Antievolution.org :: Antievolution.org Discussion Board The Critic's Resource on Antievolution

Antievolution.org Discussion Board > From the Panda's Thumb > After the Bar Closes... > UnReasonable Kansans thread

Pages: (341) < ... 323 324 325 326 327 [328] 329 330 331 332 333 ... >

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: Oct. 06 2008,19:16    Dang! Why does all the drama always happen when I'm not around -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Reed Posts: 274 Joined: Feb. 2008 (Permalink) Posted: Oct. 06 2008,19:29    Quote (Ftk @ Oct. 06 2008,13:05) No, I did answer that somewhere.  I said I don't know yet if I accept common design. The question was about common descent, not design. If you really mean common design, then I think you find wide agreement here that it is almost certainly a crock. But assuming that is just a slip of the finger, you haven't really answered the question. Humans and other great apes could (and indeed, almost certainly do) share a common ancestor even if common descent wasn't universal.

Erasmus, FCD Posts: 6349 Joined: June 2007 (Permalink) Posted: Oct. 06 2008,20:07    ah hell reed who knows what the fuck she is talking about.  it's shore as hell clear to me that she doesn't. -------------- You're obviously illiterate as hell. Peach, bro.-FtK Finding something hard to believe based on the evidence, is science.-JoeG the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat I work on molecular systems with pathway charts and such.-Giggles

Reed Posts: 274 Joined: Feb. 2008 (Permalink) Posted: Oct. 06 2008,20:13    BTW, here is a reasonable approximation of a phylogenetic tree web of a family of entities that are actually related by descent with modification and common design. The methodology isn't particularly rigorous (the author has probably forced it to be more tree-like than it should be, and has left out a lot of minor cross-breeding), but IMO it is good enough to be representative. If you set out to organize these systems by common characteristics (whether in source code, functionality, interface compatibility, organization) you won't get a nice nested hierarchy like this http://upload.wikimedia.org/wikiped....SVG.svg No matter what how you tweak your criteria (if you do it honestly) it just won't work. Why not ? and yes, I would edit to add that to the previous post, if I could Erasmus: Whatever it is, won't someone please think of the children!

Ftk Posts: 2239 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,20:52    Quote (Reed @ Oct. 06 2008,19:29) Quote (Ftk @ Oct. 06 2008,13:05) No, I did answer that somewhere.  I said I don't know yet if I accept common design. The question was about common descent, not design. If you really mean common design, then I think you find wide agreement here that it is almost certainly a crock. But assuming that is just a slip of the finger, you haven't really answered the question. Humans and other great apes could (and indeed, almost certainly do) share a common ancestor even if common descent wasn't universal. F*ck.  I meant common descent.  It's difficult to keep up with responding to all you folks without making typos here and there.  I wish I could have my edit button, but no doubt the moderators enjoy the fact that I can't correct my typos. -------------- "Evolution is a creationism and just as illogical [as] the other pantheistic creation myths"  -forastero

Ftk Posts: 2239 Joined: Mar. 2007 (Permalink) Posted: Oct. 06 2008,21:00    Quote (Reed @ Oct. 06 2008,20:13) BTW, here is a reasonable approximation of a phylogenetic tree web of a family of entities that are actually related by descent with modification and common design. The methodology isn't particularly rigorous (the author has probably forced it to be more tree-like than it should be, and has left out a lot of minor cross-breeding), but IMO it is good enough to be representative. If you set out to organize these systems by common characteristics (whether in source code, functionality, interface compatibility, organization) you won't get a nice nested hierarchy like this http://upload.wikimedia.org/wikiped....SVG.svg No matter what how you tweak your criteria (if you do it honestly) it just won't work. Why not ? and yes, I would edit to add that to the previous post, if I could ;) Erasmus: Whatever it is, won't someone please think of the children! That's what really kills me.  Why the hell won't you give Reed an edit button?  WTF?  You run off Richard, you won't hand out edit buttons.  Jeez....yet it's just those dratted creationists who are such unfair moderators.  I guarantee that if UD posters inundated this place like you folks do to them, you'd be whipping out the ban button all the time. Yes, I know....the rule is to never question the moderating policy in public.  Sigh... -------------- "Evolution is a creationism and just as illogical [as] the other pantheistic creation myths"  -forastero

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: Oct. 06 2008,21:19    Quote (Ftk @ Oct. 06 2008,21:00) Quote (Reed @ Oct. 06 2008,20:13) BTW, here is a reasonable approximation of a phylogenetic tree web of a family of entities that are actually related by descent with modification and common design. The methodology isn't particularly rigorous (the author has probably forced it to be more tree-like than it should be, and has left out a lot of minor cross-breeding), but IMO it is good enough to be representative. If you set out to organize these systems by common characteristics (whether in source code, functionality, interface compatibility, organization) you won't get a nice nested hierarchy like this http://upload.wikimedia.org/wikiped....SVG.svg No matter what how you tweak your criteria (if you do it honestly) it just won't work. Why not ? and yes, I would edit to add that to the previous post, if I could ;) Erasmus: Whatever it is, won't someone please think of the children! That's what really kills me.  Why the hell won't you give Reed an edit button?  WTF?  You run off Richard, you won't hand out edit buttons.  Jeez....yet it's just those dratted creationists who are such unfair moderators.  I guarantee that if UD posters inundated this place like you folks do to them, you'd be whipping out the ban button all the time. Yes, I know....the rule is to never question the moderating policy in public.  Sigh... Enough with all the drama and temper tantrumming. Before you scared Tom off, we were discussing Tiktaalik and australopithicine jaws and in the meantime I even found you a picture of the Tiktaalik wrist. We could always go back to discussing that... -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

blipey Posts: 2061 Joined: June 2006 (Permalink) Posted: Oct. 06 2008,21:21    First of all, you didn't question the moderation policy.  Did you learn English in school or merely attempt an ESL class? Amazingly, what you did is make a prediction.  Something you have been loathe to do before.  I find it odd that you derail one of the few positive things you've managed to do by pulling out the persecution card.  Awesome. Second of all, do you ever wonder why the UD crowd doesn't post here? Thirdly, do you really think they'd be banned here? Fourthly, you are aware that you are still allowed to post here?  You are aware that AFDave posted here for thousands of comments?  You are aware that DaveScot posted here for awhile, before he went wiggy? You should look these things up before you post. -------------- But I get the trick question- there isn't any such thing as one molecule of water. -JoeG And scientists rarely test theories. -Gary Gaulin

Jkrebs Posts: 590 Joined: Sep. 2004 (Permalink) Posted: Oct. 06 2008,21:36    FtK says, Quote it's perfectly acceptable to think something is a crock of shit and still look into every aspect of that friggin crock. I find this more perverse and bizarre than "perfectly acceptable."  If one thinks something is a "crock of shit"*, then, as is amply demonstrated by FtK, one's investigation is likely to be nothing more than a continual discovery of more shit.  She doesn't really "look into" the friggin' crock with the intent of really understanding it, but rather merely with the intent of continually reinforcing her existing judgment.  She is a radical skeptic in respect to the issues we discuss, and no amount of evidence or argument is going to put a dent in her beliefs.  It's a crock of shit, and she knows it.  "Looking into it" is a disingenuous facade. * I don't usually use crude language such as this, but the metaphor is such an apt expression for her attitude that I stuck with it.

Henry J Posts: 5786 Joined: Mar. 2005 (Permalink) Posted: Oct. 06 2008,21:50    Quote Who is this Bipley person?  I'd stop that bastard as well; his name is stoopid! That must be the name of your evil twin. Henry

Henry J Posts: 5786 Joined: Mar. 2005 (Permalink) Posted: Oct. 06 2008,21:51    Quote (afarensis @ Oct. 06 2008,18:16) Dang! Why does all the drama always happen when I'm not around ??? Design?

Reed Posts: 274 Joined: Feb. 2008 (Permalink) Posted: Oct. 06 2008,22:29    Quote (Ftk @ Oct. 06 2008,19:00) Jeez....yet it's just those dratted creationists who are such unfair moderators. Your concern is touching, but it the reason for the current policy is quite clear. On the plus side, it encourages me to slow down and think about what I write. Restricting the ability to edit existing posts isn't remotely comparable banning people from UD for making clear, logical, well argued points that happen to be damaging to the ID position. The latter is censorship, while the former is not. Now how explaining why we see clear nested hierarchies in the natural world, but not in things that are known products of common design ? Do you disagree that cars or operating systems are examples of common design ? Can you convincingly arrange them into nested hierarchies by comparing their traits ? Can you show that the science of Phylogenetic systematics is flawed such that the nested hierarchies we detect natural world aren't real* ? If not, how do you defend your position that common design explains the data just as well as common descent ? * If you can, then you will put a bigger dent in "darwinism" than the entire ID/creationist movement has to date. Dr Dr Dembski is a mathematician, so this should be right up his alley.

stevestory Posts: 13407 Joined: Oct. 2005 (Permalink) Posted: Oct. 06 2008,23:14    I've been getting some PMs and IMs about whether I really think Ftk is a Loki Troll*. Well, I won't reveal all my thoughts on the matter, but I might as well post some of it publicly: Quote Well, I used to think she was sincere. But the longer it goes the less I think that. I increasingly think she's a Loki troll, and the evidence mostly centers around one recurrent observation: she misunderstands everything everyone says to her, all the time. Person A: Darwin was an Anglican who wrote about newts. FtK: How do NEWTS Prove he was an ANGLICAN??!?! SHeesh!!!!!! PersonB: We didn't ban that person from AtBC. Ftk: You expect me to BELIEVE that no Darwinist has ever banned anyone from a website??!?!?!!! Where's your evidence?!?!?!!111 PersonC: Two medical doctors discovered that in 1971. Ftk: Oh, I GET IT, only DOCTORS can understand science, now I see, you elitist Jackass!!1111eleventwelve! and she's like that day in, day out, morning, day, night, afternoon, relentlessly misunderstanding the most basic statements, turning any discussion into a hopeless morass. And it just seems like if you had the brains god gave a Louis you'd at least get something right, sometime. Her misunderstanding streak is untouchable. It defies belief. So I'm going with the idea that she's a Loki troll. And I think she's pissed that I'm onto her, and that's why she's been so belligerent and aggro lately. I really don't want to believe she's genuine, because that would make her borderline retarded. Can you imagine if you or I, who've never seen a Fugu fish, were to go to, say, a Fugu Chef discussion board, and login, and just start telling 50 Fugu Chefs that they were doing it all wrong, and they should do it like this, and they're all Nips on a Daily Basis etc etc, and the chefs ask you to prepare a Fugu your way and you say well If my restaurants had the funding you guys have I would, etc, and after 500 days of the Fugu Chefs telling you Ur Doin it Rong you say no, no, I found this guy named Walt-san who was a Mackerel wholesaler in Chile in the 1890s and he says Fugu needs to be cooked at 2700ş for 14 days and they tell you you're crazy and you demand that they call up Walt-san and have long, heart to heart discussions about where to get right kind of molten lava to give it that extra-crisp crust. Can you imagine doing that for years at a time? No. It's too absurd to be real. She's a Loki troll. *("Loki Troll" from Urban Dictionary: Quote loki troll It is a troll posting a straw man of a position while subscribing to the opposite position. The term originated in TalkOrigins.org where evolutionists pretending to be anti-evolutionists posted inflammatory and ridiculous arguments against evolution. Loki troll: Evolution is wrong, tobacco is more advanced than humans because it has 48 chromosomes while humans ONLY have 46! (actual "dr." Kent Hovind quote)

dnmlthr Posts: 565 Joined: Mar. 2008 (Permalink) Posted: Oct. 07 2008,01:16    Quote (oldmanintheskydidntdoit @ Oct. 06 2008,23:12) Quote (dnmlthr @ Oct. 06 2008,16:52)         Quote (oldmanintheskydidntdoit @ Oct. 06 2008,22:31) I'd better PM you the link to my last post then, just in case you "miss" it. As a sidenote, in a course I'm currently taking on programming paradigms, bioinformatics has been a recurring theme. So far we've done some simple calculations such as distance matrices and building phylogenetic trees based on those. Interesting stuff. I know this isn't the thread for it, but do you know of any resources where I could look up amino acid and DNA sequences? We've got some test data to play with, but I don't know if it's the genuine article... At some point I'll get my OpenGL skills out and program something (simple) along those lines, but at the moment I'm more into 3D and trying to learn about the GPGPU powerhouse I have sitting in my PC. GTX 280 don't ya know This seems to be what you want http://www.bioscience.org/urllists/protdb.htm but many of the links appear dead. I've nothing more specific I'm afraid, I'm only an interested amateur. :D EDIT: the specific pages linked to are out of date, but the domains are usually there. EDIT EDIT: Yay, DNA! http://rsat.scmbb.ulb.ac.be/rsat/ GATGTGTTACACATGCATCAACTATTTACATCTATCCTTGTTCACCCAAGCATGTCACTG Nice, thanks! -------------- Guess what? I don't give a flying f*ck how "science works" - Ftk

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: Oct. 07 2008,03:12    Edited in light of a PM from FTK. We'll see what happens. -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

Jkrebs Posts: 590 Joined: Sep. 2004 (Permalink) Posted: Oct. 07 2008,06:49    FtK is a real person - some of us know who she is - and she isn't a Loki troll.

Stephen Elliott Posts: 1776 Joined: Oct. 2005 (Permalink) Posted: Oct. 07 2008,07:15    Quote (Ftk @ Oct. 06 2008,15:22) Dearest Dave, In case you're blind to your own style of addressing me, let me clue you in, love.   You've ridiculed, mocked, insulted and talked down to me since day one.  I've dealt with it, so buck up and take it when the same shit is thrown back at you.  Just answer the questions, and quit whining about being insulted.  Isn't that what I'm always told to do.   One of your first comments to me was addressed "Effthekids".  Don't for one second tell me how to speak to you until you've clean up your own act. Thank you. A tad off-topic. Have you noticed how you are still allowed to post here? Can you not spot the difference yet between science and lies?

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 07 2008,07:56    Quote (Jkrebs @ Oct. 07 2008,12:49) FtK is a real person - some of us know who she is - and she isn't a Loki troll. Ah yes, I'd forgotten about that. However, your post could be part of an elaborate charade designed to disguise FTK's Loki status. This is Teh IntarNetz of course. Is she really as barmy in real life as she is here? Louis -------------- Bye.

J-Dog Posts: 4402 Joined: Dec. 2006 (Permalink) Posted: Oct. 07 2008,08:07    Quote (Louis @ Oct. 07 2008,07:56) Quote (Jkrebs @ Oct. 07 2008,12:49) FtK is a real person - some of us know who she is - and she isn't a Loki troll. Ah yes, I'd forgotten about that. However, your post could be part of an elaborate charade designed to disguise FTK's Loki status. This is Teh IntarNetz of course. Is she really as barmy in real life as she is here? Louis I KNOW!  I KNOW!  OH!~  CALL ON ME!! "Is she really as barmy in real life as she is here?" Yes. -------------- Come on Tough Guy, do the little dance of ID impotence you do so well. - Louis to Joe G 2/10 Gullibility is not a virtue - Quidam on Dembski's belief in the Bible Code Faith Healers & ID 7/08 UD is an Unnatural Douchemagnet. - richardthughes 7/11

blipey Posts: 2061 Joined: June 2006 (Permalink) Posted: Oct. 07 2008,09:02    SPAM ALERT!!!! Quote Seriously?  I'm going to have to put you down as racist, now.  You've actually managed to disappoint me; I didn't think that was possible. Argument number one from the video: We can't elect a man with 3 Muslim names. Srsly!!!111!!!eleventwelve! What about a person with a Norse name (Erik), an Irish name (Pierce), a French name (Charles)?  Are these people not to be elected based on their names?  Srsly? Another argument from the video: He didn't repudiate Rev. Wright.  To prove this, they edited an interview clip to truncated the part where Obama repudiated what Wright said.  As a Christian are you not supposed to repudiate the actions and love the man?  Christ said that, I believe; you may want to check. Some of the other arguments from the video (Wife not being proud of America until recently, opening negotiations with terrorists, etc) are so filled with assertions and absent facts and evidence that it is hard to comment on them.  If you'd like to discuss one of those points, however, pick the point and we'll discuss it. Not appearing here for very long. edited to lean up formatting -------------- But I get the trick question- there isn't any such thing as one molecule of water. -JoeG And scientists rarely test theories. -Gary Gaulin

stevestory Posts: 13407 Joined: Oct. 2005 (Permalink) Posted: Oct. 07 2008,11:14    Quote (Jkrebs @ Oct. 07 2008,07:49) FtK is a real person - some of us know who she is - and she isn't a Loki troll. Maybe she's Loki trolling you in real life  :D i just find it impossible to believe that someone can misunderstand everything, all the time, for years.

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: Oct. 07 2008,11:53    http://ecoworldly.com/2008....st-lake   Quote In what could be a first in the world, a fish species known as cichlids has been observed by scientists in the act of splitting into two distinct species in Lake Victoria, Africa’s largest lake and one of the world’s biggest fresh water bodies. This may be remarkable because what is causing them to diverge are adaptations to their vision as animals and plants try to cope with increased pollution and the effects of climate change. The change is also happening without geographical isolation, which was thought to be a precursor for evolution. ... Researchers looked at two species, conspicuous by their red or blue colours. They determined through lab experiments that certain genetic mutations helped some fish adapt their vision at deeper levels to see the colour red and others in shallower water to recognise shades of blue. Hmm. No intelligent designer in sight. -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

JohnW Posts: 3217 Joined: Aug. 2006 (Permalink) Posted: Oct. 07 2008,12:11    Quote (oldmanintheskydidntdoit @ Oct. 07 2008,09:53) http://ecoworldly.com/2008....st-lake   Quote In what could be a first in the world, a fish species known as cichlids has been observed by scientists in the act of splitting into two distinct species in Lake Victoria, Africa’s largest lake and one of the world’s biggest fresh water bodies. This may be remarkable because what is causing them to diverge are adaptations to their vision as animals and plants try to cope with increased pollution and the effects of climate change. The change is also happening without geographical isolation, which was thought to be a precursor for evolution. ... Researchers looked at two species, conspicuous by their red or blue colours. They determined through lab experiments that certain genetic mutations helped some fish adapt their vision at deeper levels to see the colour red and others in shallower water to recognise shades of blue. Hmm. No intelligent designer in sight. [FTK] But they're still fish!!!!  They're not laying cat eggs!!!!!!  This disproves Darwin!!!!!!!!!  Therefore Goddidit!!!!!!!!111111111111 [/FTK] -------------- Math is just a language of reality. Its a waste of time to know it. - Robert Byers There isn't any probability that the letter d is in the word "mathematics"...  The correct answer would be "not even 0" - JoeG

carlsonjok Posts: 3326 Joined: May 2006 (Permalink) Posted: Oct. 07 2008,12:13    Quote (oldmanintheskydidntdoit @ Oct. 07 2008,11:53) http://ecoworldly.com/2008....st-lake   Quote In what could be a first in the world, a fish species known as cichlids has been observed by scientists in the act of splitting into two distinct species in Lake Victoria, Africa’s largest lake and one of the world’s biggest fresh water bodies. This may be remarkable because what is causing them to diverge are adaptations to their vision as animals and plants try to cope with increased pollution and the effects of climate change. The change is also happening without geographical isolation, which was thought to be a precursor for evolution. ... Researchers looked at two species, conspicuous by their red or blue colours. They determined through lab experiments that certain genetic mutations helped some fish adapt their vision at deeper levels to see the colour red and others in shallower water to recognise shades of blue. Hmm. No intelligent designer in sight. Possible responses: 1.  They are still just fish (*shakes fist at JohnW*) 2.  You don't call color-blind people a separate species, so why are you doing so for fish? 3.  One is losing it's ability to see certain colors because all mutations are deleterious (because of Teh Fall). -------------- It's natural to be curious about our world, but the scientific method is just one theory about how to best understand it.  We live in a democracy, which means we should treat every theory equally. - Steven Colbert, I Am America (and So Can You!)

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 07 2008,12:40    Quote (stevestory @ Oct. 07 2008,17:14) Quote (Jkrebs @ Oct. 07 2008,07:49) FtK is a real person - some of us know who she is - and she isn't a Loki troll. Maybe she's Loki trolling you in real life  :D i just find it impossible to believe that someone can misunderstand everything, all the time, for years. Whilst I am tempted to agree with you, I have another two words: Ken Ham. Some people are batshit insane their whole lives. Why not FTK? Louis -------------- Bye.

J-Dog Posts: 4402 Joined: Dec. 2006 (Permalink) Posted: Oct. 07 2008,13:58    Quote (Louis @ Oct. 07 2008,12:40) Quote (stevestory @ Oct. 07 2008,17:14) Quote (Jkrebs @ Oct. 07 2008,07:49) FtK is a real person - some of us know who she is - and she isn't a Loki troll. Maybe she's Loki trolling you in real life  :D i just find it impossible to believe that someone can misunderstand everything, all the time, for years. Whilst I am tempted to agree with you, I have another two words: Ken Ham. Some people are batshit insane their whole lives. Why not FTK? Louis Bonus Points for playing the Kent Hovind card? -------------- Come on Tough Guy, do the little dance of ID impotence you do so well. - Louis to Joe G 2/10 Gullibility is not a virtue - Quidam on Dembski's belief in the Bible Code Faith Healers & ID 7/08 UD is an Unnatural Douchemagnet. - richardthughes 7/11

J-Dog Posts: 4402 Joined: Dec. 2006 (Permalink) Posted: Oct. 07 2008,13:58    Quote (Louis @ Oct. 07 2008,12:40) Quote (stevestory @ Oct. 07 2008,17:14)   Quote (Jkrebs @ Oct. 07 2008,07:49) FtK is a real person - some of us know who she is - and she isn't a Loki troll. Maybe she's Loki trolling you in real life  :D i just find it impossible to believe that someone can misunderstand everything, all the time, for years. Whilst I am tempted to agree with you, I have another two words: Ken Ham. Some people are batshit insane their whole lives. Why not FTK? Louis Do I get Bonus Points for playing the Kent Hovind card? -------------- Come on Tough Guy, do the little dance of ID impotence you do so well. - Louis to Joe G 2/10 Gullibility is not a virtue - Quidam on Dembski's belief in the Bible Code Faith Healers & ID 7/08 UD is an Unnatural Douchemagnet. - richardthughes 7/11

Louis Posts: 6436 Joined: Jan. 2006 (Permalink) Posted: Oct. 07 2008,14:07    Quote (J-Dog @ Oct. 07 2008,19:58) Quote (Louis @ Oct. 07 2008,12:40)   Quote (stevestory @ Oct. 07 2008,17:14)   Quote (Jkrebs @ Oct. 07 2008,07:49) FtK is a real person - some of us know who she is - and she isn't a Loki troll. Maybe she's Loki trolling you in real life  :D i just find it impossible to believe that someone can misunderstand everything, all the time, for years. Whilst I am tempted to agree with you, I have another two words: Ken Ham. Some people are batshit insane their whole lives. Why not FTK? Louis Do I get Bonus Points for playing the Kent Hovind card? Yes. Both times. And your answer to the question above btw, it was teh good. Louis -------------- Bye.

blipey Posts: 2061 Joined: June 2006 (Permalink) Posted: Oct. 07 2008,16:51    On the off-chance that she still wants to play (what is it abut creationists that makes them all surprised and shit when a person does exactly what they said they were going to do?): Quote Okay, really. What kind of person who has graduated third grade opens their argument with, "We can't afford to have a President with 3 Muslim names"? I mean, seriously, what about a guy with two French names?  Is that okay?  Exactly what are the name criteria?  Maybe someone should spell them out so we all know. Not appearing on the same thread as above because of its obvious off-topic nature :) -------------- But I get the trick question- there isn't any such thing as one molecule of water. -JoeG And scientists rarely test theories. -Gary Gaulin

Erasmus, FCD Posts: 6349 Joined: June 2007 (Permalink) Posted: Oct. 07 2008,20:01    all i wanna say is Stevestory that is some hilarious shit you and Louis are PMing when you aren't making kissyfaces into your screen.  loki troll scenario post of week etc.  keep it up.  she is not real (i think we have all said this before huh) -------------- You're obviously illiterate as hell. Peach, bro.-FtK Finding something hard to believe based on the evidence, is science.-JoeG the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat I work on molecular systems with pathway charts and such.-Giggles

Pages: (341) < ... 323 324 325 326 327 [328] 329 330 331 332 333 ... >

Track this topic	Email this topic	Print this topic

© 2002-2009 Antievolution.org Powered by Ikonboard 3.0.2a © 2001 Ikonboard