afdave
Posts: 1621
Joined: April 2006
|
Where to start? Probably the best place would be to float a reminder to you about "The Big Picture of This Thread" and "Your Role" vs. "My Role" and how this little discussion of GULO fits into the big picture.
(1) One reason I am here at PT is to see if there really is anything substantive to evolutionary arguments. Seems like a good place to find out would be a forum where evolutionary scientists hang out.
(2) Notice that on this thread, it is not my primary goal to prove to you something positive about the Creationist view of Apes and Humans. It is to see if YOU have some positive, convincing proof that would make me rethink my position that Apes and Humans are separately created kinds.
(3) Someone has pointed out that I just want everyone else to run around chasing data and I myself don't want to do any "real scientific work." Well, in this case, YES. The burden is upon you to try to convince me. I have always felt sorry for evolutionists in a way, because I have always thought it would be a huge undertaking to try to defend many aspects of it, and so many arguments have crashed and burned in the past when new information is known. I'm finding this to be true with Ape/Human issues in general and with the GULO issue in particular. Sorry if this observation frustrates you, but it's an honest observation.
(4) Someone has correctly observed that I am an apologist for YEC. I'm glad someone has figured this out because it is true. I have said many times that I don't want to become a specialized scientist in a particular field--we have many of those already. But I am being honest when I say that I would abandon the YEC position if given some convincing evidence for NOT being a YEC. It's just that no one has yet.
Now that we have that "role review" under our belts, let's dive in.
Just so Faid is not insulted that I never look at his links, I'll post something from one of his links ...
| Quote | B-1: The GULO Gene as an Example of Shared Deletions:
Given below is the alignment for the same part of the GULO gene that we examined in lesson A on Vitamin C,
along with the corresponding sequences from 3 primate species that are incapable of synthesizing Vitamin C, the
chimpanzee, the orangutan, and the crab-eating macaque.
Human TACCTGGTGGGGGTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC
Chimpanzee TACCTGGTGGGGCTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC
Orangutan TACCCGGTGGGGGTGCGCTTCACCCAGAG-GATGACGTCCTACTGAGCCCC
Macaque TAACCGGTGGGGGTGCGCTTCACCCAAGG-GATGACATCATACTGAGCCCC
Rat TACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC
Link to article |
Oh, by the way ... maybe I should have clarified this earlier ... YECs have no problem with the idea of Apes and Monkeys having a common ancestor. We actually agree that they did. I think Noah took a pair of genetically rich "ape/monkeys" on the ark and these diversified into the many varieties we see today.
So the only thing I care about here is the Ape-Human thing ... the supposed shared ancestry.
Now let's analyze this. As I have found in so many areas, you make many assumptions:
1) You assume that the ONLY reason human and ape GULO does not work is because of this single deletion. Am I correct?
2) You are assuming that pseudo-GULO is in fact "broken GULO". Argystokes has not yet demonstrated that to me. To me it is a possibility that "pseudo-GULO" has some as yet undiscovered function. Remember the good old "vestigial" organs that turned out to have function after all? Why wouldn't "vestigial" GULO turn out the same way?
3) You are assuming that this "deletion" is in fact a deletion. The word deletion implies that it was there at one time in history and now is not due to a mutation. I think you base your idea that it is a deletion by comparing it to rat GULO. A tempting comparison and I do see your logic, but how is this conclusive? An interesting experiment in this regard would be to delete the "C" in question in the rat GULO, then see if rat Vitamin C production ceases. Has this been done? Is it even possible? How about inserting a "C" into some ape GULO, then seeing if Vitamin C production commences? I did read the Rat/GP/Trout experiment and it is interesting, but does this prove that the "C deletion" is definitely the cause of non-functionality?
4) You assume that this "C deletion" occurring independently in apes and humans is a highly unlikely event. Why is it so unlikely? After all, there are many identical substitutions in an unrelated ... er ... *cough* ... distantly related (yes, yes, I forgot my head yesterday for a moment ... it is still a challenge for me to remember that you all think ALL organisms are related through common ancestry), i.e. our furry friend, the guinea pig.
| Quote | Dave, this is the part you're not getting: Creationism predicts everything. Creationism is an ad hoc hypothesis that can always fall back on the proposition that the Creator could always have done something in a particular way, and given we know almost nothing about the Creator, we cannot make assumptions about why it would do something.
Now, Dave. Tell me something you could in principle find in the natural world that Creationism would not predict. Can you do it? |
Creationism does NOT predict everything. Here are 5 things it does not predict. (but evolution does predict and has been proven wrong)
1) "Upward evolution" ... it predicts "downward"
2) "Seamless fossil record" ... it predicts ubiquitous gaps
3) "Hominid civilizations" (or half-human to make Norm happy on terminology) ... it predicts fully human civilizations and fully ape "civilizations."
4) "Millions of years coal production" ... it predicts rapid coal formation
5) "An infinite universe" ... it predicts a finite universe that had a beginning
How far do you want me to go on? I could keep going a long time, but you get the idea. So you are incorrect. Creationism does not predict everything.
Evolution, on the other hand is almost "God-like" (actually fairy-talish) in its supposed explanatory power. If a guy like Michael Behe comes at you with an irreducibly complex biological system like the flagellum, the "Evo Fairy Tale Machine" goes into high gear cranking out stacks of "just so" stories about how you all wish it might have happened. None of this can be tested experimentally, of course, and no one has ever observed such an innovation happening in nature, and we all know what happens to fruit flies when you "speed up" evolution, but who cares about all of that. On they go creating large volumes of "scholarly articles" which in reality are nothing more than "Alice-in-Wonderland" tales without the "fun story appeal." Have you ever waded through one of those "How a Flagellum Evolved" technical papers? I don't blame you if you haven't. You would no doubt have headache afterwards if you did.
| Quote | | Also, as a side note, does Creationism make any predictions as to the number of "kinds" there are out there? Or does Creationism even have an estimate of the number of "kinds"? Because evolution does. It has a nice little diagram of the organizational structure of life on earth. Does Creationism have its own diagram, or does it just plagiarize the one created by real scientists? |
I think they do somewhere. I can find out pretty easily from AIG or ICR or someplace. I just threw out that 1000 number. I have no idea what a good number might be. The actual number was not important to my argument yesterday, so I just picked one out of the air.
| Quote | | Seriously Dave, you are trying to do rocket science when you don't have basic physics down. Before any of this works, you need to understand why scientists believe that the earth is around 4 1/2 billion years old. |
Yes. The magic potion of evolution ... millions and billions of years. I hate to be so unkind as to tell you that you might need to pay attention, but if you read this thread, millions of years doesn't have anything to do with the questions I have raised on this thread.
| Quote | If you still refuse to address them, I'll have no choice but to infer that:
a) either you're in some OCD state, where you think that checking the link is like "giving in to temptation", expressing doubt in the eyes of you-know-who, or
b) You have already checked the links, but don't want to address them- and that is dishonesty. |
Whew! I cut and pasted Faid's quotes. Now he won't think I'm in an OCD state!
| Quote | Mine says that you will not find a functional GULO region in this primate. Yours has no reason to predict this. Note that despite argystoke's interesting proposed experiment, we have no reason to expect the converse. That is, we might well expect to find additional broken GULO regions in rats and other animals that still have functioning GULO and can synthesize vitamin C. This would indicate duplication (similar to that found in hemoglobin genes and many others). It would not indicate some vital and as-yet unknown function of the pseudo-GULO. So, while it's an interesting idea, it wouldn't provide any magic bullet to decide between your "scenarios". I notice that you didn't have enough understanding of the question to realize this.
Mine says that if we spliced a rat or mouse GULO gene into the primate's liver cells (as we have done for humans), it would be able to synthesize vitamin C. Yours has no reason to predict this. Mine says we couldn't do the same for a fish. Yours?
Mine says that this pseudogene is likely the result of a retrovirus, and that the mutation occurred about 40 million years ago, in the shared ancestors of that primate and us. Yours?
What does your "theory" predict for our newfound primate, Dave?
Or let's leave the hypothetical primate. Let's look at a hamster, Dave. What does your "theory" predict for hamster GULO? Is a hamster part of the guinea pig kind? The rat kind? Its own kind? Does it matter? Can you -- without peeking at those hocus-pocus evolutionary phylogenies tracing ancestry -- predict anything about hamster GULO and vitamin C production? Can you test your predictions on your own?
Who doesn't know the language here, Dave? |
You are the biology expert. I am the apologist. Remember the role discussion above? By the way, I am very impressed with some of the technical knowledge displayed here. I don't want to trivialize that. I am just pointing out some items which appear to be logical fallacies to me.
OK. Over to you ...
--------------
A DILEMMA FOR THE COMMITTED NATURALIST
A Hi-tech alien spaceship lands on earth ... DESIGNED.
A Hi-tech alien rotary motor found in a cell ... NOT DESIGNED.
http://afdave.wordpress.com/....ess.com
|
