takes a matter of minutes to accomplish. Or perhaps you'd like to rephrase your accusation. Louis -------------- Bye.

Ftk Posts: 2239 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,15:07    Quote (oldmanintheskydidntdoit @ Oct. 06 2008,15:04) Quote (Ftk @ Oct. 06 2008,15:02) I'm not allowed to start a new thread. So fucking what. Just post the awfulness here, post the text that's so bad that it's driven you to distraction. Always some excuse huh FTK? After all, this right here is "your" thread. Go on. For once in your life support your assertions. Oh, go f*ck yourself, OM.  I will be posting them here, but it would be certainly be better if they were highlighted in a separate thread instead of thrown into this one. PS:  Are you and blipey brothers?  Srsly...the loon factor is so similiar between the two of you. -------------- "Evolution is a creationism and just as illogical [as] the other pantheistic creation myths"  -forastero

Ftk Posts: 2239 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,15:09    Quote (Louis @ Oct. 06 2008,15:07) Quote (Ftk @ Oct. 06 2008,20:05) Quote (Louis @ Oct. 06 2008,14:02)   Quote (Ftk @ Oct. 06 2008,19:37) [SNIP] Louis, in case you've not noticed, Tom has *NOT* responded to a *thing* I've posted.  I wanted to give him ample time to do so without bitching at him like so many of your folks do to me if I don't answer immediately.   [SNIP] O RLY? You must think everyone is as illiterate as you are. Louis Classic Louis response.  Again, need I remind you why I loathe the idea of discussing *anything* with you? Would you like me to link to a post where Tom responds to one of your posts? It takes a matter of minutes to accomplish. Or perhaps you'd like to rephrase your accusation. Louis Tom responded to my last big post?????  Yes, please do link to that.  I've been checking in regularly to see if he's responded, and I haven't seen anything.  Perhaps I missed it. -------------- "Evolution is a creationism and just as illogical [as] the other pantheistic creation myths"  -forastero

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: Oct. 06 2008,15:14    Quote (Ftk @ Oct. 06 2008,15:07) Oh, go f*ck yourself, OM.  I will be posting them here, but it would be certainly be better if they were highlighted in a separate thread instead of thrown into this one. PS:  Are you and blipey brothers?  Srsly...the loon factor is so similiar between the two of you. So, when it's convenient to you, you respond to me despite attempting to insult me by calling me "the peanut gallery" on many occasions. Yes, it might be "better" if "they" were highlighted in a single thread, but lets face it you'll post a few times then lose interest and move onto the next distraction. Anything to avoid actually facing the issues at hand. If the "loon factor" is so high why do you even bother to respond to my posts at all? Quote I said I don't know yet if I accept common design.  I DON'T KNOW...ANY EVERYONE HERE SHOULD KNOW THAT BY NOW.  I TEND TO THINK IT'S A CROCK OF SHIT, BUT I'M NOT ENTIRELY CONVINCED OF THAT YET...HENCE ALL THE QUESTIONS. Luckily you have as much influence on the world of science as a gnat on the shoe of a scientist. So your opinion is basically worthless. Luv, for me you are entertainment. And, FTK, what questions have you asked that have not been answered? Please do repeat them, I'm excited to know how you can be further spoonfed with information you then ignore. -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

Ftk Posts: 2239 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,15:22    Dearest Dave, In case you're blind to your own style of addressing me, let me clue you in, love.   You've ridiculed, mocked, insulted and talked down to me since day one.  I've dealt with it, so buck up and take it when the same shit is thrown back at you.  Just answer the questions, and quit whining about being insulted.  Isn't that what I'm always told to do.   One of your first comments to me was addressed "Effthekids".  Don't for one second tell me how to speak to you until you've clean up your own act. Thank you. -------------- "Evolution is a creationism and just as illogical [as] the other pantheistic creation myths"  -forastero

Erasmus, FCD Posts: 6349 Joined: June 2007 (Permalink) Posted: Oct. 06 2008,15:22    OM sometimes gnats are undescribed species.  So... anyway, FtK, I've heard you go on and on about 'design detection' and repeating ad nauseum the nonsense from ENV, I assumed your mind was made up.  It sure as hell ain't analysis paralysis.  You should go read zachriel's stuff about nested hierarchies and do note the consistent stupid trap that JoeG falls into on this issue.  'Common design' is nonsense.  While you are at it remember that 'goo to you' and 'evolution can't explain the formation of the moon' and 'evolution can't explain the origin of life' etc etc etc are raging non sequitors and not part of the discussion at all. -------------- You're obviously illiterate as hell. Peach, bro.-FtK Finding something hard to believe based on the evidence, is science.-JoeG the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat I work on molecular systems with pathway charts and such.-Giggles

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 06 2008,15:24    Quote (Ftk @ Oct. 06 2008,21:09) Quote (Louis @ Oct. 06 2008,15:07) Quote (Ftk @ Oct. 06 2008,20:05)   Quote (Louis @ Oct. 06 2008,14:02)   Quote (Ftk @ Oct. 06 2008,19:37) [SNIP] Louis, in case you've not noticed, Tom has *NOT* responded to a *thing* I've posted.  I wanted to give him ample time to do so without bitching at him like so many of your folks do to me if I don't answer immediately.   [SNIP] O RLY? You must think everyone is as illiterate as you are. Louis Classic Louis response.  Again, need I remind you why I loathe the idea of discussing *anything* with you? Would you like me to link to a post where Tom responds to one of your posts? It takes a matter of minutes to accomplish. Or perhaps you'd like to rephrase your accusation. Louis Tom responded to my last big post?????  Yes, please do link to that.  I've been checking in regularly to see if he's responded, and I haven't seen anything.  Perhaps I missed it. Deary me FTK you can't even read your own posts can you? You didn't say Tom hadn't responded to your LAST post, you said he hadn't responded to a THING you'd posted. Do you understand the difference between those two statements? One is a statement that Tom has never responded to any of your posts (and is demonstrably untrue), the other is that Tom has not responded to your last post (which may well be true, I'll have to check back upthread). Again, the charitable interpretation is that you are merely wrong. However, your "mere wrongness" is very frequent and also takes the same form (i.e. accusations of bias/persecution etc). Hence why I questioned your statement that Tom had not responded to a thing you posted, his responses are a matter of record. A simple example of a claim you made without thinking that is demonstrably wrong. A less charitable interpretation would be that you have deliberately moved the goalposts in a dishonest fashion. Which do you prefer? This of course has absolutely nothing to do with ID/creationism, but it has an enormous amount to do with why your interactions here are so utterly unproductive. I, we, may occasionally mock you, and certainly very few people are charitably disposed towards you (for a variety of reasons, none of which is because you are a creationist whatever you might like to think) and so have little patience for your rather pathetic histrionics. I've told you over and over FTK, you want a pleasant and productive discussion, you need to put in some effort too. The fact that you continually demonstrate that you are unwilling to do so, and that you demonstrate a paranoid lack of intellectual honesty on a daily basis are great sources of comedy for us, but ultimately unsatisfying. Oh and it is abundantly obvious that the reason you "don't want to discuss anything with me EVAR" is because you and I both know I won't let you wriggle off the hook with your usual nonsense. Louis -------------- Bye.

Albatrossity2 Posts: 2780 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,15:30    Quote (Ftk @ Oct. 06 2008,15:22) Dearest Dave, In case you're blind to your own style of addressing me, let me clue you in, love.   You've ridiculed, mocked, insulted and talked down to me since day one.  I've dealt with it, so buck up and take it when the same shit is thrown back at you.  Just answer the questions, and quit whining about being insulted.  Isn't that what I'm always told to do.   One of your first comments to me was addressed "Effthekids".  Don't for one second tell me how to speak to you until you've clean up your own act. Thank you. And, unlike you, I learned from that mistake. And, also unlike you, I do answer the questions. Usually immediately. So thanks, but no thanks, for that bridge to nowhere. -------------- Flesh of the sky, child of the sky, the mind Has been obligated from the beginning To create an ordered universe As the only possible proof of its own inheritance.                         - Pattiann Rogers

Jkrebs Posts: 590 Joined: Sep. 2004 (Permalink) Posted: Oct. 06 2008,15:42    FtK writes - and I think this is pretty hilarious - Quote I said I don't know yet if I accept common design.  I DON'T KNOW...ANY EVERYONE HERE SHOULD KNOW THAT BY NOW.  I TEND TO THINK IT'S A CROCK OF SHIT, BUT I'M NOT ENTIRELY CONVINCED OF THAT YET...HENCE ALL THE QUESTIONS. Actually I think she is confused about whether she means common design or common descent in this paragraph, but I think "I TEND TO THINK IT'S A CROCK OF SHIT, BUT I'M NOT ENTIRELY CONVINCED OF THAT YET..." pretty adequately sums up what is so empty about her point of view.  This is one of those statements that sort of defies rational analysis, so it certainly puts the lie to her claims about being "open-minded" and "wanting to learn."  If you are tending towards thinking that something is a "crock of shit" it's pretty certain that you are not very open to any evidence or arguments that the something is in fact solid science.

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 06 2008,15:54    Quote (Jkrebs @ Oct. 06 2008,21:42) FtK writes - and I think this is pretty hilarious - Quote I said I don't know yet if I accept common design.  I DON'T KNOW...ANY EVERYONE HERE SHOULD KNOW THAT BY NOW.  I TEND TO THINK IT'S A CROCK OF SHIT, BUT I'M NOT ENTIRELY CONVINCED OF THAT YET...HENCE ALL THE QUESTIONS. Actually I think she is confused about whether she means common design or common descent in this paragraph, but I think "I TEND TO THINK IT'S A CROCK OF SHIT, BUT I'M NOT ENTIRELY CONVINCED OF THAT YET..." pretty adequately sums up what is so empty about her point of view.  This is one of those statements that sort of defies rational analysis, so it certainly puts the lie to her claims about being "open-minded" and "wanting to learn."  If you are tending towards thinking that something is a "crock of shit" it's pretty certain that you are not very open to any evidence or arguments that the something is in fact solid science. It's things like this which demonstrate most clearly why I think any approach to discussion with FTK at anything above the high school level is futile. She simply doesn't have the understanding or knowledge to participate in any discussion at any level beyond that. Hence why, in all seriousness, I asked her three incredibly simple questions a few pages back which she has yet to answer (even though I've answered them for her). These answers would require her to make one simple post containing about 10 words in total. Vastly less than she has wasted Blipey's wickedness. Louis -------------- Bye.

csadams Posts: 124 Joined: June 2007 (Permalink) Posted: Oct. 06 2008,15:56    Quote (Ftk @ Oct. 06 2008,11:11) Thank you Cheryl.  I appreciate that.  I'm sorry that I did not make myself clear. ( . . . what did I ask about using other-than-nic names here, J?) This thread's been entertaining to read in a sick sort of way.  It's [b]so[/] much like Couric interviewing Palin . . . the jumbled jargon, not answering direct questions, becoming irritated when pressed for responses, refusing to be pinned down to specifics . . . hell, we don't need no more stinkin' VP debates, we got us a live one here! -------------- Stand Up For REAL Science!

dnmlthr Posts: 565 Joined: Mar. 2008 (Permalink) Posted: Oct. 06 2008,16:07    Quote (Louis @ Oct. 06 2008,21:54) It's things like this which demonstrate most clearly why I think any approach to discussion with FTK at anything above the high school level is futile. She simply doesn't have the understanding or knowledge to participate in any discussion at any level beyond that. Hence why, in all seriousness, I asked her three incredibly simple questions a few pages back which she has yet to answer (even though I've answered them for her). These answers would require her to make one simple post containing about 10 words in total. Vastly less than she has wasted Blipey's wickedness. Louis I think it's pretty obvious by now that ftk isn't at all interested in any form of substantive exchange. She's just been trolling for quite some time. Perhaps it's always been like that, I guess I haven't been around for long enough. -------------- Guess what? I don't give a flying f*ck how "science works" - Ftk

Ftk Posts: 2239 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,16:25    Louis, you knew exactly what I meant in regard to the post Tom hasn't responded to.  Way to fuck up the thread even further. CSADAMS, I was trying to be personally sincere, if that makes any sense at all.  I wasn't trying to reveal something about you. Jack, it's perfectly acceptable to think something is a crock of shit and still look into every aspect of that friggin crock.  That's what I intend to do until I figure out why on earth you are all so convinced that Darwinism is truth beyond all question, that we cannot consider other explanations surrounding our origins because we already know the "facts", and why our students are not allowed to consider the controversial issues surrounding Darwinism. Peace out people....I'm outta here until I have a chance to get back to my last big 'ol post...it may be a few days because I want to get a hold of that book I refered to in an earlier post and see if it is more enlightening than what you what you folks present. [she flounces into the sunset...] -------------- "Evolution is a creationism and just as illogical [as] the other pantheistic creation myths"  -forastero

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 06 2008,16:27    Quote (dnmlthr @ Oct. 06 2008,22:07) Quote (Louis @ Oct. 06 2008,21:54) It's things like this which demonstrate most clearly why I think any approach to discussion with FTK at anything above the high school level is futile. She simply doesn't have the understanding or knowledge to participate in any discussion at any level beyond that. Hence why, in all seriousness, I asked her three incredibly simple questions a few pages back which she has yet to answer (even though I've answered them for her). These answers would require her to make one simple post containing about 10 words in total. Vastly less than she has wasted Blipey's wickedness. Louis I think it's pretty obvious by now that ftk isn't at all interested in any form of substantive exchange. She's just been trolling for quite some time. Perhaps it's always been like that, I guess I haven't been around for long enough. Oh I don't know. 99.99999999999999999% of the time I agree with you completely, the only question being if she is an excellent Loki troll or merely a dullard. There is 0.00000000000000001% of me that thinks she might be sincere. It's gone down considerably since Ilast thought about it. Louis P.S. It's always been like that. Since she first got here people have been trying to get a (scientific, reasonable or even merely sane) discussion going with her. And since then she has pulled exactly the same shit every time anyone has tried to have any form of conversation with her. Even when people haven't been mean, even before they were mean, any excuse has been used by FTK to avoid any examination of her claims. What's even funnier is her continual projection of her own antics and attitudes onto others. Stick around, like creationism and herpes, FTK always flares up are pretty regular intervals. -------------- Bye.

Reciprocating Bill Posts: 4265 Joined: Oct. 2006 (Permalink) Posted: Oct. 06 2008,16:28    The tizzy doth make me dizzy... -------------- Myth: Something that never was true, and always will be. "The truth will set you free. But not until it is finished with you." - David Foster Wallace "Here’s a clue. Snarky banalities are not a substitute for saying something intelligent. Write that down." - Barry Arrington

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: Oct. 06 2008,16:30    Quote (Ftk @ Oct. 06 2008,14:12) News flash, I want to know *how* and *why* common descent supposedly proved to be better in terms of explaining differences & similarities, as well as in making predictions that have been verified by experiment.  I want to know *everything*, and by God, I'll keep asking questions until they're answered to my satisfaction.  I *sure* hope that your students question you further when you give pat answers like that that say absolutely nothing. Common descent appears to explain why every living thing ever is in a nested hierarchy. monophyletic taxon — a grouping that includes all descendants, living and/or extinct, known and unknown, of an inferred common ancestor. Here's a great link that explains really everything you might need to know right now What is evolution and how does it work? And look, they even "admit" it's not perfect       Quote The tree is supported by many lines of evidence, but it is probably not flawless. Scientists constantly reevaluate hypotheses and compare them to new evidence. As scientists gather even more data, they may revise these particular hypotheses, rearranging some of the branches on the tree. For example, evidence discovered in the last 50 years suggests that birds are dinosaurs, which required adjustment to several "vertebrate twigs." However I think FTK you would be most intested in this section entitled       Quote Has the explosion of phylogenetic research confirmed or overturned our ideas on relationships? The answer is: both! Tree of Life - Surprises Especially this       Quote Phylogenetic studies are also uncovering totally unexpected relationships. This is especially true for microorganisms, where little visible structural evidence is available. Here, DNA sequences are providing data that are fundamentally changing our understanding of relationships. As it appears to me that your question is answered there - if it seems to you that common descent can make sense of all this then can common design also make sense of the data? On that same page they observe       Quote We have also discovered that fungi are more closely related to animals than to plants, and that within the animals the segmented worms (annelids) are more closely related to the unsegmented molluscs (snails, clams and squids) than they are to segmented arthropods (spiders, lobsters, millipedes and insects). Does common design predict that fungi are more closely related to animals then to plants? Can common design explain the patterns shown at the links above and the image below? A more mathematical approach is shown here http://plus.maths.org/issue46/features/phylogenetics/index.html where they conclude     Quote Phylogenetics pushes the boundaries of known mathematics and more problems are sure to follow. Scientists are starting to think that Darwin's binary rooted tree may not be the best picture to have in mind. Certain species can hybridise and some bacteria can transfer genes directly from individual to individual. It may therefore be better to use more general graph theoretical objects, networks, rather than trees. Even if you do accept that evolution progresses in a largely tree-like fashion this is a useful approach. It seems to me that given all the ways of visualising the data (and yet more data is being produced every day) then "common design" would stick out like a sore thumb - it would not follow the pattern so far observed. It would be obvious that something was different. This tree contains 3,000 species representing the lineages of some 30,000 flowering plants http://www.peabody.yale.edu/exhibits/treeoflife/challenge.html FTK, would it look like that if common design was true? What would be different? If common design was true why would everything appear to branch? Would it not just be like  straight spokes on a wheel? -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: Oct. 06 2008,16:31    Quote (Ftk @ Oct. 06 2008,16:25) Peace out people....I'm outta here until I have a chance to get back to my last big 'ol post...it may be a few days because I want to get a hold of that book I refered to in an earlier post and see if it is more enlightening than what you what you folks present. [she flounces into the sunset...] I'd better PM you the link to my last post then, just in case you "miss" it. -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 06 2008,16:34    Quote (Ftk @ Oct. 06 2008,22:25) Louis, you knew exactly what I meant in regard to the post Tom hasn't responded to.  Way to fuck up the thread even further. CSADAMS, I was trying to be personally sincere, if that makes any sense at all.  I wasn't trying to reveal something about you. Jack, it's perfectly acceptable to think something is a crock of shit and still look into every aspect of that friggin crock.  That's what I intend to do until I figure out why on earth you are all so convinced that Darwinism is truth beyond all question, that we cannot consider other explanations surrounding our origins because we already know the "facts", and why our students are not allowed to consider the controversial issues surrounding Darwinism. Peace out people....I'm outta here until I have a chance to get back to my last big 'ol post...it may be a few days because I want to get a hold of that book I refered to in an earlier post and see if it is more enlightening than what you what you folks present. [she flounces into the sunset...] No FTK you said one thing (Tom has not replied to a thing you have posted) and claim you meant another (Tom has not replied to your most recent post). You could just say "oh sorry, I was wrong, what I meant to say was that Tom hasn't replied to my most recent post" and guess what, I'd cheerfully say "no worries FTK, we all make mistakes". Your continual refusal to admit even trivial errors and to lie about them (which goalpost moving is btw) is just one of the hilarious things that prevent decent discussion. Trying to claim I know what you meant is ridiculous, not only do you NOT know what I know, but you are demonstrably trying to avoid a tiny, simple, error of your own making. Sort yourself out. Louis P.S. And also, yet again, your dishonest assertion is that we are all dogmatic Darwinists who never consider "alternatives". Do you have any idea how untrue, and how insulting btw, that is? And yet you claim to desire pleasant discourse. Way to start! How do you think people know that ID/creationism is a failed explanation if they've never considered it? The sad fact is FTK, you know less about your own claimed beliefs in ID/creationism than anyone here knows about them. Tragic really. -------------- Bye.

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 06 2008,16:37    Quote (Reciprocating Bill @ Oct. 06 2008,22:28) The tizzy doth make me dizzy... The dumb doth make me glum..... -------------- Bye.

JohnW Posts: 3217 Joined: Aug. 2006 (Permalink) Posted: Oct. 06 2008,16:46    Quote (Ftk @ Oct. 06 2008,14:25) Jack, it's perfectly acceptable to think something is a crock of shit and still look into every aspect of that friggin crock. FTK, I think you have a point here.  It's why I keep going back to Uncommonly Dense.  Of course, it certainly helps that Dr Dr Dembski's Daycare is one of the funniest sites on the whole intertubes. Quote (Ftk @ Oct. 06 2008,14:25) That's what I intend to do until I figure out why on earth you are all so convinced that Darwinism is truth beyond all question, that we cannot consider other explanations surrounding our origins because we already know the "facts"... But you don't have a point here.  We can consider other expanations, based on the evidence to support them.  And every type of creationism I've seen has: at best, no evidence in its favour; more typically, a ton of evidence against it; at worst (not mentioning Walt Brown by name here), would require us to ignore virtually every experimental and observational result from the last five centuries, across the whole of science. Quote (Ftk @ Oct. 06 2008,14:25) ...and why our students are not allowed to consider the controversial issues surrounding Darwinism. On the assumption that by "controversial issues" you mean evolution vs. creationism, see above.  No evidence.  No controversy. -------------- Math is just a language of reality. Its a waste of time to know it. - Robert Byers There isn't any probability that the letter d is in the word "mathematics"...  The correct answer would be "not even 0" - JoeG

Albatrossity2 Posts: 2780 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,16:48    Quote (Ftk @ Oct. 06 2008,16:25) Jack, it's perfectly acceptable to think something is a crock of shit and still look into every aspect of that friggin crock.  That's what I intend to do until I figure out why on earth you are all so convinced that Darwinism is truth beyond all question, that we cannot consider other explanations surrounding our origins because we already know the "facts", and why our students are not allowed to consider the controversial issues surrounding Darwinism. Ermm, you do realize, of course, that exactly none of those things is true. Three strawmen in a single sentence may be a record, even for you! 1. Everybody here understands that science is provisional, and that "Darwinism" itself has been superseded by other more useful explanatory frames. Nobody rational has ever said that "Darwinism is truth beyond all question". 2. The only people who claim to know all the facts are creationists. No scientist would ever make that claim. 3. As for exposing our students to "controversial issues surrounding Darwinism", there are no scientific controversies other than to mention that "Darwinism" died out about 100 years ago. If you want to expose them to dead scientific controversies, you won't find much support for that in the science or education communities. If you want to expose them to your faux controversies based on the problems that reality poses for your religious views, they can get that in non-science classes, or in Sunday School. So if that is all you needed to help you figure this out, I'm glad to be able to help. -------------- Flesh of the sky, child of the sky, the mind Has been obligated from the beginning To create an ordered universe As the only possible proof of its own inheritance.                         - Pattiann Rogers

dnmlthr Posts: 565 Joined: Mar. 2008 (Permalink) Posted: Oct. 06 2008,16:52    Quote (oldmanintheskydidntdoit @ Oct. 06 2008,22:31) I'd better PM you the link to my last post then, just in case you "miss" it. As a sidenote, in a course I'm currently taking on programming paradigms, bioinformatics has been a recurring theme. So far we've done some simple calculations such as distance matrices and building phylogenetic trees based on those. Interesting stuff. I know this isn't the thread for it, but do you know of any resources where I could look up amino acid and DNA sequences? We've got some test data to play with, but I don't know if it's the genuine article... -------------- Guess what? I don't give a flying f*ck how "science works" - Ftk

Assassinator Posts: 479 Joined: Nov. 2007 (Permalink) Posted: Oct. 06 2008,16:52    Quote (Ftk @ Oct. 06 2008,09:13)   Quote (Assassinator @ Oct. 06 2008,08:57)   Quote (Ftk @ Oct. 06 2008,08:42)     Quote (Assassinator @ Oct. 06 2008,07:57) Could you be so kind and also show wich comments from blipey you did not show. How can I do that?  I deleted them.  It's his tone that I simply can't abide by anymore.  He pisses everyone off and deteriorates every single post he's on.  I have to go through and delete all kinds of crap when he gets on a roll.  Other posters get put off with him, and they start swinging so I have to delete their comments as well. I WANT HIM GONE, AND I WANT TO KNOW WHAT IT WILL TAKE TO GET HIM TO LEAVE. I'm willing to make a deal here.  I've had it. So I should just trust you when you say he's all those things you call him? It would be nice if there would be actual evidence wich supports your claims, try to gather some. Sigh....of course it would be too much to ask that you trust a "creationist".   Look, I just want to know what it would take to get blipey off my blog.  I'll await his response. You being a creationist has nothing to do with it. You make a claim, support it. Creationist or not. O and by the way, this post from OM isn't violent or anything against you. It's right down on the subjects. So, will you adress this? That would show you would actually care about the subjects and care about answers. Are you? Now is your time to show it.

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: Oct. 06 2008,17:12    Quote (dnmlthr @ Oct. 06 2008,16:52)       Quote (oldmanintheskydidntdoit @ Oct. 06 2008,22:31) I'd better PM you the link to my last post then, just in case you "miss" it. As a sidenote, in a course I'm currently taking on programming paradigms, bioinformatics has been a recurring theme. So far we've done some simple calculations such as distance matrices and building phylogenetic trees based on those. Interesting stuff. I know this isn't the thread for it, but do you know of any resources where I could look up amino acid and DNA sequences? We've got some test data to play with, but I don't know if it's the genuine article... At some point I'll get my OpenGL skills out and program something (simple) along those lines, but at the moment I'm more into 3D and trying to learn about the GPGPU powerhouse I have sitting in my PC. GTX 280 don't ya know This seems to be what you want http://www.bioscience.org/urllists/protdb.htm but many of the links appear dead. I've nothing more specific I'm afraid, I'm only an interested amateur. :D EDIT: the specific pages linked to are out of date, but the domains are usually there. EDIT EDIT: Yay, DNA! http://rsat.scmbb.ulb.ac.be/rsat/ GATGTGTTACACATGCATCAACTATTTACATCTATCCTTGTTCACCCAAGCATGTCACTG -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

blipey Posts: 2061 Joined: June 2006 (Permalink) Posted: Oct. 06 2008,17:12    Ftk: Quote I like your idea about a blipey thread.  I don't know if I'm able to start a topic, but I'll try it.  I'm limited on some functions here.  I do think that if I posted all of his comments, he'd simmer down a bit.  He's still only posted 1 comment at my blog today.  That's is a wonderful improvement. Hmmmm.  Didn't I suggest that you do that exact thing?  Several months ago I told you to do that.  I started doing it myself.  Then just today, in this comment, I suggested the same. Passing strange that you didn't see that.  Oh, wait.  You don't see anything that you disagree with. Don't worry; I'll still post at your blog.  Nothings gone on today: no new posts, no new comments, nothing.  I'll do as usual and wait a day or two to see if you address any of the on-topic posts I made and you erased.  Then I'll remind you of them. Or, if you decide to post something else that I find interesting, I may comment on that. Or, if Larry ever explains what foreign leaders with no governing experience have to do with electing a US VP, I'll probably comment on that. -------------- But I get the trick question- there isn't any such thing as one molecule of water. -JoeG And scientists rarely test theories. -Gary Gaulin

Reciprocating Bill Posts: 4265 Joined: Oct. 2006 (Permalink) Posted: Oct. 06 2008,18:00    Hey, Ftk, since you "hat tip" and link to Young Cosmos in your recent post vis Skilling, drawing readers to Salvador's bog, er, blog, are you also down with his four consecutive headlines referencing representative "Barney Fag?" -------------- Myth: Something that never was true, and always will be. "The truth will set you free. But not until it is finished with you." - David Foster Wallace "Here’s a clue. Snarky banalities are not a substitute for saying something intelligent. Write that down." - Barry Arrington

stevestory Posts: 13407 Joined: Oct. 2005 (Permalink) Posted: Oct. 06 2008,18:42    Quote (Reciprocating Bill @ Oct. 06 2008,19:00) Hey, Ftk, since you "hat tip" and link to Young Cosmos in your recent post vis Skilling, drawing readers to Salvador's bog, er, blog, are you also down with his four consecutive headlines referencing representative "Barney Fag?" WHAT?!?!?! Surely not. (goes to Young Cosmos.) http://youngcosmos.com/blog/ Quote Obama and Barney Fag’s Darwinist Hypocrisy exposed Comments (0) Posted in Uncategorized by scordova @ Oct 2, 2008 ... Darwinist Barney Fag likened to a pimp complaning about STD’s Comments (0) Posted in Uncategorized by scordova @ Oct 2, 2008 Darwinist Barney Fag has been rightly criticized for his role in bringing the country on the brink of financial crisis: ... Discovery Institute on the Bush/Barney Fag Bailout Plan Comments (0) Posted in Uncategorized by scordova @ Sep 26, 2008 ... Risk manager criticizes Bush and Barney Fag’s Bailout Plan Comments (0) Posted in Uncategorized by scordova @ Sep 26, 2008 The mathematics of risk managment can actually be successfully used to refute Darwinism. I like risk managers. Here is one risk manager trashing the Bush /Barney Fag bailout plan: Wow. That Salvador's a heck of a guy.

stevestory Posts: 13407 Joined: Oct. 2005 (Permalink) Posted: Oct. 06 2008,18:45    the funny thing about that last post is, "The mathematics of risk management" didn't even correctly model the financial instruments' risk, let alone jump fields into Darwinism.

Pages: (341) < ... 322 323 324 325 326 [327] 328 329 330 331 332 ... >

Track this topic	Email this topic	Print this topic

© 2002-2009 Antievolution.org Powered by Ikonboard 3.0.2a © 2001 Ikonboard