Antievolution.org :: Antievolution.org Discussion Board The Critic's Resource on Antievolution

Antievolution.org Discussion Board > From the Panda's Thumb > After the Bar Closes... > Anatomy of Creo Argument: Warning! long

BWE Posts: 1902 Joined: Jan. 2006 (Permalink) Posted: May 22 2006,21:08    afdave Posted: May 08 2006,08:55   DIFFICULT QUESTIONS REMAIN FOR APE/HUMAN ORIGINS I appreciate the good information that was exchanged on my "Chimp Chromosome Thread."  I have learned some important information regarding the similarity of the genomes of apes and humans.  I agree that the similarities are quite striking indeed and cannot be dismissed as some Creationists attempt to do. However, I believe there are a number of major issues which would have to be solved before a scientist could logically adopt the firm position that humans and apes DO IN FACT share a common ancestor.  Of course, I am becoming quite proficient at searching the "Index to Creationist Claims" and the Article DB at Talk Origins now BEFORE posting my questions here, so as not to waste your time.  I will summarize the points of agreement that I share with Neo-Darwinists, then pose my questions.  I have surveyed the various Creationist refutations of common descent for apes and humans and have found most of them to be inadequate.  These inadequacies are spelled out rather nicely by Todd Charles Wood (2006) of the Center for Origins Research at Bryan College in Dayton, Tennessee, who appears from this paper to be a fair-minded creationist. Wood Article (2006) Points of Agreement between myself (Wood also) and Common Descent Advocates (1)  Nucleotide mismatches appear to be very small ~1.5% (2)  Alignment gaps are also very small ~3-4% (3)  Human Chromosome 2 does in fact appear to be a result of the fusion of 2 chimp chromosomes (4)  The pseudogene for Vitamin C production does in fact appear to support common descent theory (5)  Body similarities are indeed very striking and pose interesting questions (6)  Many creationist arguments are inadequate. Summary of Inadequacies of Creationist Responses (Wood) (1) Similarity pointing to Common Design is inadequate. Quote omitted (2) Possibility of higher % differences proves nothing. Quote omitted (3) There may be NO "Haldane's Dillema" at all. Quote omitted Wood then goes on to propose an intriguing alternative ... Quote omitted and he asks an important question which serves as an excellent prelude to my own questions ... Quote What is a Genome? This might seem like a trivial and self-evident question, but its simplicity hides a deep challenge (Wood 2001). The Bible teaches that God created adult organisms and presumably even complete ecosystems by covering the land with plants. Thus, the Bible favors a holistic perspective of organisms. Modern molecular biology has favored the opposite perspective: that life is the complicated interaction of molecules and that DNA is the “code of life.” If the molecular viewpoint is correct, then the differences between organisms that really matter are indeed the differences in the DNA. and Yada yada This paper by Wood is quite interesting to me and serves well as a prelude to my own questions which I shall now present to you ... (1) How do we explain the complete lack of 'Hominid Civilizations' (for lack of a better term) today?  It seems to me that if Common Descent Theory is correct, that  we would expect to see numerous 'civilizations' of 'less evolved' humans.  I suppose a hopeful candidate for this type of civilization has been the remote tribes of jungle natives found throughout the world.  However, I have firsthand experience with one such tribe, the Wai-Wai indians of Southern Guyana/Northern Brazil (My father is a Bible Translator for this tribe), and we have observed no evidence of anything 'primitive' about their human characteristics.  To be sure, their civilization and technology was quite primitive (they were basically hunter/gatherers), but their language is every bit as complex as English or Spanish or many other languages (I speak the language some and have a copy of their grammar, which my dad produced).  Their behaviour is in no way 'primitive' for the purpose of determining if they are 'less evolved.'  They laugh, cry, make jokes, tell stories, get mad at one another, read, write, learn foreign languages, play guitars and keyboards, have political battles, and in short do everything that any human society also does.  The main difference is in technology, which of course is not advanced.  As far as I know, there are Apes and there are Humans.  And there are no existing 'in-betweens.'  How do you explain this? (2) The fossil record of human evolution is unconvincing to me.  Here is the supposed evidence from Talk Origins ... Quote omitted Do we not have plenty of LIVING HUMANS which could correlate very nicely with some of these fossil finds, but which we now know are completely human?  i.e. Pygmies and 'Aborigines' ?   (3) Some have claimed that for all practical purposes, we are apes and biologically speaking, I see what they are saying.  But does this not minimize the ENORMOUS non-biological differences?  Humans have highly complex symbolic languages.  Apes probably communicate some, but do they communicate in DIFFERENT LANGUAGES in different parts of the world?  Are there any apes that have learned how to write?  Do apes organize themselves into 'governments' and seek to conquer  other ape groups?  Is there any indication of abstract thinking among the apes?  Is there any evidence of any 'technology' developed by apes?  Even primitive technology?  And this is only the tip of the iceberg with such questions. (4) Has anyone thought about the implications of an assertion by a government entity that "Apes are 98.5% human and therefore should be afforded certain 'human rights.'"  This would be a silly idea to me of course, but it appears to be a logical conclusion of some evolutionist thinking. (5) Was not Adolf Hitler affected by current evolutionary thinking when he came up with his "Aryan Master Race" theory?  I believe he was, and why shouldn't he have been?  Isn't it logical to assume that some races might be 'less evolved' than others if human evolution is true?  How about slavery?  Did not many whites view themselves as 'more evolved' than blacks, thus justifying their ownership and ill treatment of slaves?  And if human evolution is true, why would Hitler and slave owners be wrong in their actions?  After all, we 'enslave' chimps in zoos and we do medical experiments resulting in the death of lab rats.  Why should we not do the same with 'less evolved' humans? My conclusion then is that in spite of striking genome similarities, humans and the apes are VERY DIFFERENT in many important ways.  All the evidence that I have seen so far is explained in a much better way by the Biblical assertion that mankind was made "in the image of God."  It appears to me also that Neo-Darwininsts are not even close to being able to answer ANY of the above questions in a satisfactory manner.  But maybe you will prove me wrong. OK.  That should do it for starters.  I welcome your comments. ---------------------------------- Arden Chatfield said ... Quote The 'Hitler = Darwin' equation has been tried out by every creationist for the last 60 years. It's bullshit. Start here: http://www.talkorigins.org/indexcc/CA/CA006_1.html I did and it is extremely weak. Then go look here for a much stronger case. The Holocaust and Darwinism Quote Hitler was especially determined to prevent Aryans from breeding with non-Aryans, a concern that eventually resulted in the ‘final solution’. Once the inferior races were exterminated, Hitler believed that future generations would be eternally grateful for the improvement that his programs brought to humanity: ‘The Germans were the higher race, destined for a glorious evolutionary future. For this reason it was essential that the Jews should be segregated, otherwise mixed marriages would take place. Were this to happen, all nature’s efforts “to establish an evolutionary higher stage of being may thus be rendered futile” (Mein Kampf).’ 20 Individuals are not only far less important than the race, but the Nazis concluded that certain races were not human, but were animals: ‘The Jews, labelled subhumans, became nonbeings. It was both legal and right to exterminate them in the collectivist and evolutionist viewpoint. They were not considered … persons in the sight of the German government.’ 34 As a result, the Darwinist movement was ‘one of the most powerful forces in the nineteenth–twentieth centuries German intellectual history [and] may be fully understood as a prelude to the doctrine of national socialism [Nazism]’.35 Why did evolution catch hold in Germany faster, and take a firmer hold there than any other place in the world? But OK.  You don't want to accept this?  What about the other questions? Ltracey said ... Quote Whoa, I seriously cannot believe we just saw another instance of "why are there still pygmies and dwarves?". That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins. I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct? Tom Ames said ... Quote "What is the Bernoulli effect? Well, the Bible teaches..."  Sounds kinda dumb, doesn't it? Sure, THAT does.  But you are distorting what the paragraph says.  Read the context.  What Wood is saying is "What is a Genome?  It is something worth studying, no question.  But is the Genome going to explain the real differences?  No.  There are differences which have to be accounted for by means OTHER THAN Genome studies." Remember, that I and apparently Wood view the Bible as a SOURCE FOR PLAUSIBLE HYPOTHESES.  I also believe in Biblical inerrancy.  But this is a separate issue which must be proven on its own merits.  Biblical inerrancy has nothing to do with the issue you just raised. Norm said ... Quote The most evolved life forms on our planet are probably bacteria and virii. They go through more generations and mutations in shorter time periods. There is no such thing as "less evolved" or "more evolved" in the context you want to use them. There is only more fit or less fit to the niche you find yourself living in. This is an amazing statement to me.  Do most of you guys really believe this? --------------------- I said ... Quote That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins. I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct? Oops.  Let's try that again ... That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans DIED, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins?? I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct? ------------------------------------------- Norm said ... Quote Human Brain Is Still Evolving Howard Hughes Medical Institute researchers who have analyzed sequence variations in two genes that regulate brain size in human populations have found evidence that the human brain is still evolving. They speculate that if the human species continues to survive, the human brain may continue to evolve, driven by the pressures of natural selection. Their data suggest that major variants in these genes arose at roughly the same times as the origin of culture in human populations as well as the advent of agriculture and written language. and he also said this ... Quote You seem to think that human intelligence is some sort of goal in evolution. It's not. There is no goal except for an organism's instinct to survive and reproduce itself. Brains won't be of use to all. ... and ... The most evolved life forms on our planet are probably bacteria and virii. They go through more generations and mutations in shorter time periods. There is no such thing as "less evolved" or "more evolved" in the context you want to use them. There is only more fit or less fit to the niche you find yourself living in. These seem to be contradictory statements to me.  On the one hand you seem to be saying that the brain is evolving (I assume this means humans are getting smarter), then on the other hand you say that bacteria are the most 'evolved' Let me just explain that MY conception is this: MORE EVOLVED=More Intelligent and More Abilities.  For example, apes can walk, climb, eat, drink, sleep, communicate in a limited way, etc.  Humans can of course do all these things and much more including blow all the rest of life on Planet Earth to smithereens.  This is what I'M talking about.   If you want me to use a new term so I don't confuse your minds, please suggest one. ------------------------------------------------------ Quote How about you go get a high-school biology textbook and shut up for a while. PLEASE go get some education (not from Answers in Genesis) and come back in 6-12 months. Out of answers and energy, perhaps?  I'm starting to make sense and you are frustrated?  Maybe evolutionary explanations are not so great as they once seemed to you?  But you still want to hang onto them because you have your life invested in them? Hmmmm .... ------------------------------------------ Quote More Koko news. I acknowledged up front that apes have communication ability and even some of the other abilities mentioned here.  This does not overcome the ENORMOUS differences between Apes and Humans.  The BEST explanation remains, as it did before Darwin, that an Intelligent Designer made Humans to be Humans and Apes to be Apes. Quote Oh, look. The evidence shows that the differences between the various races are negligible, and that their abilities are essentially identical. Huh. I guess that makes it an instance of "Things are not always what you expect." My point exactly.  Things ARE NOT as one would expect if evolution were true. Quote It is your next line ...that the reality-based people here will take issue with. 'All the evidence that I have seen so far is explained in a much better way by the Biblical assertion that mankind was made "in the image of God."' Why?  What is wrong with proposing this as a hypothesis and testing it?  This is what am doing on my other thread (well into Point 1 already).  If the evidence fails to support it, then fine.  I will abandon the proposition. You should not be calling people here 'reality based.' Because many of them refuse to consider the possibility of what may in fact be quite legitimate REALITIES -- God, angels, demons, afterlife, etc.  I will be showing excellent evidence for just these types of realities on my other thread.  I cannot prove them, but there is much evidence.  A better term for the people here might be 'naturalistic based.'  In other words, they only acknowledge things they can test with their meters and such.  They think that there is no 'God-meter' so to speak, so they reject the possibility out of hand. I will show that this is a mistake. Quote What I wanted to ask you was what are we suppose to make of the non-gaps(I don't know what else to call a non-gap, maybe evidence woudl be a good name, but if anyone has an idea please do tell) in the fossil evidence?  You know, the places that make all those gaps the creationists complain about possible.  All that evidence has to mean something.  Especially since the evidence between the gaps shows such flow(again a bad word but the only one I could think of) between features and anytime a new piece of evidence is found it fits into the flow just as we would expect it to.  Focusing only on the gaps gives the lopsided picture that the gaps are all that is important, but as I said above without the evidence there would be no gaps; or, rephrased, all of prehistory would would be one giant gap.  And if creationism was true(especially YEC) that is all we would expect.  One giant gap.  Why can't creationists get that? I will cover this on my other thread.  Keep checking back.  Thanks for the question. Quote (Arden)Ah yes, where would creationists be without comparisons of Hitler and Darwin? And where would they be with AIG? (Didn't use AIG this time ... are you happy?) Okay, Dave try answering this. Adolf Hitler was a Christian. Catholic, in fact. The great majority of Nazis were Christians of some kind. Hitler frequently rationalized his attitudes towards 'racial purity' by appeals to Jesus and God. From this, one could conclude that a natural consequence of Christianity is murdering Jews. You presumably disagree. So do I. But why is this any less reasonable than your logic? It's FAR EASIER to find statements by the Nazis invoking Jesus for what they did than invoking Darwin. (Joe the Ordinary Guy) Sure he [Hitler] was. But, as above, I think most people would describe him as “wrong”; he MISINTERPRETED evolutionary theory and arrived at bad conclusions. Wasn’t he also a Christian? Would you say he followed Christian precepts correctly? I might concede this point.  It is true that various twisted versions of Christianity has wreaked enormous havoc on the human race, the medieval Catholic Church being a case in point, in my opinion.  But history also has a very recent example of a nation which based its laws upon the general Protestant interpretation of Christianity (the USA)--there is a very strong case that this is true--it should be self-evident, but may not be now thanks to post-1950 (or so) revisionists of American history.  America (and the British Empire before it)  owes its success more than anything else to the Bible and to the teachings of Jesus of Nazareth.  And by "success", I mean equality, prosperity, culture, conveniences, art, music, good treatment of women and children, etc.  Note that people from all over the world want to come to America.  I cannot help but think that the story of Great Britain and America would have been quite different (maybe like the USSR?) had they been founded upon Darwinism instead of upon the Bible and the teachings of Jesus.  Do you disagree with this? To me, basing society upon the Bible and the teachings of Jesus has been demonstrated to be a good idea, whether they happen to be true or not.  And basing a society upon Darwinism would be a bad idea, whether it is true or not.  But I believe I have a "double whammy" if you will.  Not only do I believe Darwinism is unsupported by adequate evidence AND has bad societal influences, but I also believe that Biblical Christianity and YEC is supported by overwhelming evidence AND is good for society.   This explains my zeal in fighting AGAINST Darwinism and FOR Biblical Christianity and Creationism. Quote Evolutionary theory does not provide any support for the arguments you try to make.  These are issues for society, not science, to resolve. True, and I am not an official member of the science community, but policy makers rely on what they think is good science many times to make good decisions.  I am a concerned citizen with a scientific mind who feels that a pseudo-science called Neo-Darwinism is being called science on a large scale.  This gives politicians scientific sounding reasons to implement potentially disastrous policies in our society. Quote Christians had been discriminating against and killing jews for well over a thousand years before Hitler was born. Twisted Christianity had been.  You are correct.  It got so bad that a man named Martin Luther turned things upside down.  The result?  The translation of the Bible into the English language and the attendant success of the British Empire, followed by the founding of the United States squarely upon the Bible also, again with great results.  Note also the DECLINE of the British Empire coincident with the REJECTION of the validity and authority of the Bible. Quote Tell us what to do, now, Dave. Obviously we have to start from scratch. I mean, I assume I have to get one of those Jesus fish eating a Darwin fish for my car, and vote Republican this fall, but aside from that, I'm at a loss. No one will make you do any of those things.  That's the beauty of America.  We let people be Atheist or Islamic or Buddhist or Nothing with no penalties.  And the reason for this is the Christian worldview which is unique in the world in that it allows maximum freedom. What we DO want is to NOT have our Creationist views ridiculed in the public square, and we want school children to hear both sides of the evidence (whether in ID format or Creo format, I don't care).  I hear this is starting to happen in the UK and I think this is great! --------------------------------------------------------------- Quote Since you seem to have abandoned the previous thread, I'll repost my simple, unanswered question here: Do you or do you not find the very idea that humans are evolved apes offensive? If it does indeed turn out to be false when I have finished my investigation into the claim, then YES, I would be offended at the idea of teaching it as if it were true. I will resume posts on my other thread tomorrow morning.  I was not avoiding yours or anyone's questions over there. ---------------------------------------------------- Quote To #### with it all -- let's play Hitler ping-pong! We are getting off on rabbit trails.  I said I would concede the Hitler point. Let me put us back on the main track. The BOTTOM, BOTTOM, BOTTOM line for me is this, guys. None of this discussion here changes the simple FACT that ... (a) WE REALLY DON'T KNOW FOR SURE IF HUMANS EVOLVED FROM APE-LIKE ANCESTORS, AND I'M NOT SURE WE EVER WILL. and ... (b) WE REALLY DON'T KNOW FOR SURE IF "GODDIDIT" AND WE CERTAINLY CAN'T "PROVE" THAT. OK?   Now ... my BIG problem is this ... Why are we standing up in science classes and teaching kids that Ape to Human Evolution is a FACT?  This is dishonest and potentially damaging to society for any number of debatable reasons.  What we SHOULD be doing is telling them BOTH THEORIES--DESIGN and NO DESIGN and clearly let them know they are UNPROVEN THEORIES and it is up to YOU and YOUR PARENTS to decide.  My tax dollars are funding this education system just like yours are and I have a different opinion on something that is an unprovable fact in either direction.  Why is my opinion shut out and vilified?  Is this country supposed to be a representative democracy or is it not?  Last time I checked IT WAS. And that ... my friends ... is the BOTTOM LINE on this thread. -------------------------- Let me just put to rest all the talk about "More Evolved=More Abilities, etc." ... When comparing Apes and Humans (which is the topic of this thread), I am simply saying this ... Humans Have More Abilities than Apes Let's just forget about the bacteria and the rest until another day ... OK?  Everybody happy now? Also, this type of thing from Aftershave ... Quote Let's use AFDave "logic", shall we? Those evil Nazis used their knowledge of chemistry to produce high explosives and poisonous gas, so therefore the Atomic Theory of Chemistry must be scientifically wrong! Worse than that, those evil Nazis used their knowledge of physics and gravity to aim and drop their bombs, so therefore Newtonian physics and the Theory of Gravity must be scientifically wrong! How can we teach such blasphemy as chemistry and physics to our children??? Let's say someone drops AFDave into the middle of the Pacific with no raft, into a pack of sharks, to see which is "more evolved".  Any bets? is a sure indicator that this person has nothing left to say that is substantive ... this does not help the image of evolution promoters ... the YECs on the other hand thank you for ranting so ... Could you maybe do some more?  Maybe go tell 4 friends to show up and insult me too ... then you would be 5 times as effective :-) --------------------------------------------------------------------------- Well ... one thing is sure ... most of you are answering me precisely as I expected you to answer ... We'll see you guys tomorrow for some more fun ... :-) --------------------- Good morning everyone! I hope everyone has had an excellent night's sleep so your mind is clear and your wits are sharp!  The remaining half of my brain that's not "religion darkened" feels pretty good, so I'm ready to go at it again hammer and tongs!   It was a fun day for me yesterday ... I learned some really interesting things, and my wife and I got some great laughs from some of the creative answers you gave. I do see that some of my "Chief Insult Hurlers" have abandoned that tactic apparently because they found it ineffective for their cause.  We'll see how long it takes ALL the Insult Hurlers to figure this out. (You know ... some are more "highly evolved" than others, so it takes a while with some ... just kidding, JUST KIDDING! :-)  ) NOTEWORTHY HIGHLIGHTS FROM YESTERDAY'S SKIRMISHES Tom Ames runs for cover when the "B WORD"  is mentioned ... Quote What is a Genome? This might seem like a trivial and self-evident question, but its simplicity hides a deep challenge (Wood 2001). The Bible (RED ALERT!! RED ALERT!! ALL PERSONNEL TAKE COVER IMMEDIATELY!! THE DEPLORABLE WORD HAS BEEN SPOKEN! teaches that God created adult organisms and presumably even complete ecosystems by covering the land with plants. Thus, the Bible (RED ALERT!! RED ALERT!! favors a holistic perspective of organisms. Modern molecular biology has favored the opposite perspective: that life is the complicated interaction of molecules and that DNA is the “code of life.” If the molecular viewpoint is correct, then the differences between organisms that really matter are indeed the differences in the DNA. If a holistic perspective is correct, then perhaps differences in the DNA are not paramount to understanding organismal differences.Complicating this reasoning is the fact that differences in DNA do indeed cause differences at the organismal level. There is a definite relationship between phenotype and genotype, even though the relationship is not as simple as Mendel might have imagined it. We could understand the genome as a repository of some of the information necessary for the physical composition of the organism (Wood 2001). In that case, far more important than the genome may be its cellular context, which interprets and applies the information stored in the genome. Since some of the cellular context is coded by the genome, we have something of a chicken/egg problem, which can only be resolved by a creation event.The similarity of the human and chimpanzee genomes offers evidence that the genome could primarily be a repository. If the fixed nucleotide mismatches between the chimpanzee and human genomes are 1.06%, then the original nucleotide identity could be as high as 99%. At that high level of similarity, perhaps it is not impossible to believe that God created humans and chimpanzees with identical genomes. The known differences between human and chimpanzee biochemistry (see Varki 2000; Varki and Atheide 2005) may well rule this out, but it is an intriguing possibility. Even at 99% identity, however, the biological and behavioral differences between chimpanzees and humans indicate that the source of these differences is not likely to be found entirely in the genome sequences. Theologically, the high similarity of humans and chimpanzees reinforces our spiritual – not physical (Ecc. 3:18-21) (RED ALERT!! RED ALERT!! – distinctiveness from the animals. It is the image of God (RED ALERT!! RED ALERT!! THE OTHER DEPLORABLE WORD HAS BEEN SPOKEN! that makes us human not some intrinsically valuable genetic element.(p.12) NOTE:  Let me emphasize again that for YECs showing evidence of YEC Theory, the Bible is a SOURCE FOR HYPOTHESES.  Belief in Biblical inerrancy IS NOT required in this discussion.  This is a SEPARATE ISSUE and stands or falls on its own merits. Quote The most evolved life forms on our planet are probably bacteria and virii. I just LOVE this one!  My kids got a great laugh too.  I quickly learned yesterday that I am not up to date on the latest version of THE GREAT MYTH, so I thank all of you for fixing that.  You'll have to pardon me for making this mistake.  When I was in grade school, I remember all the encyclopedias showing Evolution going something like AMOEBAS - WORMS - SQUIDS - FISH - AMPHIBIANS - MAMMALS - APES - HUMANS (did I get that right?), with humans at the top of the tree.  Anyway, I remember seeing a nice little Ape to Human progression and I remember quotes from Huxley and the like saying things about whites being "more evolved" than humans.  I guess it stands to reason that ND Theory would have to change as racism became less fashionable worldwide throughout the 20th Century.  And I do apologize for not keeping up on the latest version of THE GREAT MYTH.  The Bible (My "myth" as you call it) says the same thing THIS century as it did in Darwin's day, so it's easier to keep up with than YOUR MYTH. Quote Human Brain Is Still Evolving: Howard Hughes Medical Institute researchers who have analyzed sequence variations in two genes that regulate brain size in human populations have found evidence that the human brain is still evolving. And why shouldn't it be if evolution is true?  It seems that the ToE would actually PREDICT continual brain sophistication (oops ... there's one of those evil "directional" words) ... er, shall we say, er ... I'm at a loss ... anyway ... ToE should predict continual brain sophistication so that at some point there may actually be some kind of Super Homo Sapiens species who might be able to leap tall buildings in a single bound, play 100 simultaneous chess games, memorize large books in minutes, etc, etc. Quote Why should Common Descent produce “Hominid Civilizations”? There’s no reason to assume that this would be the case. Actually, there is EVERY reason to believe this should be the case if the ToE is true. Quote After Darwin, a new possibility was raised: that those at the top of the social pyramid deserved to be there for natural reasons rather than religious reasons. There has never been ANY doubt by those at the top that their position is deserved. So these "natural" justifications have been deployed both by nations (as in Germany) and by scientists (searching for natural explanations for why the French are superior to the Germans or vice versa (depending on who's doing the study), or why whites are superior to blacks (again depending on who's doing the study). In brief, it fell out of fashion for those born into privilege to say God put them there, and into fashion to say they are "more evolved" and rose to the top from sheer innate superiority. Quote The anti-semitic attitudes that allowed for various attrocities - including the Holocaust - came directly from Christianity.  The notion that Hitler just came up with the idea of killing off jews all on his own is simply absurd.  Christians had been discriminating against and killing jews for well over a thousand years before Hitler was born.  Hitler was just continuing a popular tradition, and adding his own spin to the process. You need to remove the word 'Christianity' from this one and insert 'Catholicism' instead.  The two are vastly different as I will show on a future "Martin Luther" post.  That one should be fun! Quote How can you hope to find any flaws in something of which you have no understanding? My 1st grader can easily grasp the truth that Apes are Apes and Humans are Humans and that they probably HAVE ALWAYS BEEN just that, and probably WILL ALWAYS BE just that.  It doesn't take very much understanding of biology.  The reason you don't grasp this is beyond me.  Maybe too much ToE indocrination in higher education? Quote But you come in with arrogance and attitude on top of that. You don't show any respect for the opinions of people who do know things. I'll give you that one.  I did come in kind of cocky on the chimp chromo thing and you are right ... I should not be cocky, but I did show respect for people's opinions when they showed me the truth.  I have always said I would ... and I did.  You got me on that one, and now I agree with you that it does in fact appear that this supports ToE.  So basically now you are "one bucket full" of water closer to draining the ocean.  You should feel justifiably proud. Quote If creationism offered some explanations of the otherwise unexplained, if it made any predictions at all that worked, I still have my life and my work. It wouldn't cost me a thing to adopt it. If it worked. But it doesn't. Stay with me.  I will be resuming my work on my "Creator God Hypothesis" thread and I hope for your sake that it makes sense to you.  The world is truly a fun place when you have the right view of it! Quote Now, let's talk about what you have invested in creationism. Suppose we were able to convince you that AiG is just as obviously, glaringly, unambiguously wrong about everything else as I hope you have come to realize they are about the chromosome fusion story. Suppose you had to accept what every scientist who's looked at the evidence objectively accepts: that the earth is billions of years old, and that humans are just one little twig on the tree of life, that has been on the scene for but an infinitesimal fraction of the planet's history. Would that make you reassess your thoughts on life and your alleged god? Sure.  I'd probably think there ISN'T a God.  And yes, I would be disappointed.  I admit that I LIKE the idea of there being one.  But I don't think I am necessarily jaded by this.  I think everyone's thinking is affected somewhat by their "wanters", but we have to keep this "wanter" under control.  "Evos", like "Creos" also have "wanters" and many of them DON'T WANT there to be a God because they think their life would somehow be worse, or they'd have to tie half their brain behind their back, or some such thing. Quote What does this (Hitler) have to do with the biologically history of the planet Earth? Simply this. If you compare the two "World Views" you have something like the following major points: DARWINISM:   Survival of the fittest Humans are animals-nothing more No God required-I'm not accountable to anyone but myself CHRISTIANITY (American Protestantism specifically): God created mankind in His image All humans are created equal Don't kill, don't steal, etc. Treat others as you would have them treat you Love one another Turn the other cheek Bless your enemies If your enemy is thirsty, give him a drink Do not repay evil for evil Now ... which of these is more conducive to a Holocaust?  You tell me.  I'm not discounting other factors.  It's true that Hitler was influenced by Catholicism, the Occult, and other factors as well.  So my point is ... NOT ONLY IS DARWINISM FALSE AND AN INSULT TO INTELLIGENCE ... demonstrably so as we saw for many years with Henry Morris and Co. and are now seeing with Dembski, Denton, Behe, etc. BUT IT IS ALSO AN BAD FOUNDATION UPON WHICH TO BUILD A NATION. I don't know of a single one that was built on the Principles listed above under "Darwinism" that I would want to live in.  Do you? In stark contrast to that, we have at least TWO examples of nations who built their laws squarely upon the CHRISTIANITY principles listed above:  Great Britain and the USA. Now you see what gives me such zeal in fighting Darwinism. Again, so no one misses it ... the two reasons I fight Darwinism are ... (A) IT IS FALSE (B) IT IS HARMFUL TO SOCIETY Are there any questions?  Is my position perfectly clear? By the way, for those of you wise enough to "get off the Darwin train" BEFORE the train wreck, your buddy Bill Dembski has come up with a neat list of over 500 scientists who have had the kahoonas to sign their names to a public statement that says ... Quote A Scientific Dissent From Darwinism "We are skeptical of claims for the ability of random mutation and natural selection to account for the complexity of life. Careful examination of the evidence for Darwinian theory should be encouraged." It also notes that ... Quote The scientists on this list dispute the first claim and stand as living testimony in contradiction to the second. Since Discovery Institute launched this list in 2001 [in response to the PBS "Evolution" propaganda piece] over 500 scientists have courageously stepped forward to sign their names. The list is growing and includes scientists from the US National Academy of Sciences, Russian, Polish and Czech National Academies, as well as from universities such as Yale, Princeton, Stanford, MIT, UC Berkeley, UCLA, and others. Here's the link ... [url="http://www.dissentfromdarwin.org"] (What?  We have rebels in the Ivy League too?  Heaven help us! er ... Deep space help us! (?) ... er ... May the Force help us! ... er ... well ... anyway, SOMEONE help us! THOUGHT QUESTION FOR THE DAY:  If over 500 scientists have actually had the kahoonas to SIGN such a document, how many others AGREE with the document, but are AFRAID to sign it because of peer pressure, fear of not getting tenured, etc., etc. Hmmmm .... Quote so afdave, have you confronted AIG about the lies on their site as you said you were going to do yet? Patience, my friend.  These things take time.  AIG is so popular right now that they get ZILLIONS of questions every day and it takes time to get to mine.  Actually, I think the only way I will get an answer in any reasonable amount of time will be if I use my connections.  But I don't even know for sure if that will work quickly.  Stay tuned, though. Quote The problem is not that chimps, and the animal kingdom in general, is so far behind.  It is that you are so completely unknowing of just how capable chimps really are and that you are full of species superiority about how far advanced humans really are. Yes. Maybe we should take this up in Congress and maybe come up with an "Ape Bill of Rights."  Good idea.  I'll take this one with me on my next trip to Washington.  Oh ... and maybe we could have an "Ape Olympics" and make it a world class event ... and maybe we should modify laws to allow Apes free access to various public places like Walmart and the Public Library, etc.  Excellent idea.  I like your progressiveness. Quote Dave, the reason people are becoming frustrated with you is because most of the questions you have, which you seem to view as huge problems for evolutionary biology, are in fact a result of your limited understanding of evolutionary biology. I have an alternative explanation for the frustration (imagine that!  Mine is like this ... STAGE 1: ToE advocates are becoming frustrated because their explanations are sounding more and more like pro-geocentrism and pro-flat-earth arguments as time goes on.   STAGE 2: The Ship of Darwin has hit an iceberg and a few brave souls are jumping into life boats before it sinks.  See www.dissentfromdarwin.org STAGE 3: And now, ordinary amateur scientists like me are jumping in the fray and shining a light on a foolish theory. STAGE 4: Frustration ensues, followed by name calling, arrogant and belittling comments, talk of censorship, and the like. STAGE 5: This is turn fuels more doubts in people minds. ("Why would that guy resort to name calling?  Doesn't he have any GOODS?" etc.)   STAGE 6: Which in turn fuels more frustration and mental anguish.  And so the cycle goes until finally for some ... in a desperate moment ... possibly in the middle of the night ... or out on a peaceful lake while fishing ... STAGE 7: THE LIGHT BULB COMES ON!  (Trumpets) And one more Darwinist is rescued from the darkness of error. Quote How do you test for God? With a God Meter of course.  No.  Seriously, there are some very good ways.  Cosmic fine tuning and Biological Machines are great for starters.  And if I could get everyone on this thread to agree with me, I could hop back over to that thread (AF Dave's UPDATED Creator God Hypothesis) and give you more.  Lots more.  Stay with me.  We'll get there. Quote Let's say someone drops AFDave into the middle of the Pacific with no raft, into a pack of sharks, to see which is "more evolved".  Any bets? Aftershave ... you're in STAGE 4.  See above.  (Which means there's hope for you) Quote Why is my opinion shut out and vilified? That's an easy one.  Because your ideas are not within the mainstream of scientific understanding today.  It's that simple. Yes.  Galileo's ideas were not mainstream either.  Right. Quote Why do you ignore the fact that the chimp/human DNA thing is a PRETTY DURN BIG piece of evidence in favor of evolution, especially since it is the proof of predictions made before people even knew there was such a thing as DNA? I don't ignore it.  In fact I've acknowledged it several times to prove my sense of fairness and honesty.  Go read the whole "Chimp Chromo" thread and you will see this.  I'm trying to set a good example for how someone should act when they are proven wrong on a point as I was. And here it would be appropriate for me to repeat what I told Steve Story ... that with your "Chimp Chromo" victory ... ... you are "one bucket full" of water closer to draining the ocean.  You should feel justifiably proud. Quote AFDave, since you refer to 'more evolved' humans, do you admit that we are the result of some evolution? No.  I do not believe there is such a thing as 'more evolved' humans.  I just asked our ToE advocates why there ARE NO EXAMPLES of 'more evolved' or 'less evolved' humans.  There should be some living today if ToE is true. Quote For the umpteenth time – science is NOT a democracy, and scientific truth is NOT decided by popular vote.  Your opinion based on ignorance  doesn’t mean jack sh*t to the scientific realities of the evidence. Dave, for an otherwise intelligent guy, you’re sure doing a good impersonation of a cement-headed dumbf*ck. Not just STAGE 4.  SERIOUS, "E.R." STAGE 4.  See above. Quote We're teaching kids that this is science's best guess and its as factual as this kind of science ever gets. There are apparently more and more scientists who have a DIFFERENT guess.  But let's not consider their guess.  They are obviously 'unscientific.' Quote Looking at human society, behaviour, anatomy, physiology and genetics, our close evolutionary relationship to the great apes is obvious. Remember the vitC gene? No disagreement with any of this.  I just think it indicates COMMON DESIGN, not common descent.  Not a looney, fringe idea. Should be taught in school too.  I'm in good company ... Newton for one.  Apparently thousands of currently living scientists as well in all major universities. Quote But you have demonstrated here that you are not really competent to judge. Agreed.  That's why I enlist the help of Morris, Dembski, Meyer, Denton, Behe, etc. etc. Quote And of course, evidence doesn't matter. But in the world of science, evidence DOES matter. Evidence DOES matter.  That's why we are having this discussion.  Because the EVIDENCE favors COMMON DESIGN, not common descent. Quote But what we are discussing here is science, and science is NOT a democracy. Quite true.  Science is not a democracy.  We have to go with the evidence.  But politicians are elected by majority.  And politicians give funding to public schools and universities.  And if universities behave irresponsibly and teach junk science -- like Darwinism -- and vilify people who don't, then the electorate can demand that the politicians RE-direct the funds to responsible schools. Quote afdave, if you need retarded "science" (your idiotic AIG approved "science") to justify your faith in god you were in a world of hurt long before you came to this web site. I think you must not yet know WHY I came to this website. Quote To trot out an over used but apt comparrison.  A recent poll came out that said barely 1/3 of questioned people could locate Iraq on a map.  Does that mean that: 1)  We should improve geographic education to make sure that Americans are more aware of the world around them or 2)  We should "teach the controversy" and show both sides of the issue, both those people who believe Iraq is in the middle east, and those people who pointed at Australia and said "I think it's around here somewhere". Your analogy works if you assume that "Teaching Darwinism = Teaching that Iraq is Somewhere near the North Pole", which I of course do believe is a good equation.  And in this case, YES, I would advocate (2).   Quote Why are we standing up in science classes and teaching kids that Ape to Human Evolution is a FACT?  Because we teach them that gravity makes apples fall. Jeannot, Jeannot.  Come now.  Look what you just did.  You compared something with ABUNDANT EVIDENCE THAT WE SEE EVERY DAY (Gravity), with something for which there is NO EVIDENCE OF IT OCCURRING (Apelike ancestor becoming Human).  Or do you see this occurring in France?  (I can think of a joke about the REVERSE occurring, but I will be nice and refrain.  Besides, I liked Lafayette.)  I was beginning to be impressed with your grasp of science (the DNA replication info). How could you make this basic error? Quote Speaking of which, how are you doing with supporting your three assertions? Eric is referring to these ... 1. The Bible is literally inerrant; 2. The earth is not billions of years old, but only thousands of years old; and 3. Evolution cannot explain the origin of species. FIRST, these are not assertions that I made in my Creator God Hypothesis although I heartily agree with them all and they all have mountains of evidence to support them which I hope we can get into.  The reason I did not make them in my Hypothesis is that there are more important things to show evidence for first.  It is most important that I BEGIN with the PHYSICAL EVIDENCE ... namely, the Cosmos and the Living World around us.  This evidence includes Cosmic Fine Tuning, Biological Machines and Relativity.  Next we should observe Humanity and Moral Laws which in fact are REAL THINGS, although we cannot "see" them.  From this evidence we can postulate a Cause for all these phenomena.  There are other phenomena we can observe to get a better and better description of what this Cause might be like.  If we can establish a pretty good case for the existence of a Great First Cause, then we are not unreasonable to postulate than maybe He gave us a written message.  We posulate the Bible as a possible candidate for THE MESSAGE OF GOD TO MANKIND because of its uniqueness and seemingly supernatural character, then test our theory in detail.  If this theory is well supported from things easily verifiable, we can now move on and investigate various claims of the Bible such as the Flood, Young Earth, the Changing of Languages at Babel, etc. which are disputed widely today.  This is the general outline I am following.  Again, remember that I have never before published a "God Hypothesis" ... I am proposing one and working out the exact details of how it should go with YOUR HELP!  Thank you!  As for proving Evolution to be false, this is not my priority, as some others are doing a good job of that.  Henry Morris, Michael Denton and Michael Behe, to name a few.  Denton was more polite than I would have been in titling his book.  Instead of "Evolution: A Theory in Crisis", I would have named it "Evolution: Impending Train Wreck." NOTE:  Let me emphasize again that for YECs showing evidence of YEC Theory, the Bible is a SOURCE FOR PLAUSIBLE HYPOTHESES, nothing more.  Belief in Biblical inerrancy IS NOT required in this discussion.  This is a SEPARATE ISSUE and stands or falls on its own merits. Quote But can you get it through the front door of that meritocracy honestly? Yes.  This is happening as we speak. Quote No doubt my teaching about common ancestry (especially regarding humans and apes) makes you feel uncomfortable, since you deny the starting premise. Again, I am perfectly comfortable teaching things THAT ARE TRUE.  What I am uncomfortable with is ASSERTING things AS IF they were proven, when in fact they are not, by YOUR OWN STANDARDS. Quote "More evolved" is a difficult term and issue.  However, I don't think that it is truly meaningless in biology, nor that it would necessarily apply to the highly successful micro-organisms better than to multi-celled eukaryotes. Glen ... I enjoyed reading your entire piece.  Very insightful.  Thanks! Quote AFDave, it seems that the history of Christianity is another thing that you could learn more about. Next time you are researching, Google "Martin Luther" and anti-semitism. Read his actual writings. With regard to your claims about history, I will just observe that correlation is not causation. I'm sure I would agree with you.  But this has nothing to do with my point.  Go back and read my point again.  We'll do another thread an ML.  He's one of my favorites.  But not now.  I have alot on my plate :-) Quote Indeed, Dave should not start thinking that all the Christians who mistreated Jews were all Catholics, and that Protestants all treated them well. Many high ranking Nazis were Protestants as well. Here's what Wikipedia says about Luther: Agreed.  It was Protestants who burned William Tyndale at the stake.  You are absolutely right.  But this does not change the fact of history that the Protestant Reformation changed the world for the better. Quote Add American history to the list of subjects AFDave knows less about than he thinks. Oh?  I'll take you up on the challenge sometime.  That will be fun too! Quote There are some rules here at ATBC, and I predict you won't persist in babbling your nonsense any longer. Jeannot, have you never heard of a nifty little thing made famous by Americans called FREEDOM OF SPEECH?  Do you not have this in France? BTW ... I salute Steve and Wes for honoring Free Speech!  You have my accolades. Quote Offer a "theological biology" class..... The Darwinist Religious belief on Origins would be PERFECT for this class. Quote Exactly Paul. Individuals of our species get a HUGE leg up on our planet by being immersed in the current incarnation of human culture of whatever location they happen to be born. Where would they be if they were born into the wild and cared for by animals, or by parents that had no concept of language, and if they had no contact with anything manmade? That recent thread that touched on the subject of feral children leads me to think that they wouldn't fare very well. The extremely rare child that is raised by animals imprints upon their adoptive parents, crawling like dogs, or imitating chickens. We spend years with our families and in schools learning just the basics about the world and how to interact with it. Seeing the capabilies of Koko, given the advantage of being taught an already established, open ended language that promotes structured thought, leaves me quite awestruck at how smart and similar to us gorillas are. Whoever said that these ape societies are the 'Hominid Civilizations' afdave is looking for is right. It just goes to show what a good ecological niche it is that we used to share. There's plenty of room in the jungle for apes. I agree.  All the apes need is a good environment and they will become rocket scientists.  When I am in Washington next, I will suggest to Ike Skelton that he introduce legislation for a new, tax-funded, "Primate Education Program."  Maybe we could even have a new cabinet level office ... we already have the Department of Education ... why not have the Department of Ape Education.   Quote Is every aspiring AF pilot guaranteed to get his wings and then be allowed to fly fighter jets?  Or is there a winnowing out process so that only those who have passed a battery of rigorous tests will be deemed qualified? And who gets to decide if an aspiring pilot has the right skills and attributes to fly F-22s instead of tankers or trainers, or gets to fly at all?  Is it AF cooks, and drivers, and mechanics?  Or is the judgment made by a group of senior pilots who have themselves put in the years learning the trade, and know what separates the real aviators from the wanna-be ones? I think we should give wings and assign fighter duty to everyone who applies. Why are we standing up in the Air Force Academy and teaching that some people make better pilots than others is a FACT?  This is dishonest and potentially damaging to society for any number of debatable reasons.  What we SHOULD be doing is telling them BOTH THEORIES—ONLY A FEW PEOPLE MAKE SUPERIOR PILOTS and ALL POTENTIAL PILOTS ARE EQUALLY CAPABLE and clearly let them know they are UNPROVEN THEORIES and it is up to EACH PILOT HIMSELF and HIS PARENTS to decide if he is qualified.  My tax dollars are funding the military budget for F-22’s, etc. just like yours are and I have a different opinion on something that is an unprovable fact in either direction.  Why is my opinion shut out and vilified?  Is this country supposed to be a representative democracy or is it not?  Last time I checked IT WAS. You do believe in the democratic process, don’t you Dave?  Shouldn’t it be applied here too?  I’m really curious to hear your answers. Good question.  I knew you could say something substantive. Answer:  The generals who set the rules EARNED THE RIGHT to do so by exercising sound judgment regarding EASILY VERIFIABLE TRUTHS.  What is this EASILY VERIFIABLE TRUTH?  It's very easy to distinguish the good pilot candidates from the bad ones.  In science today, we are talking about a different matter.  We are talking about many qualified students who can do much in the way of good, useful scientific work regardless of their worldview.  To exclude people because of their worldview is like excluding people based on sex or religious preference, ESPECIALLY when there are thousands of "Darwin dissenters" among scinetists in all major universities AND half the US and British population rejects Darwinism.  This is a significant difference.  Contrast this with putting the following question on the next national ballot, "Do you think there should be a selection process in choosing fighter pilots?"  I think you'd be very close to 100% YES. Quote Why would somebody be offended by having been taught something that was believed by scientists at the time, but that found out later to be incorrect? No problem with teaching Evolution as a Theory espoused by many good scientists.  Let's just be honest and call it a theory though and quit saying it is a proven fact and shutting out the ID view. Quote Now let's try this again.  Do you or do you not find the very idea that humans are evolved apes (as are, for Flint's benefit, all present-day apes) offensive? I'm perfectly fine with the idea if it turns out to be proven true. Quote I said ... Do we not have plenty of LIVING HUMANS which could correlate very nicely with some of these fossil finds, but which we now know are completely human? Let me explain this one again, since it was misunderstood. I am saying that if we took an assortment of recently (let's say they all died at once yesterday, OK?) dead African pygmies, maybe some dead dwarfs, some dead Aborigines, some dead gorillas, etc. (a morbid thought to be sure, but you get the idea ... we are collecting 'ape-like bones' ... but if we somehow collected all these bones, we could quite possibly bury fragments of them in various places throughout the world and have a 'hominid" fossil situation  quite closely resembling the naturally occurring situation which we do have.  Make sense?  Now that you understand what I am saying, please ... go ahead and refute me.  Who knows?  Maybe you can. MAIN POINTS I LEARNED YESTERDAY (1) Humans are Humans (2) Apes are Apes (3) No one has observed Apelike ancestors becoming Humans in their lifetimes and no one ever will. (4) Fossil evidence is dicey at best (5) Genetic similarities are striking, but can just as easily be explained by Common Design (probably better when we really get into it) as by Common Descent (6) Creos and Evos have strong and opposite opinions about something which cannot be proven because NO ONE CAN OBSERVE IT HAPPENING.  Contrast this with Gravity, etc. (7) Evos are the "rulers" in academia right now and they like to call the Creos "non-scientific" (8) There's hope for academia in spite of this thanks to courageous people like Morris, Dembski, Meyer, Denton, Behe and apparently a growing number of good scientists (over 500 signatories so far on a Darwin Dissent Document) I need to get back to my main Creator God Hypothesis today if I can.  So do me a favor and just agree with me quickly so we can get on with it, would you?   :-) ---------------------------------------- Quote Dave, sometimes your understanding of evolution seems very cartoonish. I really, really think you should read a few good books on evolutionary topics aimed at a general readership. Is there a better author than Dawkins for this type of book?  I do read him some. ------------------------------------- Quote But here we are, a few days later, and now you're back to insisting that humans aren't even related to apes (despite the fact that humans are apes). Are we now going to have to assume that points you conceded a week ago are no longer conceded? Does this mean we're going to have to go over the same ground again and again with you, à la Thordaddy? Because that will get old very quickly. No, no.  We will not have to cover anything over again.  I DO agree with all those things I said I agree with.   I agree that I need to explain more fully why I believe the similarities favor Common Design over Common Descent.  I will try to address this soon. Thanks ------------------------------------ Good morning to all my "Evo" friends ... The Vitamin C issue with apes and humans seems to be a very compelling evidence for you that Apes and Humans do indeed share a common ancestor. OK.  Let's take a look.  I assume everyone is familiar with the Talk Origins article my Dr. Edward Max here and the AIG article by Woodmorappe here, right? Dr. Max begins with an analogy to a plagiarism case ... Quote One way to distinguish between copying and independent creation is suggested by analogy to the following two cases from the legal literature. In 1941 the author of a chemistry textbook brought suit charging that portions of his textbook had been plagiarized by the author of a competing textbook (Colonial Book Co, Inc. v. Amsco School Publications, Inc., 41 F. Supp.156 (S.D.N.Y. 1941), aff'd 142 F.2d 362 (2nd Cir. 1944)). In 1946 the publisher of a trade directory for the construction industry made similar charges against a competing directory publisher (Sub-Contractors Register, Inc. v McGovern's Contractors & Builders Manual, Inc. 69 F.Supp. 507, 509 (S.D.N.Y. 194 -------------- Who said that ev'ry wish would be heard and answered When wished on the morning star Somebody thought of that, and someone believed it Look what it's done so far The Daily Wingnut

BWE Posts: 1902 Joined: Jan. 2006 (Permalink) Posted: May 22 2006,21:12    6)). In both cases, mere similarity between the contents of the alleged copies and the originals was not considered compelling evidence of copying. After all, both chemistry textbooks were describing the same body of chemical knowledge (the books were designed to "function similarly") and both directories listed members of the same industry, so substantial resemblance would be expected even if no copying had occurred. However, in both cases errors present in the "originals" appeared in the alleged copies. The courts judged that it was inconceivable that the same errors could have been made independently by each plaintiff and defendant, and ruled in both cases that copying had occurred. The principle that duplicated errors imply copying is now well established in copyright law. (In recognition of this fact, directory publishers routinely include false entries in their directories to trap potential plagiarizers.) Now I have read both articles in their entirety, but before Dr. Max even gets into the details of gene "mistakes", there is one very large item jumps out at me. The analogy seems very clever, but there is a huge assumption that is made which I consider to be invalid and to me this destroys the whole analogy.  See what you think and please correct me if I am wrong. OK.  Are you ready?  With the plagiarism case, we are talking about printed words in a well-known language.  In the GLO gene case, we are talking about genetic "words" in a poorly-understood language.  I hope I don't have to cite the recent literature to prove to you how poorly we understand the genetic language.  If you do a Google Scholar search, you will see numerous articles talking about pseudogene and "junk DNA" function and how much we are learning and how much there is remaining to be learned.  Here's just one with an appropriate comment from Woodmorappe ... Quote Balakirev, E.S. and Ayala, F.J., Pseudogenes: are they ‘junk’ or functional DNA? Annual Review of Genetics 37:123–151, 2003. The very title of this article would have, only a few years ago, been almost on a par with the following: ‘The Earth: is it spherical or flat?’ Are you with me so far?  I don't want to lose anyone.  Again, I am saying that ... With the plagiarism case, we are talking about printed words in a well-known language.  In the GLO gene case, we are talking about genetic "words" in a poorly-understood language.  This is a big, big difference. Notice again that Dr. Max's whole argument rests on the following ... Quote In both cases, mere similarity between the contents of the alleged copies and the originals was not considered compelling evidence of copying ... The principle that duplicated errors imply copying is now well established in copyright law. Do you see where I am going?  Dr. Max is assuming that the state of the GLO gene in humans and apes is an error and with our as yet limited knowledge of gene function, genome function as a whole, pseudogene function discoveries, and "not-junk-after-all" discoveries about "junk DNA", this seems to be an enormous unwarranted assumption.  If, in fact, this GLO gene turns out to have some function, then Max's whole argument fails, because now the gene would be rightly interpreted as part of the correct informational content analogous to the correct informational content in the textbooks. To emphasize this point, consider a passage of text from a language which you do not know, but I do (my dad's jungle tribe for whom he is a Bible translator).  In this case, I am playing the role of the hypothetical "Designer" and you are playing the role of the genetic researcher trying to unlock the code.    Let us say the above plagiarism case involved the following text ... Quote ORIGINAL TEXT:  Twaihsom me thakwa xatkene roowo pono komo ahnoro.  Yipinin yaw so tko xakne Kaan.  Ero ke Tumumuru tak nimyakne rma okwe twaihsom mera tak ehtome so.  Waipini ro me xa matko naxe Noro pona enine komo. ALLEGED PLAGIARIZED TEXT:  Twaihsom me thakwa xatkene roowo pono komo.  Yipinin yaw so xakne Kaan.  Ero ke Tumumuru tak nimyakne okwe twaihsom mera tak ehtome so. Waipini ro me naxe Noro pona enine komo. While a word by word comparison of the above text gives some evidence of plagiarism, i.e. they are similar, you cannot conclude this positively if we use the court case guidelines because you do not know the language so as to be able to detect errors. Now I DO know the language, so I can identify an error, namely that the word "cewnaninhiri" which means "only begotten" (it is John 3:16) is left out of both texts. So we see that for Dr. Max's argument to be valid, we have to know the language which obviously, genetic researchers do not yet very well. Now there is something else interesting here.  This text of John 3:16 could be rendered in a number of different ways and yet communicate the same meaning.  For example, we could say ... Quote Yipinin yaw so xakne Kaan roowo pono komo poko. Ero ke Tumumuru tak nimyakne okwe twaihsom mera tak ehtome so. Waipini ro me naxe Kaan pona enine komo. I know the language well enough to know that this would communicate the same message, but with different structure. Now, back to biology.  It is my theory that this is exactly the situation which we will find in the genomes of various organisms as we understand more and more about them every year.  I predict that we will find that the genetic code is a very real language, complete with "words", "sentences", "phrases", "paragraphs", and different ways of saying the same thing. Now, here is something else ... How do you explain the similarity of the GLO gene "defects" of humans and guinea pigs? (you knew I was going to go here, didn't you)  Apparently, something like 36% of the substitutions are the same when compared to the functional rat GLO gene.  If we assume that there is some pro-simian ancestor that has a functional GLO gene, then it would appear that humans are more closely related to guinea pigs than to this pro-simian ancestor.  This would seem to defy the evolutionary scenario.  How do you explain this? OK.  There's some food for thought.  Now pick me apart. Oh ... and here the quote from Balakirev and Ayala for you Quote Annual Review of Genetics Vol. 37: 123-151 (Volume publication date December 2003) (doi:10.1146/annurev.genet.37.040103.103949) First published online as a Review in Advance on June 25, 2003 PSEUDOGENES: Are They "Junk" or Functional DNA? Evgeniy S. Balakirev1,2 and ­Francisco J. Ayala1­ 1Department of Ecology and Evolutionary Biology, University of California, Irvine, California 92697-2525; email: fjayala@uci.edu 2Institute of Marine Biology, Vladivostok 690041, Russia and Academy of Ecology, Marine Biology, and Biotechnology, Far Eastern State University, Vladivostok 690600, Russia; email: esbalak@bio.dvgu.ru Pseudogenes have been defined as nonfunctional sequences of genomic DNA originally derived from functional genes. It is therefore assumed that all pseudogene mutations are selectively neutral and have equal probability to become fixed in the population. Rather, pseudogenes that have been suitably investigated often exhibit functional roles, such as gene expression, gene regulation, generation of genetic (antibody, antigenic, and other) diversity. Pseudogenes are involved in gene conversion or recombination with functional genes. Link to article And here's one I like from Dr. Max that confirms what us YECers so often say about mutations ... Quote Mutations causing genetic diseases and malformations are generally so detrimental to the organism's survival and reproductive success that in the wild--i.e. in the absence of modern medical science--they would tend to be "weeded out" by the pressure of natural selection. Rarely, mutations can be beneficial to an organism: these rare cases form the basis for evolutionary adaptations that improve the "fitness" of an organism to its environment.Link to article ---------------------------- And now, while you all are busy refuting me on this thread, I will hop back over to the "Creator God Hypothesis" thread and dive in again ... It appears that no one accepts the evidence for a Creator I have given so far, so we will explore that some and find out why ... See you there ... :-) ------------------------------- Quote Then, you notice a paragraph of about 400 characters that's identical in both samples. It's not in the same place in both texts, but it is absolutely identical down to the individual character. You even note that at the end of the fifth sentence, there's an extra period. You have no idea what any of the text means, but is there any doubt, at this point, that one sample was in fact at least partially copied from the other? Is there any possible doubt that both articles share a common provenance? You don't need to know anything whatsoever about the language to make this determination, Dave. And it is far from true that biologists know nothing at all about the genetic code. In fact, they may not know what all the "paragraphs" (i.e., genes) in the genetic code mean, but they sure know what the "words" (i.e., codons) mean. Are you saying that this is what has been found?  I did not understand that from the findings of the authors below ... My knowledge of this Quote All we really know is that ... (a) it is somewhat similar to the functional rat GLO gene (149 out of 647 substitutions when comparing humans to rats, 96 out of 647 substitutions when comparing guinea pigs to rats), comes from this Quote Inai, Y., Ohta, Y. and Nishikimi, M., The whole structure of the human non-functional L-gulono-ã-lactone oxidase gene—the gene responsible for scurvy—and the evolution of repetitive sequences thereon, J. Nutritional Science and Vitaminology (Tokyo) 49(5):315–319, 2003. Apparently we do not have a situation of identical sequences if I am reading this correctly.  Or maybe there is another study that I could not find which states that the human and ape GLO genes ARE identical? ------------------------- Again ... IF we find the GLO gene sequences identical (or very close) in apes (I think we only have rat, human and GP currently), why does this prove common descent of apes and humans?  We do not KNOW that the human (and presumable ape) manifestation is in fact an "error" because we don't know the genetic language well enough yet.  All we know is that BOTH apes and humans cannot synthesize Vitamin C.  It is and ASSUMPTION to say that "see it's because their GLO gene is broken."  How can you say that?  Maybe that's was never intended to BE a GLO gene in the first place.  You don't know because you don't know the language well enough yet. My bet is that when we DO learn the language well enough, we will see it has a purpose far different that Vitamin C production. Here's another analogy ... Do you think that "The dog is barking" and "The dog is barfing" means that the second sentence is somehow "broken"??  Of course not.  They are both valid sentences but they mean ENTIRELY different things. Also, in our language, the same words can mean two different things in different contexts, i.e. "bark" (dog) and "bark" (on a tree). I really think Dr. Max is making a bad analogy and assuming too many things. ------------------------------- Quote Can you tell me what a "frameshift mutation" is? Can you tell me the significance of a frameshift mutation? Somewhat familiar ... I can read up on it quickly if I need to ... But go ahead ... why is that significant here?  I honestly want to understand this Quote Yeah. Look at the cytochrome c gene. I thought were talking about the GLO gene which supposedly formerly allowed Vit C production in primates, but now is broken and does not anymore.  Why do you mention Cytochrome C genes? --------------------- Quote What if "The dog is barking" and "The dog is barfing" were two sentences from two different novels that were 95+% similar? You seem to be forgetting the Vitamin C stuff happens in that kind of context. No I'm not forgetting.  But OK.  Let's write a "novel" describing how to make a pine tree and another "novel" that describes how to make an oak tree.  OK? HOW TO MAKE A PINE TREE Start with a 50 foot long piece of soft wood.  Add some rough bark.  Poke it upright in the ground.  Add some kinda straight branches that angle down.  Add leaves that are thin and poky.  Etc. Etc. Voila!  Pine Tree! HOW TO MAKE AN OAK TREE Start with a 50 foot long piece of hard wood.  Add some semi-rough bark.  Poke it upright in the ground.  Add some kinda crooked branches that angle up.  Add leaves that are broad and smooth.  Etc. Etc. Voila!  Oak Tree! Now ... notice they are 95% (or so) similar?  Do they share a common ancestor?  No.  I assembled them in my backyard with raw materials following these highly detailed instructions. (I didn't really, but I could have) The burden of proof for Common Descent seems to me to be much more difficult that the burden of proof on Common Design. Thoughts? ------------------------- Quote Wrong again, pine breath! You are the common ancestor of both. Hey watch it, oak breath ... I am the common DESIGNER of both :-) Quote It's hard to judge as you haven't presented any evidence for common design. This is what the ID movement is all about.  Stay tuned!  And tell your friends to quit throwing fire bombs and at least listen .... then make judgment. That's the hard part -- even getting people to listen --because most people are so set in their thinking. Well ... I'm quitting until evening ... so I guess I'm gonna start losing now by default. ----------------------- Good morning everyone-- We are getting close to wrapping up this thread and I feel it is an important thread because the differences between apes and humans are in fact immense, and whether you realize it or not, there are many major issues riding on the answer to the question, "Common Descent or Common Design?"   The bottom line, of course, is ... IF Common Descent is true, then there is no need for a Creator.  Humans are free to believe in one, or pretend there is one, or whatever.  None of the 'God talk' really matters much and those who don't care to participate in 'God think' are free to leave 'Him' completely out of their thoughts and discussions.  There is no afterlife, no heaven, no ####, no judgment for actions in this life, and the best we can do is live in harmony with our fellow man and have a good time until we die.  And when we die, that's the end of the story. However, IF Common Design is true, then this raises a whole string of potentially life changing questions.  What is this Designer like?  Is it one Designer?  Or many?  If He designed ME, does he want anything from me?  The Creation myths are well known ... could there be any truth to any of them?  After all, there is one in particular that speaks of a Creator God who will someday hold humans accountable for their actions.  Could there be any truth to this?  Could it be that the Creator God spoken of in the Bible might in fact be one and the same as the Designer of the Cosmos and Biological Systems for which evidence continues to mount? I think it was Renier (can't remember for sure) who said that he "used to be a YEC fundy" but is no longer because of the Vitamin C issue. Just to recap yesterday ... Talk Origins has two relevant articles that I found (1)  Plagiarized Errors and Molecular Genetics Another argument in the evolution-creation controversy by Edward E. Max, M.D., Ph.D. and (2)  29+ Evidences for Macroevolution, Part 2: Past History Copyright © 1999-2004 by Douglas Theobald, Ph.D. Prediction 2.3: Molecular vestigial characters Abstracts for the 3 articles referred to by the second article are as follows: Quote Abstracts from Talk Origins:  29+ Evidences - Vitamin C Pseudogene 1: J Biol Chem. 1992 Oct 25;267(30):21967-72. Related Articles, Links   Guinea pigs possess a highly mutated gene for L-gulono-gamma-lactone oxidase, the key enzyme for L-ascorbic acid biosynthesis missing in this species. Nishikimi M, Kawai T, Yagi K. Institute of Applied Biochemistry, Yagi Memorial Park, Gifu, Japan. Guinea pigs cannot synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, a key enzyme for the biosynthesis of this vitamin in higher animals. In this study we isolated the L-gulono-gamma-lactone oxidase gene of the rat and the homologue of this gene of the guinea pig by screening rat and guinea pig genomic DNA libraries in lambda phage vectors, respectively, using a rat L-gulono-gamma-lactone oxidase cDNA as a probe. Sequencing analysis showed that the amino acid sequence of the rat enzyme is encoded by 12 exons and that all the intron/exon boundaries follow the GT/AG rule. On the other hand, regions corresponding to exons I and V were not identified in the guinea pig L-gulono-gamma-lactone oxidase gene homologue. Other defects found in this gene homologue are a deletion of the nucleotide sequence corresponding to a 3' 84-base pair part of rat exon VI, a 2-base pair deletion in the remaining exon VI-related region, and nonconformance to the GT/AG rule at one of the putative intron/exon boundaries. Furthermore, a large number of mutations were found in the amino acid-coding regions of the guinea pig sequence; more than half of them lead to nonconservative amino acid changes, and there are three stop codons as well. Thus it is clear that the guinea pig homologue of the L-gulono-gamma-lactone oxidase gene exists as a pseudogene that randomly accumulated a large number of mutations without functional constraint since the gene ceased to be active during evolution. On the basis of the neutral theory of evolution, the date of the loss of L-gulono-gamma-lactone oxidase in the ancestors of the guinea pig was roughly calculated to be less than 20 million years ago. J Biol Chem. 1994 May 6;269(18):13685-8. Related Articles, Links   Cloning and chromosomal mapping of the human nonfunctional gene for L-gulono-gamma-lactone oxidase, the enzyme for L-ascorbic acid biosynthesis missing in man. Nishikimi M, Fukuyama R, Minoshima S, Shimizu N, Yagi K. Institute of Applied Biochemistry, Yagi Memorial Park, Gifu, Japan. Man is among the exceptional higher animals that are unable to synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, the enzyme catalyzing the terminal step in L-ascorbic acid biosynthesis. In the present study, we isolated a segment of the nonfunctional L-gulono-gamma-lactone oxidase gene from a human genomic library, and mapped it on chromosome 8p21.1 by spot blot hybridization using flow-sorted human chromosomes and fluorescence in situ hybridization. Sequencing analysis indicated that the isolated segment represented a 3'-part of the gene, where the regions corresponding to exons VII, IX, X, and XII of the rat L-gulono-gamma-lactone oxidase gene remain with probable deletion of the regions corresponding to exons VIII and XI. In the identified exon regions were found various anomalous nucleotide changes, such as deletion and insertion of nucleotide(s) and nonconformance to the GT/AG rule at intron/exon boundaries. When the conceptual amino acid sequences deduced from the four exon sequences were compared with the corresponding rat sequences, there were a large number of nonconservative substitutions and also two stop codons. These findings indicate that the human nonfunctional L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations without selective pressure since it ceased to function during evolution. Biochimica Biophysica Acta, International Journal of Biochemistry and Biophysics,(ISSN: 00063002) 1999 Oct 18;1472(1-2):408-11.  Related Articles, Links Random nucleotide substitutions in primate nonfunctional gene for L-gulono-gamma-lactone oxidase, the missing enzyme in L-ascorbic acid biosynthesis. Ohta Y, Nishikimi M. Department of Biochemistry, Wakayama Medical College, Japan. Humans and other primates have no functional gene for L-gulono-gamma-lactone oxidase that catalyzes the last step of L-ascorbic acid biosynthesis. The 164-nucleotide sequence of exon X of the gene was compared among human, chimpanzee, orangutan, and macaque, and it was found that nucleotide substitutions had occurred at random throughout the sequence with a single nucleotide deletion, indicating that the primate L-gulono-gamma-lactone oxidase genes are a typical example of pseudogene. The first article above compares the functional rat GLO gene with the supposedly homologous guinea pig GLO gene and finds significant differences.  They say "Thus it is clear that the guinea pig homologue of the L-gulono-gamma-lactone oxidase gene exists as a pseudogene that randomly accumulated a large number of mutations without functional constraint since the gene ceased to be active during evolution." The second article does the same comparison for rats and humans and concludes ... "These findings indicate that the human nonfunctional L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations without selective pressure since it ceased to function during evolution." The third article does the same comparison among humans, chimpanzees, orangutans, and macaques, and it was found that "nucleotide substitutions had occurred at random throughout the sequence with a single nucleotide deletion, indicating that the primate L-gulono-gamma-lactone oxidase genes are a typical example of pseudogene." Dr. Max draws on these findings and compares the situation to a copyright court case.  His argument is that since apes and humans have the same "errors" in the "broken GLO gene", this shows that apes and humans have a common ancestor. Now this has one HUGE assumption which appears to me to be entirely unwarranted.  now maybe it is warranted,  but no one gave me any reasons that it should be yesterday DR. MAX's HUGE ASSUMPTION The apparently homologous "GLO gene" in humans, primates and guinea pigs used to function to produce Vitamin C, but now no longer does.  As such this constitutes a "broken gene" caused by random mutation.  My question is ... why do you assume these 3 organisms EVER had a functioning GLO gene?  Maybe this gene DOES HAVE a function which we just don't know about.  After all, we are seeing a dramatic reversal in the area of pseudogenes.  Scientists are all of a sudden finding all kinds of purpose for them.  Do a Google Scholar search to see this. Does anyone have any good arguments for why this is a good assumption to make? Because Dr. Max's whole argument rests on this being a valid assumption.  If it is not valid, then his whole argument fails. OK ... now tell me ... why is this assumption valid? (By the way, Tom Ames, I didn't see that frame shift mutations have anything to do with this discussion, but please correct me if I am wrong) ----------------------- Thanks to Tom Ames for clarifying one point -- I thought you were bringing up something that was relevant to our discussion of the supposedly "broken GLO gene", but apparently I was mistaken.   Maybe it's time for a review again.  I'll put it in bold so no one will miss it ... then I'll repeat it a few days from now for the slow ones THINGS THAT ARE NOT AF DAVE'S GOALS (1)  Get a biology degree (2)  Become a genetic engineer (3)  Get an advanced science degree (4)  Become a biochemical researcher (5)  Pretend I know more about biology than you (6)  Become a geologist (7)  Become an astrophysicist OK?  ... again, I appreciate all the admonitions to get this or that degree or go buy this or that book ... but it's not necessary ... there are plenty of competent researchers like Mr. Nishikimi out there who give me the data I need, and of course I do have YOU ALL to keep me straight. And I should point out that you guys do a great job of knowing biology and the workings of DNA and transcription and chromosomes and all these wonderful details. Your problem is NOT your comprehension of the data or in understanding the mechanics of how things work.  You are even quite good at explaining this stuff -- Incorygible did a great job explaining the transcription thing.  Spent a lot of time on it too, I understand. Your problem is simply your interpretation of data and your sometimes faulty logic.  I don't fault you for this ... it's understandable because of the overwhelming power of your Darwinian worldview.  You have been fed a steady diet of Darwinism since you were very young and it wields much power over your minds (much like a religion) and while this is not a problem for most of the things you do, it makes you fall into saying some illogical things when you start trying to explain your view of origins. THINGS THAT ARE AF DAVE'S GOALS HERE AT PANDA'S THUMB (1)  Find out firsthand why Darwinists believe humans and apes have a common ancestor and evaluate if this is reasonable.  We're making good progress here. (2)  Find out firsthand why Darwinists are apparently losing the PR game in the USA.  I find it strange that Darwinists have been so unsuccessful in convincing the public of their views because of the virtual monopoly that Darwinists hold over schools, museums, magazines, the media, etc. (3)  Present my evidence that supports a Designer, followed by evidence for YEC, the Flood, the inerrancy of the Bible, etc. (4)  Help as many open-minded folks as possible who read my threads walk through all of my "SEVEN STAGES IN THE EVOLUTION OF A FORMER DARWINIST." Again, these are ... SEVEN STAGES IN THE EVOLUTION OF A FORMER DARWINIST STAGE 1: ToE advocates are becoming frustrated because their explanations are sounding more and more like pro-geocentrism and pro-flat-earth arguments as time goes on.   STAGE 2: The Ship of Darwin has hit an iceberg and a few brave souls are jumping into life boats before it sinks.  See www.dissentfromdarwin.org STAGE 3: And now, ordinary amateur scientists like me are jumping in the fray and shining the light on their weak arguments. STAGE 4: Frustration ensues, followed by name calling, arrogant and belittling comments, talk of censorship, and the like. STAGE 5: This is turn fuels more doubts in people minds. ("Why would that guy resort to name calling?  Doesn't he have any GOODS?" etc.)   STAGE 6: Which in turn fuels more frustration and mental anguish.  And so the cycle goes until finally for some ... in a desperate moment ... possibly in the middle of the night ... or out on a peaceful lake while fishing ... STAGE 7: THE LIGHT BULB COMES ON!  (Trumpets) And one more Darwinist is rescued from the darkness of error. Now that we have that clarified, the present issue that we are discussing is ... THE SUPPOSEDLY BROKEN VITAMIN C GENE IN HUMANS AND APES Again, some of you need to re-read yesterday's posts because someone made the same mistake today which was made yesterday, namely, someone today was basically saying ... "Of course humans and apes have a broken Vitamin C gene.  Isn't that obvious?  Wouldn't it be obvious if there were some tires and broken car pieces laying on the side of the road that we were viewing a broken car?" YES with the car.  NO with the genes. Your mistake in logic is that you have ASSUMED that humans and apes at one time in their history actually had a functional GLO gene.  This has to be your assumption if you say it is "broken" now, and the fact is that you do not know this.  Also, you are assuming that you (or the genetics researchers, rather) know enough about the genetic language to even recognize an error.  My contention is that we (genetic researchers) know SO LITTLE about any genomes, that we cannot assert that this gene or that gene is broken. Please tell me that you guys ARE aware of all the new information coming in about "junk DNA" that apparently isn't junk after all (the gene we are discussing IS one of those genes, right?)?   You guys are the biology experts ... you should know this. So am I clear now?  You guys did very well on the Chimp Chromosome thing, but on this thread, it seems you don't have much understanding of this particular issue and many of you apparently have not even read the relevant articles. Do you really want me to go away from this thread thinking you guys are confused about this issue?  Because right now, that's what I think.  Remember, one of my goals is to try to determine why Darwinists have been only mildly successful in selling their views on the open market.  Your arguments on this thread so far help me understand why this is. Maybe you can think about some of this tonight and redeem your arguments tomorrow. Remember, you guys did good just last week on the chromo thing ... I know you guys can give me some substance on this thread as well. Again, this is really simple ... all you have to do is present evidence of WHY you are so sure that humans and apes formerly had a functioning GLO gene, but now do not.  Simple, right?  Sleep on it ... it'll probably come to you. (Oh, and BTW ... I think Atheists are very good, moral people ... it's the long term trend of society that worries me, but we'll get to that elsewhere ...) Have a good night and I'll see you in the morning! ------------------------- Argystokes said ... Quote Hi AFDave, Let me see if I can add something to the conversation. You've been arguing that what appears to be a broken GLO in primates may not be in fact broken at all, but is rather a designed stretch of DNA that performs some unknown function (we'll call this "pseudo-GLO").  You haven't stated it explicitly, but I think we can infer that this putative function has nothing to do with Vitamin C synthesis (seeing as primates and guinea pigs can't do it).  That is, pseudo-GLO has a function entirely distinct from regular GLO. If pseudo-GLO has a distinct function, we could use the framework of common design (as well as common descent) to predict that pseudo-GLO would be found in organisms that have functioning GLO.  This is because there is no reason to predict that a gene unrelated to Vitamin C would only be found in GLO-deficient species. So there are two possible scenarios: (1) Pseudo-GLO is found throughout the animal kingdom (either ubiquitously, randomly, or in nested hierarchies).  This type of scenario, where a species has a functional gene and a pseudogene is not uncommon. (2) Pseudo-GLO is only found in species unable to synthesize vitamin C. It seems to me that a design hypothesis would only predict scenario (1), for reasons discussed above.  Common descent would predict either scenario (2), or scenario (1) with nested hierarchies of Pseudo-GLO (this would be the result of a duplication of GLO followed by the inactivation of one of the copies, which still persists in the population).  Seeing pseudo-GLOs (especially those that look very much alike) randomly throughout the animal kingdom would certainly be a surprise to me (I can think of a mechanism by which it might occur, but we won't get in to that).  Ubiquitous pseudo-GLO would strongly imply that it has an important function, but would not really support either common descent or common design over the other. I haven't done the research to find out which is the case, but there should be sufficient online tools to find out which is the correct scenario.  With the relatively low number of genomes sequenced, it is probably not possible right now (using good ole look-it-up-online methods) to differentiate between the subscenarios of scenario (1). I'm willing to look up the information for you (assuming you don't know how to do a BLAST search) if you're willing to concede that scenario (2) does not logically fit with a special creation model. So how's about it, Dave?  Shall we do some science? This is an excellent discussion here.  I like the terminology you use to keep everything clear.  You are correct that I have lately focused on the question "Why are researchers so sure this is a broken gene?"  I think this is a legitimate question to ask (but I could be wrong) in light of statements like this from Watson (co-discoverer of DNA) in 2003 ... Quote ‘The most humbling aspect of the Human Genome Project so far has been the realization that we know remarkably little about what the vast majority of human genes do.(Watson, J.D., DNA: The Secret of Life, Alfred A. Knopf, New York, p. 217, 2003.) and we are obviously learning much about pseudogenes as the following title suggests ... Quote PSEUDOGENES: Are They "Junk" or Functional DNA? Evgeniy S. Balakirev1,2 and ­Francisco J. Ayala1­ 1Department of Ecology and Evolutionary Biology, University of California, Irvine, California 92697-2525; email: fjayala@uci.edu 2Institute of Marine Biology, Vladivostok 690041, Russia and Academy of Ecology, Marine Biology, and Biotechnology, Far Eastern State University, Vladivostok 690600, Russia; email: esbalak@bio.dvgu.ru And the answer may well turn out to be that it is in fact a broken gene, when more is known.  But if the answer is "Yes, it IS broken", then there is another question which immediately follows.  I mentioned this early on and we never explored it.  The next questions would be these ... "Did it break independently in humans and apes?  Or did it break in our ape-like ancestor and get transmitted to both apes and humans as Dr. Max asserts?"  Is it not just as plausible that both ape and human GLO "broke" independently?  Design hypothesis predicts similarity in the the two genomes also, but for a different reason than common descent advocates.  It seems to me that it is quite probable that IF apes and humans did in fact at one time have functional GLO, the functional genes would have been quite similar (is it not true that OTHER functional genes found today in apes and humans are similar?)and the large differences b/t apes and humans that we see today would have also been seen at that time in the past.  This scenario also seems to me to be supported by the 2003 Inai study comparing guinea pig and human pseudo-GLO.  Guinea pigs and humans are obviously not in sister groups, but they both have pseudo-GLO, which actually has 36% "identicalness" according to the report.  Are we to conclude that humans are more closely related to guinea pigs who (like humans) have pseudo-GLO, than to pro-simians who have functional GLO?  It seems that the guinea pig-human pseudo GLO similarity all by itself falsifies common descent for apes and humans. So I think the following possibilities exist ... (1) Pseudo-GLO is NOT "broken GLO" and is found throughout the animal kingdom (either ubiquitously, randomly, or in nested hierarchies).  This type of scenario, where a species has a functional gene and a pseudogene is not uncommon. (2) Pseudo-GLO IS "broken GLO" and is only found in species unable to synthesize vitamin C ... this is because the gene "broke" in the ape-like ancestor, then this "broken gene" was copied throughout the evolutionary path to humans.  If this is true, however, you would still need to explain how the gene broke independently in the guinea pig ancestor, but wound up in modern guinea pigs looking "36% similar" to modern human pseudo-GLO.  You have the problem of the appearance that humans are more closely related to guinea pigs than to the pro-simians! (who have functional GLO) (3) Pseudo-GLO IS "broken GLO" and is only found in species unable to synthesize vitamin C ... this is because all animals were designed with a functional gene, but now some have independently lost function because of mutations. I realize that at this point, I have not given positive evidence for the Design Hypothesis regarding apes and humans, because that was not my goal on this thread.  I have only pointed out that Dr. Max's assumptions -- (a) this is a broken gene and (b) if it is broken, this proves common descent -- are unwarranted assumptions. This whole thread started because someone (I think Renier) said he used to be a YEC advocate, but abandoned it because of this issue which he thought was a closed case.  If nothing else, I think I have shown that it is definitely not a closed case. As for which of the above 3 scenarios is true, I obviously do not know yet.  It does appear that (2) is not consistent with the evidence that we DO have.  My suspicion is that (3) will turn out to be the correct one when more is known.  Either (1) or (3) appears to be consistent with the Design Hypothesis. Quote ps Once again could you confirm or deny that you don't think we can infer any of this stuff as we didn't see it happen. I confirm that we can indeed infer many things in spite of the fact that we did not see it happen with our own eyes.  In fact, this is my exact argument on my other thread where I INFER a the idea of a Super-Intelligent Engineer from "apparently engineered" biological "machines."  I also INFER an Intelligent "Parameter Setter" from the "apparent precise setting" of the many parameters required for life in the Cosmos in which we find ourselves. Quote 1- This is ironical, coming from someone taking the Bible as evidence for his hypothesis. Again, if you read my threads, you will see that Bible is  a source for plausible hypotheses.  It is not "evidence" to support them.  My evidence comes from scientific observation of nature. Quote It's not an assumption. It's a tested hypothesis that follows from the theory of evolution. It's been cross-checked in thousands of organisms and it fits neatly with all the data. I asked you to explain why Nishikimi could expect to find gulo-homologous sequences in humans, orangs and guinea pigs, if not because of common descent. No response. Are you saying that the analysis proposed by Argystokes has already been done?  I know of GLO being analyzed in a few primates, guinea pigs and humans, but thousands of organisms?   Quote By the way, it's rather amusing to see you try to lecture people on mistakes in logic:  "IF Common Descent is true, then there is no need for a Creator....There is no afterlife, no heaven, no ####, no judgment for actions in this life, and the best we can do is live in harmony with our fellow man and have a good time until we die.  And when we die, that's the end of the story. Is this what you consider logic? There couldn't possibly be a God, heaven, he##, and common descent? Why not? Notice carefully what you just did ... I said this ..."IF Common Descent is true, then there is no need for a Creator" and you quoted me as saying this ... "There couldn't possibly be a God, heaven, he##,and common descent? BIG, BIG difference.  Think about it.  We need to be very careful in our quotes and our logic.  I believe these types of assumptions, rushes to judgment, and lack of sound logic are precisely why Darwinists are painting themselves into a corner which will ultimately be an embarrassment to them.  We have already seen the embarrasment to Darwinists of their failed predictions in the fossil record.  Darwinists predicted continuous transitional forms in the fossil record.  Creationists predicted ubiquitous gaps.  Creationists were correct.  Darwinists predicted true "vertical evolution" (or macro-evolution), but leading evolutionary scientists have now admitted that no true vertical evolution from one kind of organism to a more complex kind has ever been observed in all human history. Creationists predicted that any "evolution" would be lateral or downward and this has been confirmed.  Creationists also predicted the limited variation that we see in natural and artificial selection, but Darwinists try to use this as evidence for their failed predictions of true vertical evolution, when in fact it is better evidence for "designed adaptability" put in the originl created "kinds" by the Creator.  Since all this and many other things outlined by Denton and others have been embarrassing and unanswerable by Darwininsts, they are now repeating the same logical mistakes at the molecular level.  I predict the results will be the same.  And if that were not enough, they are calling Creationists and ID people stupid for questioning their theories!! Quote After all, it could be that the Flying Spaghetti Monster created us with his noodly appendage. I admit this is a logical possibility.  I challenge you to find evidence which supports it. Quote AFDave: Your smugness is quite grating. I assume you're doing that on purpose, no? It always amazes me how the preachiest christians lack what I would have thought would be the "zeroth commandment" of christianity: humility. Have I not demonstrated humility by "eating crow" graciously about the chimp chromosome issue?  I think what you perceive as smugness here is in reality a little bit of satire and poking fun at a theory.  I am trying very hard to use innovative tools to jar people's thinking.  I think Darwinists are so steeped in logical fallacies that it takes something rather jarring to make them wake up and see the errors. Quote I think that idea sounds a little screwy, but it does seem to me that some junk DNA won't be the vesigial stuff we are predicting. Supposedly 90 percent of our genetic material is this junk DNA, but our bodies don't support 90 percent  junk organs -- or vestigial organs -- why would our DNA? My point exactly.  I am not familiar with the "fractal" theory or whatever it was.  I do not claim to have an idea about what all that "junk DNA" does.  It will be fun to investigate it though. Quote No, dave. It's not an assumption. It's an inference, based on evidence. There's a difference. Thank you for agreeing with me (and Meyer) that INFERENCES to the Best Explanation are valid.  This is exactly what I am doing on my other thread to try to explain a Creator. -------------------- Quote I just performed a quick BLAST of GULO (exon 10), and the homology between human and chimp is 97%. No surprises there, right? So you want the original article? ... I can probably have it on Monday or Tuesday ... Are you saying you will agree with me if I give it to you? (Just kidding! --------------------------------- Quote It's not even necessarily true on that 'one little piece of DNA'. Whats the sequence similarity for the GLOs? We just know in this discussion that two are broken. It's absolutely idiotic to use this single fact to infer things about common descent. Steve!  My buddy!  You and I agree on something ... I KNEW it would happen sooner or later. That's what I've been trying to say ... Dr. Max's article on T.O. uses this as evidence of common descent for apes and humans.  My point has been all along that this assertion is not warranted with just this little bit of knowledge that we have. But I'm also not saying it proves Common Design.  It obviously doesn't, but it at least argues that either one is a possibility. Again, the whole thing started with Renier saying "Look ... Dr. Max has proven common descent with this Vitamin C thing" which I think he has not. ----------------------------- Quote afdave, that's just retarded! And you're quote mining. steve is talking about that so called 36% similarity being poor evidence of our relatedness to rats. Aw come on ... you mean Steve isn't agreeing with me here?  Bummer ... Oh well ... gotta keep trying!  Gonna happen sooner or later ... I AM interested in hearing the outcome of the big Saturday night event ... "Max vs. Woodmorappe" Faid?  Any more analysis from your corner? ----------------------------- Quote Why do you ask? Got anything to share? I thought you were going to show why Dr. Max of Talk Origins is correct and Woodmorappe of AIG is wrong on this "Vitamin C gene" issue. That's what we were talking about ... ------------------------------- Quote There it is.  They [AIG] don't do science, they do apologetics.  They don't do any scientific research for themselves--the best you can say is that they are armchair critics. Armchair critics ... er, yes ... sort of like you, right? It's funny that Evos think that Creos should "do their own research."  That would be like me saying   "PT and TO people shouldn't quote researchers like Nikimishi and Inai ... they should do their own research!!" Pretty silly argument, now, isn't it? Yeah, I thought so ... you can take it back if you like ... I won't embarrass you by quoting you further. ------------------------------ Quote So Dave, since 36% of similarity between the broken GLO genes in guinea pigs and human are very low and support our view, what is your interpretation? My view is that Dr. Max made an unwarranted assertion by saying that "GLO mistakes" were copied from the common ancestor of apes and humans.  I think the GLO situation we have in humans and apes today could just as easily support Common Design Theory.   Of course, it is fine for him to have that interpretation if he chooses.  I just think we know too little to be dogmatic as he seems to be. Renier said that basically this was a closed case for him and was the very issue that made him abandon the YEC position. ********************* Separate issue:  the guinea pig thing This is interesting, but I'm not saying anything dogmatic about it.  I really don't understand enough about it and I would value Jeannot's analysis of the AIG article.  Jeannot, do you also have the Inai article that AIG quotes? It appears that they are saying that humans would be more closely related to guinea pigs (because humans also have broken GLO) than to pro-simians (functional GLO) if we followed evolutionary logic, but this is obviously absurd, because they are not related.  Again, I don't know if I agree with this or not. I think they are also pointing out that evolutionists agree that guinea pig GLO broke independently from the simian line, so why shouldn't we expect ape GLO to break independently from human GLO? We should.  At the very least, we cannot dogmatically say that the GLO gene definitely broke in the common ancestor, then was copied to apes and humans. Do you agree? ------------------------ Faid said ...   Quote Dave, we're referring to AiG and all their proclaimed experts, like Woodmorappe, not you. You reply by referring to us. And AiG does not quote scientific research that supports Genesis (because there isn't any, and they cannot come up with any), so they take existing scientific research and try to twist and distort its data to their liking. They're liars, dave. I was not referring to you.  What I said was ...   Quote That would be like me saying "PT and TO people shouldn't quote researchers like Nikimishi and Inai ... they should do their own research!!" My point was that people like Dr. Max on Talk Origins use other people's research (Inai, Nikimishi, etc.) and draw conclusions ... why shouldn't AIG do the same?  Obviously they are going to have different conclusions because they hold a different world view.  This is not lying.  You have not shown me one lie they have told.  You have shown me that Dr. Wieland was uninformed about transcription direction being unimportant.  And I agreed with you. But you have not shown me that they lie. Quote It's not simply the fact that GLO is 'broken.' It's the exact nature of the 'breaks.' That's what supports evolution & common descent. You realize that genes are generally a few thousand base pairs long (or longer), right? And you realize that there are many, many, many different genetic changes that can 'break' (inactivate) any given change? So, if humans and other great apes all have an inactivated GLO gene, and the cause of the inactivation is virtually identical in all of them, that's evidence for evolution via common descent. Not proof. Evidence. I do understand all this, yes.   I think my understanding is correct that human and ape genes are about 95% (or 97) similar.  My assumption would be that the inactivated GLO gene would likewise be approximately 95% (or 97 or whatever it really is) similar also.  Is this correct?  Or am I to understand that human and ape GLO is 100% IDENTICAL?  Can someone confirm this for me? If the former is true, then to me it is clear that Dr. Max's assertion that this proves common descent is an OK guess, but it doesn't close the case.  One could just as easily say that apes and humans are separate designs and the GLO broke independently in each.  Why should we think it would not?  Apparently it did also break independently in guinea pigs. And again, the 36% thing to me is a side issue.  What I am trying to show is simply that Renier said that Dr. Max said that the broken GLO in humans is exactly 100% the same as in apes.  Enter Dr. Max's copyright case. And yes, IF this is the situation we in fact have, then I would agree ... it looks like common descent. Quote What we can say is that evolution not only provides detailed, mechanistic explanations of the available data, is also accurately and reproducibly predicts new observations. Creationism does neither of those things. That's why evolution is science, and creationism is not. That's why evolution should be taught in science class, and creationism should not. Creationism HAS provided many detailed explanations of the available data and has accurately predicted many things, including ubiquitous gaps in the fossil record and the inability to induce "good changes" or "vertical evolution" in fruit flies by "speeding up the evolutionary timescale." It has predicted a certain "fixity of kinds" and "downward evolution" (not "upward") (note we are using MY terminolgy here in which humans are "at the top" of the hierarchy and single celled organisms are at the bottom--this is my convention, of course, but I believe it to be a good convention which in many ways can be a useful organizational tool) which in fact has been observed--i.e.  our bodies continue to accumulate more and more harmful mutations and the bacteria are winning, among other things.  It hypothesized that coal does not require millions of years to form, but can be formed quite quickly.  This has now been shown.  It hypothesized that sedimentation such as that seen in the Grand Canyon is not formed gradually over millions of years, but is formed catastrophically.  This has now been proven at Mt. Saint Helens where there is a "miniature Grand Canyon which was not there before 1980.  Creationism and the idea of the the Curse has the only sensible description of human nature which lines up with what we actually observe.  And many other things which we have already begun to get into on my "Creator God Hypothesis" thread. Quote According to common design, the creator would have put broken copies of a gene in each species, copies that reflect the current phylogeny, built with coding genes. Why would he? A broken gene is not part of a design, it's useless. You said you would readily accept any evidence for common descent. I don't think you are sincere. What kind of proof would convince you? Please see above.  Can you confirm that the broken GLO gene is 100% identical to the broken ape GLO gene?  If so, then I think you have something. Quote And what are your thoughts on the fact that AIG only referred to the 36% homology between guinea pigs and humans, but forgot to mention the 97% identity between us and chimpanzees? Silly mistake again? No.  Just irrelevant to their discussion.  The whole Inai paper discussion (I think) is intended to show that "Guinea pigs GLO gene broke independently.  Why shouldn't apes and humans GLO gene ALSO break independently?  They may be trying to say something further than this also when they get into the pro-simian discussion and 36% etc., but I don't really follow that part of their argument.  They freely acknowledge elsewhere that there is great similarity in ape and human genes, so it is clear they are not trying to obfuscate.  They may think it will come in a bit less--maybe 90%--when more is known, but even if it stays at 95-97, this does no damage to their idea that apes and humans DO NOT share a common ancestor.  A house builder builds many houses that look similar--97% similar probably--but this is obviously because of a Common Designer, not Common Descent. By the way, the 36% 'similarness' number comes from 47 out of 129 substitutions, i.e. 47/129=0.36.  I do have the complete Inai article, and they themselves say "A high percentage of the same substitutions in the total substitutions (36%) indicates that there were many hot spots for nucleotide substitution throughout the sequences examined." (Journal of Nutritional Science & Vitaminology, 2003, Vol. 49, Issue 5,p. 316).  This does not lead to any profound conclusions for me ... how about you? I did not see anything in this article which would confirm 100% identicalness of human GLO to ape GLO.  Possibly some other article has this? Quote I keep asking, and you keep not answering: what, in the "common design theory", would have led Nishikimi to expect to find gulo homologs in humans and guinea pigs?" To me it is quite conceivable that a Designer designed functional GLO genes in all the distinct "originally created kinds."  The fact that Human Designers make similar structures to perform similar function should have led Nishikimi to expect to find homologues in the natural world as well.  I don't think the genes have to be identical to be functional.  Just as several different codons can code for a particular protein (I think that's correct, right?--help me all you genetics experts). Similarly, in the English language, I can say I'm going to go grocery shopping in a variety of different ways ... "I'm going to go buy some food" and "I'm gonna drop by Safeway and restock our vittles" and "I'm going to go to town and get our pantry restocked" all communicate the same idea but with very different words.  There is no reason in my mind to think that the situation in genetics is any different than this.   Quote Apparently the fossil evidence, DNA sequence analysis, chromosome structure, and a coherent theory are not enough. What kind of proof would convince you? 100% identicalness of the GLO gene between apes and humans would be a good piece of evidence to me.  The whale evolution sequences presented to me are very unconvincing.  The chromosome thing is the best one I have been given yet, but again, considering the above discussion, why couldn't a Designer have used the '2A and 2B' chromosome info that he used for apes, modified it slightly by fusing it and a few other changes, then inserted this into the human genome?  Or vice versa.  Maybe He used Human chromosome 2, split it into two and put it into the chimp genome as 2A and 2B.  When an artist creates two pieces of artwork, they may be very similar, and the artist may reuse certain pieces of one in creating the other.  Certainly software 'artists' do this.  I've done this myself many times.  Why write a second program entirely from scratch when you can reuse some code snippets and save yourself some time?  Again, I am not saying here that I can prove this definitely happened.  I am just saying that it is perfectly plausible and exactly what we should expect from a Designer.  Some kind of 'upward evolution' (my definition of upward -- humans at the top, one-celled organisms at the bottom) in fruit flies would be impressive.  I think these experiments try to 'fast forward' evolution.  But all I've ever heard of is dead fruit flies, deformed fruit flies, etc.  Never 'advanced' fruit flies with major increased abilities. Jeannot said ...   Quote Anyway, the percentage of identical substitutions between human and chimp is certainly well above 36%. I would expect it to be around the same as the general genetic similarity -- 95-97%.  This would be consistent with Design Theory. Quote To check that, we should gather several sequences from rodents, primates (and maybe other mammals), if available, and build a maximum likelihood our parsimony phylogeny. The three sequences alone (rat, guinea pig and human) won't do. Agreed.  Does anyone have a paper comparing human and chimp GLO, for example?  Is it 100% identical?  Or 95-97% as I predict. Quote ...You know, it's a good thing creationists like Dave drop by from time to time and try to "enlighten" us: It helps us refresh things we had forgotten, learn things we didn't know, have constructive debates (such as this) we'd normally not have, and in the end appreciate science even more. See ... even ugly, flea-bitten dogs are good for something ... to throw rocks at, kick when your mad, etc. :-) Faid said ...   Quote Did I mention that this is fun? Well ... at least I am contributing entertainment value to everyone if nothing else ... think of me a side show at the carnival that you didn't have to pay for! Quote I wonder why AFDave isn't hear setting you all straight about your convergences and your BLASTs and what have you. Oh, I was there alright.  I actually read these posts on my Blackberry at church during the boring announcements.  I just have never tried posting from my Blackberry. Quote From what I hear, he's busy posting over at his newfound haven at UD right now. But I'm sure he'll be back... Oh yes.  I'll be back.  I wouldn't call UD a haven.  Those guys all agree with me.  What fun is that?  I just thought I'd better spread the word about that fun quote from TO before someone at TO changes it to sound ... er ... less supportive of Creos. Quote And he has a website: http://airdave.blogspot.com He gets Warren Buffet quoting Jesus: http://airdave.blogspot.com/2005....te.html But he doesn't seem to know that Warren Buffet is an atheist, like Bill Gates and George Soros. Oh I know he is.  That's irrelevant to me.  I posted this in response to a friend that maintains that you shouldn't be quoting Jesus at work.  My response was "Well, why not?  Warren Buffet does!" While you are at my blog site, you guys HAVE to try my "Mist, Ghost or Computer Graphics?" link ... but turn your speakers up loud. Quote When did the split occur Dave? around the time of pharoah? Oh right you don't think there WAS a split. Interestingly, you sparked a conversation between two people who DO know what they are talking about and got some interesting info. Of course.  I like it when this happens.  BTW, I did see your questions and I have good answers, but I'm on a particular train of thought and would like to answer them in my own sequence.  Did you read the latest page on my "God Hypo" thread? ------------------ Quote Dave, no one understand why you want GLO to be 100% identical between human and chimps, since that's precisely what evolution doesn't predict. This pseudogene is not selected, so it can freely accumulate mutations at a high rate. I just thought this was the whole premise of Dr. Max's argument -- that a mistake was copied identically from the common ancestor to apes and also to humans. If this is not the case, then he does not have an argument, in my opinion. ------------------------- He does not have an argument, in my opinion, if the error is not copied 100%.  Remember the copyright case that Dr. Max made an analogy to? If we are just talking about the same difference as with other genes, then this is just as easily explained by common design as common descent. Everyone else--I'll look at your points in the morning. -------------------- OK.  It's time for a review. -------------- Who said that ev'ry wish would be heard and answered When wished on the morning star Somebody thought of that, and someone believed it Look what it's done so far The Daily Wingnut

Alan Fox Posts: 1556 Joined: Aug. 2005 (Permalink) Posted: May 22 2006,21:19    BWE You don't suppose AFDave's strategy all along was simply to cause as as many people as possible (who do not support YEC) to waste time arguing with him, thus reducing the time available for useful stuff like further scientific research, etc.? Or is it really just ego?

BWE Posts: 1902 Joined: Jan. 2006 (Permalink) Posted: May 22 2006,21:19    I started this thread with 3 items which to me argue powerfully against common descent of apes and humans.  You can go back to the start of the thread and read them fully if you like, but here they are ... 1-Complete Absence of Hominid Civilizations Today 2-Unconvincing Fossil Record 3-Enormous Non-physical Differences Between Apes and Humans I also mentioned 2 possible implications of common descent which to me are kind of interesting to think about, but have nothing to do with proving or disproving common descent, so I will not bring them up again. I then brought up the Vitamin C issue which was raised to me by Renier in another thread.  Renier said that he used to be a YEC but the "broken Vitamin C" commonality between apes and humans was the major issue that made him abandon the YEC position. I read the link that Renier referred me to, "Plagiarized Errors and Molecular Genetics" by Dr. Edward E. Max, MD, PhD at Talk Origins.  I think you all know Dr. Max's argument.  He says that in the same way that plagiarism was proven in the copyright case because an error was duplicated, so also common descent is proven with apes and humans because their genomes contain the same error, namely the broken GULO gene. I said that Dr. Max is making an unwarranted assumption in saying this for two possible reasons.  And at that time, I did not have enough information to know which was the most probable reason for his unwarranted assumption.  The two possible reasons were (I now put them in the order that I believe most likely) ... Scenario 1-The GULO gene could have broken independently in apes and in humans.  The Inai article shows that it did indeed break independently in guinea pigs, so why should it not break independently in apes and humans?       OR .. Scenario 2-The "broken" GULO gene was never a functional GULO gene in either apes or humans.  It always has had some unknown function and still does to this day.  Argystokes called this possibility "pseudo-GLO" and rightly asserted that we should be able to find this gene's homologue throughout the animal kingdom--even in animals that do have a functional GULO gene. We went through some logic exercises comparing the DNA code to relatively unknown languages, and we went down a small rabbit trail with the AIG article and the whole "humans are more closely related to guinea pigs since they both have broken GULO and 36% similar substitutions" idea that AIG seems to be promoting.  To tell you the truth, I honestly don't even know what AIG is asserting exactly, but to me it has very little bearing (if any) on the main issue that we are discussing. We ended up yesterday determining that the "broken" GULO gene is not 100% identical between apes and humans and you say that this is not predicted by evolution anyway.  OK fine. I think we agree that there is roughly 95% similarity as is also the case for most other genes compared between apes and humans. So now we are back to Scenario 1 (I'm not sure anyone has ruled out Scenario 2, mind you ... if anyone has info to rule this out, please say so) and your contention is that 95% similarity of the broken GULO gene is powerful evidence of common descent, right?   Well I disagree and here is why. 1-We have already seen that the GULO gene "broke" independently in guinea pigs.  Why should it not "break" independently in humans and apes?  I think Common Descent or Common Design can explain this equally well.  It is not deterministic between the two competing views. 2-You give me analogies of houses designed without steps but this is not analogous to the situation we have.  I will explain why, but let me first review the Creationist position. Again, my Creationist Theory regarding apes and humans is that there was one pair of human "kind" ancestors and one pair of ape "kind" ancestors.  Now I do not have a formal definition of "kind" yet and I admit there may have been a "monkey kind" pair as well, but this is not important for the present discussion.  The general idea of Creationist Theory is that there were a relatively limited number of "kinds" created by God, and that God "programmed" enough genetic information into each separate genome so that each "kind" would be able to adapt to the various environments in which they found themselves as they spread out all over the earth.  Today, of course, we find that monkeys and apes have diversified into many different species and that humans also have diversified greatly. If Scenario 1 above is confirmed, then it is perfectly logical to assume that the Creator designed apes and humans separately, then mutations later caused the GULO gene to break independently in both.  What is so unbelievable about this?  After all, it is a creationist prediction that organisms will accumulate more and more harmful mutations with each generation.  This has been heartily confirmed with fruit flies with "evolution on fast forward."  Why should it be any different with apes and humans?  The "missing steps on the houses" analogy does not apply because no creationist is proposing that apes or humans were originally designed with a broken GULO gene.  It is also perfectly consistent with Creationist Theory that apes and humans have 95% similarity in their genomes.  After all, why shouldn't they?  They do look about 95% similar in their morphology.  But this supports Common Design just as well as it supports Common Descent.  Sure, apes and humans could have had a common ancestor.  And if they did, we would expect to see 95% similarity, an apparently fused gene, etc.  But we would then have what I consider to be 3 enormous challenges outlined above. Now I do realize that proposing a Creator is an enormous challenge to the intellect as well.  And I do appreciate your objections to this idea that you have voiced.  I admit that I have absolutely no idea how the Creator designed these creatures.  Does he have a neat "Animal Design Software" package that he has on His computer that he can "drag and drop" different animal parts, then hit "Process" and the computer spits out the genome?  I have no idea and I know it challenges the mind to try to imagine how any Supernatural Being could achieve the designs we see in Nature.  But to me it is an even larger mental challenge to envision how it all comes about by random mutation and natural selection.  The probabilities against evolution of gross morphological changes are staggering.  The experimental evidence is non-existent.  The fruit flies get damaged or killed when we "speed up evolution."  And where did the first single cell organism come from?  I don't think anyone has a clue about that.  The proposals for how the bacterial flagellum and other innovations might have evolved are just as "Alice-in-Wonderland-ish" to me as proposing a Creator.  I have read them.  They are a joke to me. The fossil record is extremely weak.  The "evidence" that the earth is millions of years old is based on unwarranted assumptions which I will show.  The typological perception of nature shown by Denton to exist at the molecular level is powerful confirmation of the Creationist model, not the common descent model (in spite of Talk Origins lame attempt to discredit it).  It is obvious that a global tectonic and hydraulic catastrophe was responsible for the universal phenomenon of sedimentary, fossiliferous rocks, not uniformitarian processes over millions of years.  More on all of these issues on my other thread. But just because I have no idea how the Creator might have designed these creatures does not mean that He did not.  And I admit that I am not going to be able to "prove" to you that He did with the "Scientific Method" as you understand it. This is an extremely important point.  Scientists today do not admit certain kinds of evidence into the arena and I (and Meyer, et al) believe this is an enormous mistake.  To explain this simply, what you are really saying when you say that a "God Hypothesis" is unscientific, is that you rule out the "ET Hypothesis" that maybe an advanced civilization "planted" life here, and you rule out any possibility of any kind of Intelligence that could have been responsible for life here on earth.  This to me is ultra-naive.  Why are we so proud as to think there could be no advanced civilization that is far advanced in their technology so that they would be able to sit down at their computers and design 1000 or so distinct, original "kinds" and "plant them" here on earth?  Maybe we are one big "science experiment" to them. Or maybe it's not a civilization at all. Maybe its ONE SUPER-MIND, like God, for example.  To me, it is utter folly to rule out these possibilities.  And to really explore these issues, we need a broader definition of science than your definitions.  Falsifiability and some of the other demarcation criteria proposed last century must be dispensed with.  We need a robust science that admits all possibilities.  Quackery should not be defined and dictated by a ruling elite of naturalistic scientists.  We should allow quackery to take its course and wind up on the rubbish heap of junk science all by itself through action of the free market of ideas.  Allow astrology into the arena.  It will die a quick death on its own.  Allow Scientology and "Christian Scientists" into the arena.  They will die as well.  Allow homeopathy and acupuncture and everything else you can think of into the arena.  Who cares?  They will not gain a majority if they don't have any merit.  The only reason flat earthism and geocentrism gained a majority was because the ruling elite (the Catholic Church) force fed it to the people.  In my opinion, this is why neo-Darwinism has any following at all among the people.  It is basically being force fed by the "ruling elite" of the scientific community, which I think is quite heavily funded by the government.   Now don't accuse me of thinking there is some kind of conspiracy among scientists.  I don't think that.  I just think there is a powerfully tempting idea out there among scientists called Darwinism, or naturalistic evolution, or whatever you want to call it.  Scientists like it because it requires no Creator and that has a lot of good implications from their perspective.  Younger scientists are taught this theory and want approval from superiors and peers alike.  So naturally they overlook some of the glaring difficulties and explain them away.  And so the cycle goes in academia.  But I do not think there is some hierarchy somewhere that is somehow planning to brainwash everyone with Darwinism.  I just think there is a government funded consensus and the result is that it has a similar effect as the medieval Catholic church did in that the people are force fed some rather strange views of Origins. Anyway, back to the Vitamin C issue.  Let's get to the bottom line.   It appears to me that no one here has a convincing argument that favors Common Descent over Common Design to explain the "broken" gene in both apes and humans.  Either one can explain it just as well. Am I correct?  Or am I missing something? (Note for Faid:  I know you are trying very hard to get me to see that the AIG people are a bunch of liars, so I'll tell you what I'll do.  I'll agree with you that they are all a bunch of liars and we all know what a liar I am--I've been told this many times here--and I would add that the Talk Origins people are probably liars as well, and probably many of you are also liars, and of course, the President is a liar and all Republicans are liars.  So why don't we just agree that we are ALL a bunch of liars, then we can agree on something and get on with arguing.  What do you think?  :-) (One more note:  As a side issue, I am interested in hearing continuing dialog about the AIG paper by Woodmorappe and what your analysis is regarding what their argument even is and the various data which may confirm or refute it.  But I am more interested in people presenting actual relevant data to me as opposed to evolutionary analysis of that data.) (And remember ... I WILL become an evolutionist if the evidence is convincing enough to me.) ---------------------------- Quote If you went to church and saw half a dozen kids sitting together, and all had HUGE noses (way bigger than anyone else there, except for one of the adults sitting with them), you could conclude that each kid had a separate set of parents, and just happen to all be sitting together.  Or you could bust out Occam's Razor and conclude that they are siblings.  Oh, they also look a lot alike aside from their noses as well.  And there's no such thing as a bignose club. Kids with big noses and other features that look alike is in an entirely different universe than what we are talking about. What we are talking about is going to church and seeing some chimps on the same pew as some boys.  The creationist says "Gee, I think they are not related."  The evolutionist says, "Gee, I think they ARE related." No you go figure who's right. Russell said ... Quote You seem to have missed the entire point of the Max article. Shared ancestry predicts shared errors. That's what you see in the primate gulo gene. A completely different set of errors is seen in the guinea pig gulo gene, indicating a separate origin. Got that? Common ancestry predicts the same errors in humans and the other primates; a separate set in guinea pigs. If the errors occurred independently in guinea pigs, chimps, monkeys, and humans, you would expect the errors to be similarly diverse in all of them. Shared ancestry predicts shared errors ... no problem.  I agree.  But Creationism predicts the same thing, namely, the Creator made apes and humans as separate kinds with functional GULO, then both might lose function through mutational degeneration.  Big deal.  This is what creationists expect.  I would expect other species to lose the function in years to come also.  What do we find in apes and humans?  Voila!  95% similar broken GULO!  No surprise there.  Even if it is the same substitution (or deletion or whatever) in apes and humans, so what?  Humans and Guinea Pigs have 36%  (High percentage to use Inai's words) identical substitutions.  Why shouldn't apes and humans also have an even higher % of identical substitutions? Dr. Max does not even say the error itself is identical.  He just says both apes and humans have broken GLO.  But even if there were some "identicalness" this proves nothing for evolutionists. Also note the bold print in Dr. Max's article where he makes the goofy assertion that Creationists believe that humans and guinea pigs were designed to function without GLO. Baloney. I just got through telling you what THIS creationist believes--they were both designed with functional GLO (if Scenario 1 is true), but then it broke. Russell-- you have proven nothing.   From Dr. Max's article ... Quote Guinea pigs and primates, including humans, get sick unless they consume ascorbic acid in their diet. For humans and guinea pigs, ascorbic acid is thus a vitamin (vitamin C), while most other species can synthesize their own ascorbic acid and thus do not require this molecule in their diet. The reason humans and guinea pigs cannot manufacture their own ascorbic acid is that they lack a functional gene encoding the enzyme protein known as L-gulono-gamma-lactone oxidase (GLO), which is required for synthesizing ascorbic acid. In most mammals functional GLO genes are present, inherited - according to the evolutionary hypothesis - from a functional GLO gene in a common ancestor of mammals. According to this view, GLO gene copies in the human and guinea pig lineages were inactivated by mutations. Presumably this occurred separately in guinea pig and primate ancestors whose natural diets were so rich in ascorbic acid that the absence of GLO enzyme activity was not a disadvantage--it did not cause selective pressure against the defective gene. Molecular geneticists who examine DNA sequences from an evolutionary perspective know that large gene deletions are rare, so scientists expected that non-functional mutant GLO gene copies--known as "pseudogenes"--might still be present in primates and guinea pigs as relics of the functional ancestral gene. In contrast, Creationists believe that humans and guinea pigs were each created independently of all other species and must have been "designed" to function without GLO. If this were true, these two species would not be expected to carry a defective copy of the GLO gene. In fact, GLO pseudogenes have been detected in both guinea pigs and humans (Nishikimi et al. J Biol Chem 267: 21967, 1992; Nishikimi et al. J Biol Chem 269:13685, 1994), consistent with the evolutionary view; presumably, related pseudogenes also exist in non-human primates that require dietary vitamin C. The kinds of mutations found in the human and guinea pig pseudogenes are typical of the ones seen in genetic diseases like those mentioned earlier. In this essay I call the human and guinea pig GLO DNA sequences "unitary pseudogenes" to distinguish them from two other kinds of pseudogene occurring in a species that also possesses a functional copy of the same gene (see below). Readers should note that the term "unitary pseudogene" is used here for convenience; there is no standard nomenclature to describe this rare type of pseudogene. ------------------------------ I said ... Dr. Max does not even say the error itself is identical.  He just says both apes and humans have broken GLO.  But even if there were some "identicalness" this proves nothing for evolutionists. And I add that ... the reason this "identicalness" proves nothing for evolutionists is because of the 36% "identicalness" with guniea pigs!  Are you going to tell me that Guinea pigs and humans are related?  I hope not. ------------------------------- Quote *It could be just me, but I'm pretty sure that earlier in the thread (i.e., before you shifted gears) you argued that they WERE designed that way for an unknown function.  Is my memory faulty, Dave? No.  Your memory is not faulty.  I think the 2 scenarios I mentioned early today are possibilities.  You have not given me enough information to decide which one is correct.  All you have given me is that ape and human "broken" GULO is about 95% similar.  No one has confirmed for me if this "broken" GULO gene also occurs throughout the animal kingdom and may have some unknown function, as Argystokes suggested. ---------------------------------- -------------- Who said that ev'ry wish would be heard and answered When wished on the morning star Somebody thought of that, and someone believed it Look what it's done so far The Daily Wingnut

BWE Posts: 1902 Joined: Jan. 2006 (Permalink) Posted: May 22 2006,21:21    Posts: 223 Joined: April 2006 Posted: May 16 2006,21:53   Keep trying to insult me, Aftershave.  It might work yet if you just keep it up long enough!  I like the new angle of insult ... very innovative.  Maybe you could insult my wife next. You go right ahead and send your kids after those "competitive jobs" so they can spend their life working for someone else.  Mine already have their own business like their dad ... maybe my kids will hire some of your kids if they are smart and work real hard.   :-) ----------------------------- Where to start?  Probably the best place would be to float a reminder to you about "The Big Picture of This Thread" and "Your Role" vs. "My Role" and how this little discussion of GULO fits into the big picture. (1)  One reason I am here at PT is to see if there really is anything substantive to evolutionary arguments.  Seems like a good place to find out would be a forum where evolutionary scientists hang out. (2)  Notice that on this thread, it is not my primary goal to prove to you something positive about the Creationist view of Apes and Humans.  It is to see if YOU have some positive, convincing proof that would make me rethink my position that Apes and Humans are separately created kinds. (3)  Someone has pointed out that I just want everyone else to run around chasing data and I myself don't want to do any "real scientific work."  Well, in this case, YES.  The burden is upon you to try to convince me.  I have always felt sorry for evolutionists in a way, because I have always thought it would be a huge undertaking to try to defend many aspects of it, and so many arguments have crashed and burned in the past when new information is known.  I'm finding this to be true with Ape/Human issues in general and with the GULO issue in particular.  Sorry if this observation frustrates you, but it's an honest observation. (4)  Someone has correctly observed that I am an apologist for YEC.  I'm glad someone has figured this out because it is true.  I have said many times that I don't want to become a specialized scientist in a particular field--we have many of those already.  But I am being honest when I say that I would abandon the YEC position if given some convincing evidence for NOT being a YEC.  It's just that no one has yet. Now that we have that "role review" under our belts, let's dive in. Just so Faid is not insulted that I never look at his links, I'll post something from one of his links ... Quote B-1: The GULO Gene as an Example of Shared Deletions: Given below is the alignment for the same part of the GULO gene that we examined in lesson A on Vitamin C, along with the corresponding sequences from 3 primate species that are incapable of synthesizing Vitamin C, the chimpanzee, the orangutan, and the crab-eating macaque. Human TACCTGGTGGGGGTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC Chimpanzee TACCTGGTGGGGCTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC Orangutan TACCCGGTGGGGGTGCGCTTCACCCAGAG-GATGACGTCCTACTGAGCCCC Macaque TAACCGGTGGGGGTGCGCTTCACCCAAGG-GATGACATCATACTGAGCCCC Rat TACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC Link to article Oh, by the way ... maybe I should have clarified this earlier ... YECs have no problem with the idea of Apes and Monkeys having a common ancestor.  We actually agree that they did.  I think Noah took a pair of genetically rich "ape/monkeys" on the ark and these diversified into the many varieties we see today. So the only thing I care about here is the Ape-Human thing ... the supposed shared ancestry.   Now let's analyze this.   As I have found in so many areas, you make many assumptions: 1)  You assume that the ONLY reason human and ape GULO does not work is because of this single deletion.  Am I correct? 2)  You are assuming that pseudo-GULO is in fact "broken GULO".  Argystokes has not yet demonstrated that to me.  To me it is a possibility that "pseudo-GULO" has some as yet undiscovered function.  Remember the good old "vestigial" organs that turned out to have function after all?  Why wouldn't "vestigial" GULO turn out the same way? 3)  You are assuming that this "deletion" is in fact a deletion.  The word deletion implies that it was there at one time in history and now is not due to a mutation.  I think you base your idea that it is a deletion by comparing it to rat GULO.  A tempting comparison and I do see your logic, but how is this conclusive?  An interesting experiment in this regard would be to delete the "C" in question in the rat GULO, then see if rat Vitamin C production ceases.  Has this been done?  Is it even possible?  How about inserting a "C" into some ape GULO, then seeing if Vitamin C production commences?  I did read the Rat/GP/Trout experiment and it is interesting, but does this prove that the "C deletion" is definitely the cause of non-functionality?   4)  You assume that this "C deletion" occurring independently in apes and humans is a highly unlikely event.  Why is it so unlikely?  After all, there are many identical substitutions in an unrelated ... er ... *cough* ... distantly related (yes, yes, I forgot my head yesterday for a moment ... it is still a challenge for me to remember that you all think ALL organisms are related through common ancestry), i.e. our furry friend, the guinea pig. Quote Dave, this is the part you're not getting: Creationism predicts everything. Creationism is an ad hoc hypothesis that can always fall back on the proposition that the Creator could always have done something in a particular way, and given we know almost nothing about the Creator, we cannot make assumptions about why it would do something. Now, Dave. Tell me something you could in principle find in the natural world that Creationism would not predict. Can you do it? Creationism does NOT predict everything.  Here are 5 things it does not predict. (but evolution does predict and has been proven wrong) 1) "Upward evolution" ... it predicts "downward" 2) "Seamless fossil record" ... it predicts ubiquitous gaps 3) "Hominid civilizations" (or half-human to make Norm happy on terminology) ... it predicts fully human civilizations and fully ape "civilizations." 4) "Millions of years coal production" ... it predicts rapid coal formation 5) "An infinite universe" ... it predicts a finite universe that had a beginning How far do you want me to go on?  I could keep going a long time, but you get the idea.  So you are incorrect.  Creationism does not predict everything.   Evolution, on the other hand is almost "God-like" (actually fairy-talish) in its supposed explanatory power.  If a guy like Michael Behe comes at you with an irreducibly complex biological system like the flagellum, the "Evo Fairy Tale Machine" goes into high gear cranking out stacks of "just so" stories about how you all wish it might have happened.  None of this can be tested experimentally, of course, and no one has ever observed such an innovation happening in nature, and we all know what happens to fruit flies when you "speed up" evolution, but who cares about all of that.  On they go creating large volumes of "scholarly articles" which in reality are nothing more than "Alice-in-Wonderland" tales without the "fun story appeal."  Have you ever waded through one of those "How a Flagellum Evolved" technical papers?  I don't blame you if you haven't.  You would no doubt have headache afterwards if you did. Quote Also, as a side note, does Creationism make any predictions as to the number of "kinds" there are out there? Or does Creationism even have an estimate of the number of "kinds"? Because evolution does. It has a nice little diagram of the organizational structure of life on earth. Does Creationism have its own diagram, or does it just plagiarize the one created by real scientists? I think they do somewhere.  I can find out pretty easily from AIG or ICR or someplace.  I just threw out that 1000 number.  I have no idea what a good number might be.  The actual number was not important to my argument yesterday, so I just picked one out of the air. Quote Seriously Dave, you are trying to do rocket science when you don't have basic physics down. Before any of this works, you need to understand why scientists believe that the earth is around 4 1/2 billion years old. Yes.  The magic potion of evolution ... millions and billions of years.  I hate to be so unkind as to tell you that you might need to pay attention, but if you read this thread, millions of years doesn't have anything to do with the questions I have raised on this thread. Quote If you still refuse to address them, I'll have no choice but to infer that: a) either you're in some OCD state, where you think that checking the link is like "giving in to temptation", expressing doubt in the eyes of you-know-who, or b) You have already checked the links, but don't want to address them- and that is dishonesty. Whew! I cut and pasted Faid's quotes.  Now he won't think I'm in an OCD state! Quote Mine says that you will not find a functional GULO region in this primate.  Yours has no reason to predict this.  Note that despite argystoke's interesting proposed experiment, we have no reason to expect the converse.  That is, we might well expect to find additional broken GULO regions in rats and other animals that still have functioning GULO and can synthesize vitamin C.  This would indicate duplication (similar to that found in hemoglobin genes and many others).  It would not indicate some vital and as-yet unknown function of the pseudo-GULO.  So, while it's an interesting idea, it wouldn't provide any magic bullet to decide between your "scenarios".  I notice that you didn't have enough understanding of the question to realize this. Mine says that if we spliced a rat or mouse GULO gene into the primate's liver cells (as we have done for humans), it would be able to synthesize vitamin C.  Yours has no reason to predict this.  Mine says we couldn't do the same for a fish.  Yours? Mine says that this pseudogene is likely the result of a retrovirus, and that the mutation occurred about 40 million years ago, in the shared ancestors of that primate and us.  Yours? What does your "theory" predict for our newfound primate, Dave? Or let's leave the hypothetical primate.  Let's look at a hamster, Dave.  What does your "theory" predict for hamster GULO?  Is a hamster part of the guinea pig kind?  The rat kind?  Its own kind?  Does it matter?  Can you -- without peeking at those hocus-pocus evolutionary phylogenies tracing ancestry -- predict anything about hamster GULO and vitamin C production?  Can you test your predictions on your own? Who doesn't know the language here, Dave? You are the biology expert.  I am the apologist.  Remember the role discussion above?  By the way, I am very impressed with some of the technical knowledge displayed here.  I don't want to trivialize that.  I am just pointing out some items which appear to be logical fallacies to me. OK.  Over to you ... ------------------------------- Quote OA asks AFDave for the fourth time New thread, my friend, new thread.  This one is about "Ape Questions" as you might find out by scientifically analyzing the title. Go start a new one if Wesley will let you and I'll see if I can find time to come over and visit ... Cheers! (I did enjoy "Top Gun" ... glad to see you did too! ------------------------- Quote Tell us Dave, what incentive would anyone have in doing hours and hours of research and writing just so a disingenuous knucklehead like you can reject the data with a few flip sentences? Dunno.  A lot have done it so far though.  Why would they not continue?  Maybe they have an insane fascination with 'brain damage' ?? (As someone here put forward) --------------------------------- Or maybe it's the 'sharpening knives on dull stones' idea. Who knows! ------------------------------- OK THIS IS MY PROJECT SO I JUST WANT TO POINT OUT WHERE THIS COMMENT IS IN SEQUENCE BWE Posted: May 17 2006,10:36   Well well well. The time has come. Dave, you are an idiot. Your vacant mind is incapable of synthesizing information into understanding. I sincerely hope that your children do not end up as misguided as you. Not for them but for me. Your head is crammed securely up your ass and you have nothing valuable to say. Your god is a pathetic little provincial bigman who can't even say boo to my god because my god is so much stronger and braver than your god. And my god makes better things than your god. Also, I can run faster, jump higher and screw better than you can. Your friends don't really like you; they are just pretending. Wesley, your other thread was precient in that you don't really want to have a poster who is simply an object of ridicule. Is this correct? ---------------------------- AF Dave  said ... Quote Creationism does NOT predict everything.  Here are 5 things it does not predict. (but evolution does predict and has been proven wrong) 1) "Upward evolution" ... it predicts "downward" 2) "Seamless fossil record" ... it predicts ubiquitous gaps 3) "Hominid civilizations" (or half-human to make Norm happy on terminology) ... it predicts fully human civilizations and fully ape "civilizations." 4) "Millions of years coal production" ... it predicts rapid coal formation 5) "An infinite universe" ... it predicts a finite universe that had a beginning How far do you want me to go on?  I could keep going a long time, but you get the idea.  So you are incorrect.  Creationism does not predict everything. qetzal said ...   Quote Just in case there are any lurkers out there who think this is persuasive, I'll point out that none of these are predictions of evolution. I will also ask afdave: if we observe any of these things, do you agree that it's evidence against Creationism? *Ahem* ... sorry ... I should have said these used to be predictions of evolution ... Until they were disproven ... Now, of course they are no longer predictions of evolution. More ape fun tomorrow morning!  See you then! ------------------------- BWE said ... Quote Also, I can run faster, jump higher and screw better than you can. Eric, Chris, Jeannot, Incorygible, Norm, Qetzal (others also)... I truly admire all of you for your knowledge of your field and your ability to express your thoughts matter-of-factly (even though I disagree with you).  (End serious comment, begin sarcasm) I also wanted to highlite some of the abilities of one of your team members.  These abilities may come in handy in a future debate.  Just kidding.  Don't worry.  I really don't lump you in with anyone else, and my judgment of your character has nothing to do with my judgment of anyone else's ... I just saw a chance for a joke.  I wouldn't want people lumping me in with certain other YECs.  As for BWE, I congratulate you.  I have been insulted a lot of different ways, some creative, some boring.  I have to say that this one takes the cake as the most innovative I have ever heard.  If you tell me your mailing address, I would like to send you a certificate for "Most Creative Insult of All Time."  I will be interested to see if you or anyone else can top this one in the future :-) Quote Also, I assume you don't believe that humans once had a tail although you think that the monkape kind either evolved one or lost one. If it was one original kind, then there would originally have been a tail and it would have been lost over time.  Creationism predicts the loss of function, not gain.  There may, however, have been a separate monkey kind and an ape kind. Quote Science itself is evolutionary and a thousand wrong ideas are tested before we hit on ideas that work. So, if there were an ID research program I wouldn't object. What I object to is the fact that they're faking having any  research program and instead spending millions on PR and lawyers and think tanks that  invent ways to lie and distort. Science is not evolutionary because it is directed by intelligence.  I am glad that you would support an ID Research Program.  ID has to spend millions on PR to even get any research off the ground to see if there is support for this promising theory.       Quote You're an arrogant SOB, you know that, Dave?  From whence this audacity to dictate OUR roles in educating YOU in the absolute absence of any effort on your part?  See above. Look, Incorygible.  I'm a businessman with a science/engineeering background and a financial contributor to causes, I'm politically involved, I'm an apologist for YEC, and I'm a little bit like an investigative reporter at the moment.  If you don't want to accept the role of "Evolution Apologist" and jump on the opportunity to make your theory look plausible to an outsider, then don't.  No one is making you.   The ape/human questions and the Creation/Evolution controversy are absolutely to vital to society.  I'm spending 4+ hours a day on this effort. You can't say I'm not putting in any effort.  Now, if you don't like your role, then you don't have to assume it.  On the other hand, if you want to stick around and not get mad, you might have some fun. Others have said they are having fun.  You can too.  By the way, I have encountered scientists who seem very resentful of businessmen in general because they feel that businessmen "use" them for their own purposes.  Do you feel this way?  The truth is that both businessmen and scientists are necessary.  Businessmen need scientists to invent and discover new things.  Scientists need businessmen to market their innovations.   And by the way, apologists and politicians are necessary too.  Your side has a famous apologist in Richard Dawkins.  Why shouldn't our side have some too?     Quote It is a "huge undertaking" to understand volume upon volume, journal upon journal, paper upon paper of published, peer-reviewed science, Dave.  Takes decades of full-time devotion.  In light of that, your observation, your opinion of "burdens", and the roles you have set out are anything but "honest". Again, scientists do much wonderful work.  Where they go wrong is when they write volume after volume of speculation about how the immune system might have evolved and similar things.  They would be much more productive if they hypothesized that it was designed and studied it from that perspective.     Quote So you recognize the huge undertaking to become knowledgeable in this subject, but think you can have it for free.  I would have suspected you'd have come across the term "no free lunch" in your IDiot meanderings, Dave.  In this case, however, it actually applies. I understand there is no free lunch.  I was born in poverty and have worked very hard to be where I am now.  No one asked you for a free lunch.  Some of you act as if I am asking you to give me a biology degree for free or something. Again, I am basically a YEC apologist and an investigative reporter asking for a convincing story.  If you don't want to give it, then you don't have to.  If I were in your shoes, though, I would want to try to give a convincing one.     Quote No.  You are looking at one small region of the gene.  The deletion may have broken the gene.  It may not have.  Other mutations could have occurred before, and others since.  We've shown you the exact nature of the mutations that we see now.  We've pointed you in the direction of references where you can find out more. Exactly.  So Faid was making an assumption when he told me that the deletion in his article is the cause of broken GULO. AF Dave said ...         Quote 3)  You are assuming that this "deletion" is in fact a deletion.  The word deletion implies that it was there at one time in history and now is not due to a mutation.  I think you base your idea that it is a deletion by comparing it to rat GULO.  A tempting comparison and I do see your logic, but how is this conclusive?  An interesting experiment in this regard would be to delete the "C" in question in the rat GULO, then see if rat Vitamin C production ceases.  Has this been done?  Is it even possible?  How about inserting a "C" into some ape GULO, then seeing if Vitamin C production commences?  I did read the Rat/GP/Trout experiment and it is interesting, but does this prove that the "C deletion" is definitely the cause of non-functionality? Incorygible said ...         Quote Yes, Dave, it's all been done.  We can easily knock out vitamin C production by breaking rat GULO in any way you desire.  No functioning gene -> no functioning protein -> no vitamin C synthesis.  This is basic.  Look at the medical literature.  That Ha et al. (2004) paper I referenced earlier is titled "Functional rescue of vitamin C synthesis deficiency in human cells using adenoviral-based expression of murine L-gulono-gamma-lactone oxidase" (Genomics 83:483-492).  They took murine (rat/mouse) GULO, spliced it into human liver cells via a virus (we do this all the time, Dave), and those cells began synthesizing Vitamin C.  I've already told you this. Incorygible, that's not the same thing ... read my quote again.  I asked if anyone has knocked out the "C" in rat GULO at the position indicated in Faid's article which I quoted.  You responded by saying "Yes, we spliced rat GULO into a human and it worked."  Hello?  That wasn't what I asked.  It's not the same thing.     Quote If someone wanted to tell you how wrong you are about how to fly planes, and they didn't even know basic things about lift, stalls, air pressure, and when you tried to explain the basics they just kept telling you how wrong you were, wouldn't you be a little intrigued? Yes.  But I wouldn't get mad.  I'd just think it was funny.  The fact that people get mad about this stuff is interesting to me.  Why do they?  Oh, I know all the superficial reasons ... I'm thick headed, etc.  But it seems like there must be a more basic reason for the frustration.     Quote And besides, if it's not your goal to present positive evidence about the Creationist view, why did you waste several hundred words on your "Creator God Hypothesis" (which, let the record show, you have not yet supported with any positive evidence)? If you weren't going to support it, why did you even bring it up, and waste our time waiting under the misapprehension that you were going to try to support it? Absolutely.  On that thread, not this one.  This thread is all about "Ape Questions" and seeing what your answers are to those questions.  I have given excellent positive evidence on my other thread for the existence of God, and will over time give much evidence for all the things I said I would.  I know some don't accept my evidence so far, but I cannot help that. All I can do is give it.     Quote Dave, you're simply not equipped to evaluate the evidence in favor of evolution. That's been pointed out to you innumerable times. No one here is under the slightest obligation to educate you on that evidence. I agree with you.  I am not equipped.  This is why I am giving evolutionary biologists the chance to speak for themselves and explain why their theory is plausible.  If they cannot do this, who can?  I understand that no one is under any obligations here.  There are certain roles, though, and I can tell you that I am certainly not going to assume the role of 'Evolution Apologist.'  So that leaves the job to either you guys or else no one at all. I think people here rightly want to try to answer these questions as best they can because they truly believe in their theory.  And it is important to them for others to understand and agree with this theory.  We all want people to agree with out theories.     Quote Explain to me why "downward evolution" is predicted by Creationism. How does this follow from the idea that God created everything? Is his creation so defective that everything eventually breaks down and collapses? It is predicted in Genesis and is known as the "Curse."  Yes.  Everything in this world has been cursed because of sin, and God will RE-create the world at some point in the future.  Of course, I cannot prove this last piece to you scientifically, but I can show you that the Bible is both reliable and supernaturally originated.  Then it is but a small step of faith to believe the unverifiable stuff.     Quote 2) To talk about a "seamless fossil record" versus ubiquitous gaps is a demonstration of  your ignorance of what the fossil record is. Fossils happen rarely and not all fossils have been found. What you don't believe in here is  called a "transitional fossil." OK.  Fair enough.  Let's use your term.  Evolution predicted many transitional fossils and now that the evidence is coming in, there have been only a handful of equivocal ones.     Quote The convergence for this deletion may not be unlikely, but primates share dozen mutations. And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance. Would you drop this argument? Why would I drop the argument if you agree with me that the deletion is not unlikely?     Quote And what does "upward evolution mean"? The evidence shows that there is no such thing, but Evolutionists wish there were.  To me it means addition of wings where there were no wings before, addition of eyes where there were no eyes before, etc.  The reverse happens a lot, however.  Organisms lose function quite often and Creationists predict that this will continue until the time that the Creator RE-creates all things.     Quote Even so, bacteria have developed the ability to digest nylon. They didn't have that ability in the past. It's new. We can identify the pre-existing genes that were co-opted to achieve this. Isn't this "upward" evolution by your definition? Does it disprove Creationism? I do know there are a few mutations that could be construed as "upward" or "increased or new function."  Do you know of many like this?  To disprove Creationism, it would take a multitude of  mutations like this.  And by multitude, I mean thousands or even millions.     Quote Your "ubiquitous gaps" are gradually disappearing. Isn't that evidence against Creationism? To say that the gaps are disappearing is sort of like saying that you are well on your way to emptying Lake Superior because you have removed 10 buckets full of water.     Quote Let's simplify. Is there any conceivable objective observation (or combination thereof) that could disprove Creationism? If so, please explain. Yes.  There are many possible ways to disprove Creationism, and evolutionists have been hoping for years that just such evidences would come to light as more is known.  They just haven't yet.  The opposite is actually happening.     Quote But how much has the Bible changed to reflect more recent observation, Dave? Has it changed much in the last thousand years? Science gets better all the time. Religion stays the same, getting left further and further behind every year. It hasn't changed, unless you are talking about the equivocal "Apocrypha."  Or maybe you are referring to modern Bible translations?  Translations are not changes.  The translators typically work from the original Greek and Hebrew to make their translations.  I don't know about religion.  I'm not a religionist.  I'm interested in truthful science of which the Bible and a God Hypothesis are a legitimate part. Renier said ...         Quote Afdave is showing off his amazing faith. Since I feel that he just waisted our time, asking to be educated and then revealing he is just here to preach, I feel we need to test Dave on the claim that he is indeed a Christian and not just someone who is fooling us.  Chimps and Humans -- This is interesting. Now the fundies are REALLY going to fume. Renier, my friend, you're back!  You were the one (I think) that gave me the idea to start this thread.  Wasn't it you that said you used to be a YEC, but abandoned the position because of the Vitamin C issue?  Well, as I hope you have seen, there are many assumptions here and I think you were too quick to abandon your position.  I read your new article about Chimps and Humans, but it does not look as interesting as the Vitamin C issue. *************************************************************** So there you have it.  We're on page 16 of this thread, and there has been some very good discussion.  After all of this, of the two possible scenarios that I mentioned ...     Quote Scenario 1-The GULO gene could have broken independently in apes and in humans. The Inai article shows that it did indeed break independently in guinea pigs, so why should it not break independently in apes and humans?       OR .. Scenario 2-The "broken" GULO gene was never a functional GULO gene in either apes or humans.  It always has had some unknown function and still does to this day.  Argystokes called this possibility "pseudo-GLO" and rightly asserted that we should be able to find this gene's homologue throughout the animal kingdom--even in animals that do have a functional GULO gene. it seems that Scenario 1 is the most likely, although who knows what will turn up as more is known about "pseudo-genes." I have confirmed my suspicion that Dr. Max's assumptions are not necessarily warranted, although I would not go so far as to say they are wild assumptions. It is clear to me that the theory that apes and humans had a common ancestor, while it has some apparent support, is by no means a closed case, and there is plenty of evidence supporting Common Design Theory as well.  I don't think we can 'prove' either one of them.  And if I were in Renier's shoes, I certainly would not have abandoned the YEC position because of this issue. So, as you probably expected would happen, my position remains that Apes are Apes, and Humans are Humans, and as far as anyone really knows for sure, it's always been that way. Thanks for your participation!  I have nothing further to add on this thread.  If anyone wants to keep going, by all means, go ahead.  But I have completed what I set out to do. I will now spend all my time presenting evidence for a Creator God, a Young Earth, the Global Flood, the accuracy of the Bible, etc. etc. on my other thread. Thanks again. AF Dave. ---------------------------------- Quote How is PR a requirement for starting research? PR raises money for doing research. Quote afdave, please point me to the post in which I claimed that that particular C deletion was the cause for the loss of the gene's function. Otherwise, please retract your claim and all assumptions derived from it. You probably told me five times to go look at your link which supposedly proves Dr. Max's assertions.  I did so, as you asked me to.  What else am I to conclude from that article? If you really don't believe what I thought you believe, fine.  I'll retract my statement. -------------------------------- Aftershave said ... Quote I'll just note that the sum total of AFDave's scientific knowledge and integrity would comfortably fit inside a thimble, with plenty of room left for his genitalia. BWE's was funnier. He's still in first place.  But keep trying.  You might pull off a good one yet. ------------------------------------ Quote letting your personal and petty anger through I was? Hello??  McFly?   Toejam-- Could you use some of that straight talkin' of yours and tell Mrs. Rilke what planet we're on ... ----------------------------- Incorygible said ...   Quote Again, Dave, why do you think you know where scientists go wrong?  You've admitted you're not on their level in their respective fields. I admit that I am not on their level, but there is a relatively small but rapidly growing group of scientists who are disillusioned with Darwinism ... Michael Denton, Michael Behe, Dr. John Baumgardner of Los Alamos to name just a few.  When top notch people like this stand up and say there's a problem, I at least investigate.  Now why is that so unreasonable? Quote After all, the current crop of scientists aren't doing anything worthwhile, and you seem to know how to correct that, given your science/engineering/religious background.  Why not cure cancer with your "design perspective"? As a politically active businessman who wishes to contribute to humanity and help the YEC cause, would there be anything better? I have never said the current crop of scientists aren't doing anything worthwhile ... nothing of the sort.  I have consistently said they are doing many great things and I reap the benefits.  But their thinking on origins is highly questionable and the answer to this question has major implications on society.  And I agree that trying to cure cancer from a "design perspective" would be a very worthy goal. Quote I got interested in this whole affair (I used to not care, just do what I did and let other people believe whatever they wanted) when a YEC (in similar shoes to yours?) sent me a scary fire-and-brimstone e-mail because may name appeared on a university website for teaching a course in evolution.   I know that some people who wear the YEC label do irresponsible things like this ... I am sorry for that, but I cannot stop them.  I can only do what I do and I for one do not say that you are 'evil' or that you should even quit teaching your views on evolution.  Go ahead and teach them.  Just don't shut out other views.  Honesty would dictate that your view is just that--a view.  The origin of life is not a thing you can 'prove.'  So just admit that and let others express their views as well.  That's all. Quote Faid has already responded to this and where the misunderstanding lies.  And even if he hadn't, I am sorry that I assumed you were asking a question that had some actual over-arching relevance to the discussion.  I assumed you had learned enough by now to realize that "the missing C" was not the deletion we have been talking about (not even close). But yes, I assumed to much, with the proverbial consequences -- you just wanted to go down yet another rabit hole leading to a meaningless detail and pedagogical semantics. I was not intentionally leading you down a rabbit hole.  I was trying to summarize your collective position, then point out my view that it is inconclusive to me. Quote And I think you (of all people), might be a little offended by being accused of being in league with the devil and on a fast-track to ####. Again, please don't get mad at me for the actions of others, and I will treat you with the same respect. Quote I don't care what they "believe", either.  Affirmation and consensus with the norm is not a high priority for me.  Did I not mention I'm in science?  We THRIVE on DISagreement, Dave. OK.  Then you should be thriving. Quote "The convergence for this deletion may not be unlikely, but primates share dozen mutations. And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance. Would you drop this argument?" Why would I drop the argument if you agree with me that the deletion is not unlikely? Honestly, do you even read, Dave?  This reply, with the actual quote right above it, proves beyond a shadow of a doubt that you are illiterate, dumb as a brick, and/or disingenuous. She says the convergence may not be unlikely.  She says that primates share dozen mutations.  And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance.   I don't understand the second sentence, but why is it so unusual to share "dozen mutations"?  Guinea pigs and humans share a lot of mutations too, right? -------------------------------- Quote You do know that you are desicively swaying those of us on the fence away from your brand of creationism? You are on the fence?  Excellent!  There's hope! ------------------------------------ have not had time to analyze Incorygible's latest response, but I will and then get back to you. In the mean time, there is a good lesson on my "Prove Evolution to AF Dave" thread on the Bible's admonition that "Pride goeth before a fall." It was nice knowing you Rilke ... ------------------------------------------ Eric said ...   Quote Dave, I really think you need to read, and understand (that means read it slowly and carefully and make sure you understand each paragraph before you go onto the next one) Douglas Theobald's superb article at Talk Origins setting forth the mountain of evidence supporting common descent with modification. If you honestly read and understand that one article, you will understand that common descent with modification is not an hypothesis in need of evidence; it's a fact in need of explanation. Eric ... you seem to misunderstand the Creationist position (it's OK, sometimes I misunderstand your position as well) ... I actually have no problem at all with "Common Descent with Modification" and I have said so here several times.  You are correct that there are mountains of evidence that there was just one original "Ape kind" and one original "Dog kind" and one original "Cat kind" and one original "Human kind" and so on.  And it is quite true that all the hundreds of variations within these kinds we see today are the result of Common Descent with Modification--modification meaning random mutation and controlled random mixing during reproduction.  No argument there at all.  I understand Natural Selection quite well (and artificial selection too) and agree that it is a proven fact.  It is also a Creationist prediction.  Where we differ is in the evolutionist idea that everything shares one common ancestor, with my most interest in this regard being on the Ape/Human question.  We also disagree that random mutation and natural selection can produce anything like an eye where there was no eye before, or a flagellum, or what have you.  No one has been successful in showing how new features like this could have evolved by random mutation.  In almost all cases, random mutation makes things worse or neutral.  And in the few cases that they make things "better", it's not because a flagellum was added or an eye was added.  The changes are extremely minor changes.  This is because the information content required to make something as complex as a flagellum is so large (greater than 500 bits), that chance is ruled out.  And nothing simpler can be formed as a precursor, because it only would get selected for if it is complete and working. AFD said ...   Quote She says the convergence may not be unlikely.  She says that primates share dozen mutations.  And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance.   I don't understand the second sentence, but why is it so unusual to share "dozen mutations"?  Guinea pigs and humans share a lot of mutations too, right? Oops ... sorry, Incorygyble (or Jeannot) ... I meant to say THIRD sentence, not second.   What is Jeannot referring to when she says "And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance." ??  Is she switching back to apes and humans, or is she still talking about humans vs. guinea pigs? ----------------------------------- Quote Doesn't it puzzle you in the slightest that everybody here keeps asking you to provide evidence for your position, when I'm sure it seems obvious to you that you already have? Uh ... no, it doesn't puzzle me.  I did enough reading about the mindset of evolutionists before coming here that I was well prepared for what I would encounter. Quote We also disagree that random mutation and natural selection can produce anything like an eye where there was no eye before, or a flagellum, or what have you.  No one has been successful in showing how new features like this could have evolved by random mutation. Dave, it's been shown dozens of times. In many cases we know exactly which mutations in exactly which locations resulted in exactly which changes. Yes, of course ... you're talking about those wonderful 'Alice in Wonderland' descriptions of how the immune system evolved and such.  Have you ever read those?  If you did, you would see they are complete and total speculation of the highest order. Quote The changes are extremely minor changes.  This is because the information content required to make something as complex as a flagellum is so large (greater than 500 bits), that chance is ruled out.  And nothing simpler can be formed as a precursor, because it only would get selected for if it is complete and working. Dave, if you'd even the most cursory reading anywhere other than at AiG, you'd see that this argument (irreducible complexity) has been completely blown out of the water. Yes, I've read all those articles that 'blow the arguments out of the water' at T.O.  They are quite lame.   The most credible sounding one I've read yet is Dr. Max's article which is being discussed on this thread, but as it turns out, after much debating all around the mulberry bush, we are finally back to the following statement by Jeannot which proves my point and destroys Dr. Max's argument completely.  I'm going to put this in lights so that no one will miss it. ****************************************************************** Jeannot said ... Quote For the last time, you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene. </b> ****************************************************************** One more time for emphasis ... [b]For the last time, you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene. Remember, this whole thing started because Renier said ... "I used to be a YEC, but the broken Vitamin C gene in primates caused me to abandon the YEC position." OK.  What did Dr. Max say?  He said that an error in the GULO gene was copied from  the common ancestor of apes and humans to both humans and apes.  He compared this to a copyright case and said that this basically proves common descent of apes and humans. Now Jeannot just said that "you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene," telling me that neither Dr. Max nor anyone else knows which mutation broke the gene in humans or which mutation broke the gene in apes.  Dr. Max was saying that his argument was that the 'error was identical,' but his argument was really just that 'apes and humans both have broken GULO.'  OK.  So they both have broken GULO.  Big deal.  It could have broken independently, just as it did in guinea pigs.  What does this have to do with Dr. Max's copyright case?  Absolutely nothing.  And you cannot consider the loss of function alone as a valid evidence for common descent anyway, according to Jeannot. So we see that whereas Faid complains all the time about AIG lying, the truth of the matter is that it is Talk Origins that is lying.  You guys have been taken in by many slick arguments ... I have a cure for you ... www.dissentfromdarwin.org ... hundreds of good scientists are jumping ship ... you can too! ------------------------ Quote Step by step, in good argument format, please support this statement of yours. [that T.O. is lying] I will be quite happy to do so the moment that Faid and others give me their step by step argument that AIG is lying, because they made their assertion first.  On the other hand, if they feel this is too much trouble, if they will retract their statement, I will also retract mine. In any case, I have a feeling that you will continue to use T.O. despite what I say about it, and I feel sure I will keep using AIG despite what you say ... so what does it really matter? Quote Man, how many times have we explained this? You've explained the 'apes and humans are similar' argument many times, and I have also many times argued that 'apes and humans are similar' argues just as easily for Common Design as it does for Common Descent.  'Apes and Humans are similar' is all well and good, but it is not deterministic between the two views. Renier, if you stick with me long enough, I will be systematically dismantling all the basic underpinnings of evolution and establishing the credibility of the YEC position.   I have dismantled Dr. Max's argument, and I will continue to dismantle many more. Young Earth Creationism is the only view which not only is consistent with all the evidence from many disciplines, but also the only view which answers mankind's biggest questions in life. My hope for you and for all the good people here is that you will come to a knowledge of the truth ... and that it will transform your life as it has mine. ---------------------------------- Quote And, I predict, for the (n+1)th time, he will not get around to giving us that "easy" explanation. OK, Russell, for the (n+1)th time ... 95% similarity between apes and humans supports common design in the same way as it does in house building or car building, for example.  A Ford Aerostar is 95% (?) similiar to a Ford Fiesta (do they still make those?) and this is because they have a common designer.  You see?  Again, this is not rocket science and does not require a PhD (or even a biology degree). Quote Serious question Dave, Did you actually retire from the Air Force or did you resign your commission sooner than that? Went on reserve status when I got out in 1996, then resigned my commission this year. Quote "This is a revolution dammit, we're going to have to offend somebody!"-John Adams A great example of a great Christian "tough guy" !! ***************************************** You guys just can't get used to the fact that you lost the Portuguese thing, can you ... Quote I haven't read Dr Max's argument but if you think you have refuted the claim that the GULO gene does not support common descent you are sadly mistaken. You haven't even read the article and yet you disagree with me when I say I have refuted it? Whoa!   ... well, I was warned about this kind of stuff ... Quote why it's not which mutation broke the gene, but the remarkable simillarities in the accumulated mutations in the broken part between humans and primates that matter- You guys cannot get your story straight.  You say it's the similarities in the broken part, Jeannot says "you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene." Come on guys. Face it.  Apes and humans have some striking similarities, I agree.  Apes and humans both have what appears to be a broken GULO gene.  So what?  This does not prove Common Descent. Quote I'll give you this: I'll say that this guy is either a liar, or a total ignoramus in genetics and, at the same time, an arrogant jerk who thinks he can argue about something he knows absolutely nothing about by simply pulling "arguments" out of his ####. Take your pick. Great.  And I'll back off my "liar" claim for the T.O folks.  I will content myself to think they are just ignorant. ------------------------- Quote I think it's gotten to the point where Dave now thinks that if he admits a mistake on ANYTHING that his Christian arguments are all threatened. Oh really?  How do you explain my very forthright and honest concession that I was wrong about the AIG-chimp-chromosome thing? Arden, precisely the REVERSE of what you say is true.   YOU are the one that will never admit defeat no matter how looney you look. ---------------------- Quote All by itself, a broken GULO gene does not prove much of anything -- but it is one line of evidence. Thank you, Norm.  Would you please explain this to your friends and to Dr. Max?  They don't seem to get this simple point. As for kinds, we will be getting into them shortly. Quote Ah, I missed that. Sorry. And I'm glad you admitted it. So, now, in an attempt to prove to us that you're not 'looney', are you now willing to admit you were wrong on your linguistic statements, the founding fathers all being Christians, a Young Earth, Noah's flood, and scientists all 'jumping ship' on evolution? 'Cause none of those things are true, either... No.  I won the Portuguese thing thanks to Rilke's Wikipedia article, my Medieval Encyclopedia and your own admission.  You can go argue that one against me with Rilke until you are blue in the face if you want.  But you'll be talking to the wind. As for the rest, you'll have to earn victory, point by point.  If you win a point, I will concede.  I hope you will be so honorable as well. ----------------------------- Quote DDDDDDDDDAAAAAAAAAAAVVVVVVVEEEEEEEEE!!!!!!!! AAAAAAARRRRRRREEEEEE YYYYYOOOOOUUUU TTTTTTAAAAAAKIKKKIIIINNNNGG MMMMMYYYYYYY BBBBEEEEEEETTTTTT When do we start? NNNNNNNNNNNNOOOOOOOOOOO!  I won already ... now be a gentleman and go help Rilke crawl out from under that big branch I sawed off.  I think she hit her head when she fell because she's hallucinating now. Quote Surely, davy, surely after pages and pages of discussion on this, you're not going to pretend that Max's only evidence is "a broken GULO gene". I'm sure he has many more reasons why he thinks he is related to chimps, but the item of discussion on this thread most recently is THIS piece of evidence.  And let me say again ... I agree, it's a piece of evidence.  But it argues equally well for both Common Descent and Common Design.  Remember the Aerostar and the Fiesta? Quote But just for the record, it's not just one or two "holdouts" - so far as I can tell no one here other than you thinks you "won" that little dust-up. most of them probably do agree with me, but they wouldn't dare admit it and betray "the team." Quote For you to be correct I would have had to have said "I haven't read Dr Max's argument but if you think you have refuted his argument/article you are sadly mistaken." whereas I actually said "I haven't read Dr Max's argument but if you think you have refuted the claim that the GULO gene does not support common descent you are sadly mistaken." Do you see the subtle but important difference. Now that you point it out, yes.  I'll concede there was a subtle (very subtle) difference in the two statements. Tom Ames ...   Quote The GULO pseudogene is evidence for the common ancestry and recent divergence of humans and the other great apes. It is not "proof of" same, and not considered as such by careful scientists. You're engaging in an intellectually dishonest rhetorical tactic that Phil Johnson likes to use. He specializes in nibbling at the margins of specific pieces of evidence (never looking at the totality) and then pretending that he's "disproven" something. Or when it turns out that the evidence is correct, he diminishes its importance by pointing out that it's only one piece of evidence. Pointing out that the GULO story does not by itself "prove" the ancestry of humans is a red herring: no-one claims that it is sufficient evidence. And you can get any biologist to "concede" this. But so what? It strongly supports a particular hypothesis. And thousands of other observations do too. Thank you Tom, for agreeing with me in your first paragraph.  As for your second paragraph, if you will read this whole thread, I have looked at the totality of the Ape/Human ancestor question on two separate occasions.  To review briefly, the problems are (1) Lack of 'Hominid Civilizations' existing today, (2) Completely unconvincing fossil record, and (3) Major non-physical differences between apes and humans.  I am not engaging in intellectual dishonesty.  I focused heavily on the GULO issue because several people kept throwing it in my face in several different threads.  I simply took the challenge ... And won! Now let's see how intellectually honest all of you are ... -------------------------------- Quote Dave, I totally annihilated that claim of yours. There were other tool using primates, and our first human ancestors didn't live much differently than they did. Did you ever read those posts?[/quote] Of course I read your post.  I always read your posts.  You, Chris, Jeannot, Tom, Incorygible and several others say very coherent things and you don't get into the goofy name calling which just makes people look vacuous.  I can tell also that you are very sincere in what you believe.  I respect what you have to say even though I disagree with your conclusions. I know you responded to my claim of 'no hominid civilizations' but I don't agree that some bones and cave writing is evidence for this.  My contention is that if apes and humans have a common ancestor, there should be lots of 'beetle brow civilizations' all over the earth with half ape-men who grunt a lot and have a simple language and are at some stage between chimps and humans.  These 'people' should be living today if evolution were true. (Rilke-- I'm glad to see you believe in Jesus now ... maybe you could tell BWE about Him) -------------------------------------------- AND THAT'S A WRAP -------------- Who said that ev'ry wish would be heard and answered When wished on the morning star Somebody thought of that, and someone believed it Look what it's done so far The Daily Wingnut

Track this topic	Email this topic	Print this topic

© 2002-2009 Antievolution.org Powered by Ikonboard 3.0.2a © 2001 Ikonboard