Antievolution.org :: Antievolution.org Discussion Board The Critic's Resource on Antievolution

Antievolution.org Discussion Board > From the Panda's Thumb > After the Bar Closes... > Cosmic Fingerprints

Pages: (2) < [1] 2 >

FrankH Posts: 525 Joined: Feb. 2009 (Permalink) Posted: April 09 2010,14:53    I found a new place that looks fun for Tard mining: Comic, er Cosmic Fingerprints I don't know if I should be proud that I found it or saddened that it exists at all. -------------- Marriage is not a lifetime commitment, it's a life sentence!

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: April 09 2010,15:37    Quote (FrankH @ April 09 2010,14:53) I found a new place that looks fun for Tard mining: Comic, er Cosmic Fingerprints I don't know if I should be proud that I found it or saddened that it exists at all. Yes, alrighty, we have achieved "tired, wretched, poor..." In fact, this qualifies as wretched refuse of their teeming snore. Quote Day 1 -  The mistake Einstein later called “the biggest blunder of my career” – and a dangerous assumption that nearly blinded him to the greatest discovery of the 20th century. Ho hum, I wonder what that could be. Zzzzzzzzzzzzzz -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

FrankH Posts: 525 Joined: Feb. 2009 (Permalink) Posted: April 09 2010,15:51    Yeah, the stuff gets "better" (or is that much, much worse?) the more one reads. After reading this site and UD, UD is a bastion of intelligence. This guy though seems to allow more open debate.  But he's still bit shat nucking futz. -------------- Marriage is not a lifetime commitment, it's a life sentence!

keiths Posts: 2195 Joined: Jan. 2006 (Permalink) Posted: May 18 2010,20:41    And now Mr. Marshall has jumped on the "Darwinism in its death throes" bandwagon: Quote 2013: Darwin Fails. In 2013, the Berlin Wall of Darwinism Will Fall. Here’s Why. Evolution really did happen, living things really do have a common ancestor, and the earth really is 4.5 billion years old. But the way evolution really works has little in common with Darwin’s theory. Darwinism is in deep trouble and it’s too late save it. It’s no different than the Berlin Wall in 1986, Enron in 2000 or the US financial markets 3 years ago: It’s a bubble propped up by academic theorists, atheist zealots, politics and shell games - not hard science. All that needs to happen is for the right 3-5 scientists to step forward and expose the evolution industry for what it is…. and it’s not a question of “IF”, it’s only a question of WHEN. Darwinism has about 2-5 years left. And when the !@#$ hits the, fan it’s it’s gonna be quite a spectacle. Add another one to the list of people to mock in a few years. -------------- And the set of natural numbers is also the set that starts at 0 and goes to the largest number. -- Joe G Please stop putting words into my mouth that don't belong there and thoughts into my mind that don't belong there. -- KF

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 18 2010,22:50    Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste: Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Reciprocating Bill Posts: 4265 Joined: Oct. 2006 (Permalink) Posted: May 18 2010,22:58    Quote (afarensis @ May 18 2010,23:50) Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste:   Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' You mean it doesn't come from talking rocks? I'm in trouble. -------------- Myth: Something that never was true, and always will be. "The truth will set you free. But not until it is finished with you." - David Foster Wallace "Here’s a clue. Snarky banalities are not a substitute for saying something intelligent. Write that down." - Barry Arrington

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 18 2010,23:09    Quote (Reciprocating Bill @ May 18 2010,22:58) Quote (afarensis @ May 18 2010,23:50) Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste:   Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' You mean it doesn't come from talking rocks? I'm in trouble. I thought the mice were, ultimately, responsible... -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Venus Mousetrap Posts: 201 Joined: Aug. 2007 (Permalink) Posted: May 19 2010,05:01    Quote (afarensis @ May 18 2010,22:50) Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste: Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' I was about to argue with this, but then I saw that he enclosed *cannot* in asterisks, which makes his argument completely undefeatable. I might as well give up now. The best I've got is a few weedy little carats.

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 19 2010,08:51    Quote (keiths @ May 18 2010,20:41) And now Mr. Marshall has jumped on the "Darwinism in its death throes" bandwagon: Quote 2013: Darwin Fails. In 2013, the Berlin Wall of Darwinism Will Fall. Here’s Why. Evolution really did happen, living things really do have a common ancestor, and the earth really is 4.5 billion years old. But the way evolution really works has little in common with Darwin’s theory. Darwinism is in deep trouble and it’s too late save it. It’s no different than the Berlin Wall in 1986, Enron in 2000 or the US financial markets 3 years ago: It’s a bubble propped up by academic theorists, atheist zealots, politics and shell games - not hard science. All that needs to happen is for the right 3-5 scientists to step forward and expose the evolution industry for what it is…. and it’s not a question of “IF”, it’s only a question of WHEN. Darwinism has about 2-5 years left. And when the !@#$ hits the, fan it’s it’s gonna be quite a spectacle. Add another one to the list of people to mock in a few years. Oh, the rocks and stones themselves will sing!   A-nutter countdown! Me like. -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

J-Dog Posts: 4402 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,09:32    HaHa, he's wrong, the jokes on him!  Darwin won't be proved wrong in 2013 - the Mayan's have already decided that the world ends in 2012, and it says so right on the TV*.   *Telly for all you Brit fans out there. -------------- Come on Tough Guy, do the little dance of ID impotence you do so well. - Louis to Joe G 2/10 Gullibility is not a virtue - Quidam on Dembski's belief in the Bible Code Faith Healers & ID 7/08 UD is an Unnatural Douchemagnet. - richardthughes 7/11

curiousgeorge Posts: 2 Joined: May 2010 (Permalink) Posted: May 19 2010,10:07    I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so?

Amadan Posts: 1337 Joined: Jan. 2007 (Permalink) Posted: May 19 2010,10:16    Quote Gibbering creobot: " . . . the Berlin wall in 1986" Francis Bacon (a well-known Christian and a scientist) surveys the Berlin Wall in 1986: That must have been what made it fall three years later. Maybe. -------------- "People are always looking for natural selection to generate random mutations" - Densye  4-4-2011 JoeG BTW dumbass- some variations help ensure reproductive fitness so they cannot be random wrt it.

Amadan Posts: 1337 Joined: Jan. 2007 (Permalink) Posted: May 19 2010,10:18    Quote (curiousgeorge @ May 19 2010,10:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? Hello Perry.  Good of you to join us. -------------- "People are always looking for natural selection to generate random mutations" - Densye  4-4-2011 JoeG BTW dumbass- some variations help ensure reproductive fitness so they cannot be random wrt it.

Venus Mousetrap Posts: 201 Joined: Aug. 2007 (Permalink) Posted: May 19 2010,10:20    Quote (curiousgeorge @ May 19 2010,10:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? Why don't you try? It's good practice.

Albatrossity2 Posts: 2780 Joined: Mar. 2007 (Permalink) Posted: May 19 2010,10:31    Quote (curiousgeorge @ May 19 2010,10:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? What is the "counter argument" to a prediction about the future? As far as I can tell, there are no arguments in anything quoted here, just predictions. But if you are interested in the history of success of those folks who predict the downfall of Darwinism, I'm sure someone here could oblige you. Suffice it to say that there is a long and glorious history of failed predictions there. -------------- Flesh of the sky, child of the sky, the mind Has been obligated from the beginning To create an ordered universe As the only possible proof of its own inheritance.                         - Pattiann Rogers

midwifetoad Posts: 4003 Joined: Mar. 2008 (Permalink) Posted: May 19 2010,12:07    They've already got the 3-5 scientists: Behe, Dembski, Gish, Hunter, Marks. What more could you ask for? -------------- Any version of ID consistent with all the evidence is indistinguishable from evolution.

ppb Posts: 325 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,14:32    Quote (curiousgeorge @ May 19 2010,11:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? He says "In fact the evolutionary paradigm I’m about to share with you was first proposed more than 60 years ago. It was an object of derision and ridicule until it won the Nobel Prize for Science in 1983." There is no Nobel Prize for "Science". ETA:  Maybe he meant Barbara McClintock, for her work on horizontal gene transfer.   If her work was ridiculed, why was she given the Nobel Prize in Physiology or Medicine? -------------- "[A scientific theory] describes Nature as absurd from the point of view of common sense. And it agrees fully with experiment. So I hope you can accept Nature as She is - absurd." - Richard P. Feynman

curiousgeorge Posts: 2 Joined: May 2010 (Permalink) Posted: May 19 2010,18:03    So no serious responses as of yet...

ppb Posts: 325 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,18:10    Quote (curiousgeorge @ May 19 2010,19:03) So no serious responses as of yet... The website doesn't give us much to comment on without subscribing.  Perhaps you could post something of substance from there and we can respond to it. My earlier post addressed some misinformation from the web site.  Care to respond to that? -------------- "[A scientific theory] describes Nature as absurd from the point of view of common sense. And it agrees fully with experiment. So I hope you can accept Nature as She is - absurd." - Richard P. Feynman

Cubist Posts: 558 Joined: Oct. 2007 (Permalink) Posted: May 19 2010,18:25    Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... There's a very appropriate quote from Thomas Jefferson: "Ridicule is the only weapon which can be used against unintelligible propositions. Ideas must be distinct before reason can act upon them..." The proposition you're asking us to provide serious responses to is, itself, unintelligible. The author of the quote you're referring to asserts that nonliving things cannot create "information"; what does he mean by "information"? If his definition of "information" includes any clause to the effect that information absolutely must come from a living/intelligent source, then sure, by definition rocks cannot create "information" in the sense that guy means it. Wonderful! All he has to do is demonstrate that his personal definition of "information" has any bearing on the RealWorld, and he's got something. Also, if the author of that quote doesn't know how to measure information, it follows that he can't even tell if rocks can create information. So perhaps the author of that quote might want to visit the So You Think ID Has Substance? thread and take the third challenge, the one about determining which of two different nucleotide sequences has more information in it? Or, if the author of that quote is unavailable for whatever reason, how about you do that, Curious George?

nmgirl Posts: 92 Joined: Sep. 2009 (Permalink) Posted: May 19 2010,18:35    Quote (J-Dog @ May 19 2010,09:32) HaHa, he's wrong, the jokes on him!  Darwin won't be proved wrong in 2013 - the Mayan's have already decided that the world ends in 2012, and it says so right on the TV*.   *Telly for all you Brit fans out there. i was trying to figure out why 2013 and then I realized: that is when the rethuglicans take over the world again.

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 19 2010,19:50    Quote (J-Dog @ May 19 2010,09:32) HaHa, he's wrong, the jokes on him!  Darwin won't be proved wrong in 2013 - the Mayan's have already decided that the world ends in 2012, and it says so right on the TV*.   *Telly for all you Brit fans out there. Gee, J-Dog, does that mean that evolution will not die in 2016 after all? Because I've been worried...evolution has not been watching his diet lately...wouldn't want it to have a heart attack on April 1, 2016 or something. -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,22:11    I have only received the one email...it's been almost 24 hours since the last one. I am very disappointed. -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Venus Mousetrap Posts: 201 Joined: Aug. 2007 (Permalink) Posted: May 20 2010,09:27    Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... I'll have a go, then. This is 'the atheist's riddle'. Quote Gentlemen: The starting point of this discussion is my central thesis, which is: 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. 2) All codes are created by a conscious mind; there is no natural process known to science that creates coded information. 3) Therefore DNA was designed by a mind. If you can provide an empirical example of a code or language that occurs naturally, you've toppled my proof. All you need is one. Perry Marshall I offer the following counter: a) All minds are ultimately the result of DNA, since it tells the body how to form, and there are no known non-biological minds. b) Following from point 3, this means that DNA was designed by a mind which was formed from DNA, which was also designed by a mind, in an infinite chain of causality. c) Since the universe has existed for a finite time, this cannot be the case. Therefore either point 3 is false, or there exist minds which are not biological - something science has never observed. d) Therefore, DNA was not designed by a mind. If you can provide an empirical example of a non-biological mind, you've toppled my counter.

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: May 20 2010,10:58    curiousgeorge     Quote 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. One of the attributes that language possesses is that it can be translated into other languages. Please translate this   Quote ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC Into a different language. German perhaps? Note, google translate will not help you here. If you cannot translate it, is it really a "language"? Perhaps language is not quite the right word then? If, of course, you cannot translate it. -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 20 2010,11:43    I am continually amazed at how IDers refer to "information" as if it were knowledge, wisdom, or foresight. Information happens all the time; it does not take a mind to create it, whereas human-generated information does take a mind to organize it, otherwise it turns into Borges' Library of Babel - which is where ID is going. After all, ID seems to be building no taxonomy. They're just throwing out a bunch of top-level terms to see if something sticks. -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 20 2010,12:07    Quote (Venus Mousetrap @ May 20 2010,09:27)   Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... I'll have a go, then. This is 'the atheist's riddle'.     Quote Gentlemen: The starting point of this discussion is my central thesis, which is: 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. 2) All codes are created by a conscious mind; there is no natural process known to science that creates coded information. 3) Therefore DNA was designed by a mind. If you can provide an empirical example of a code or language that occurs naturally, you've toppled my proof. All you need is one. Perry Marshall I offer the following counter: a) All minds are ultimately the result of DNA, since it tells the body how to form, and there are no known non-biological minds. b) Following from point 3, this means that DNA was designed by a mind which was formed from DNA, which was also designed by a mind, in an infinite chain of causality. c) Since the universe has existed for a finite time, this cannot be the case. Therefore either point 3 is false, or there exist minds which are not biological - something science has never observed. d) Therefore, DNA was not designed by a mind. If you can provide an empirical example of a non-biological mind, you've toppled my counter. It should also be remembered that, whenever IDists or scientists refer to a biological entity as a machine, code, robot, module, etc. that these are at best analogies. Just because I observe that the sky is "blue" does not mean that the sky is actually paint pigment. We humans created words to describe our human social activities first, not the cosmos (and not our subjective states of mind). Quarks are not really "charmed" or "strange," or up or down; the "big bang" was not a "bang" (the phrase was intended as a pejorative); even "species" is a convenience because, remember, species are mutable. As I wrote in my paper, it is tremendously difficult for us to mentally grasp the natural world, since we see ourselves as artificial and separate from it. Christians refer to Christ as the "lamb of God," but if I were to argue that therefore Jesus literally was an Ovis aries, that would be pretty deceptive, wouldn't it? -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

JLT Posts: 740 Joined: Jan. 2008 (Permalink) Posted: May 20 2010,15:25    Quote (Venus Mousetrap @ May 20 2010,15:27)     Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... I'll have a go, then. This is 'the atheist's riddle'.       Quote Gentlemen: The starting point of this discussion is my central thesis, which is: 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. 2) All codes are created by a conscious mind; there is no natural process known to science that creates coded information. 3) Therefore DNA was designed by a mind. If you can provide an empirical example of a code or language that occurs naturally, you've toppled my proof. All you need is one. Perry Marshall I offer the following counter: a) All minds are ultimately the result of DNA, since it tells the body how to form, and there are no known non-biological minds. b) Following from point 3, this means that DNA was designed by a mind which was formed from DNA, which was also designed by a mind, in an infinite chain of causality. c) Since the universe has existed for a finite time, this cannot be the case. Therefore either point 3 is false, or there exist minds which are not biological - something science has never observed. d) Therefore, DNA was not designed by a mind. If you can provide an empirical example of a non-biological mind, you've toppled my counter. Me, too! I don't agree that DNA is a code in the same sense that we use for man made codes, but that doesn't really matter. Marshall's argument fails anyway. Two possibilities: a) DNA had a natural origin or b) DNA was designed If a) is true, then not all codes are designed and Marshall's 2) doesn't apply. Only if b) was true Marshall's point 2) stands - which means that Marshall's taken as premise what he wants to prove. Logic is a wonderful thing but doesn't always beat actual thought. -------------- "Random mutations, if they are truly random, will affect, and potentially damage, any aspect of the organism, [...] Thus, a realistic [computer] simulation [of evolution] would allow the program, OS, and hardware to be affected in a random fashion." GilDodgen, Frilly shirt owner

Quack Posts: 1961 Joined: May 2007 (Permalink) Posted: May 20 2010,16:16    Quote As I wrote in my paper, it is tremendously difficult for us to mentally grasp the natural world, since we see ourselves as artificial and separate from it. Part of the problem may be that our brains weren't made for mentally grasping anything. I suspect my brain was made just to help me survive and 'multiply'. Which I've done. Another problem may be that the world really isn't really (fully) mentally graspable. -------------- Rocks have no biology.               Robert Byers.

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 20 2010,19:40    Low and behold another email. This one full of gross mischaracterizations of natural selection - and an insulting account of "cavemen" to boot: Quote Darwin was definitely right about natural selection. To be fair, being right about that is no Nobel Prize winning accomplishment. The weaklings die and the strong survive. I think our cave man ancestors were familiar with that one. (Rog hits Grog over the head with a rock and kills him, then they both get eaten by a hungry tiger. Survival of the fittest... nothing profound about that.) Seriously, natural selection does not have any kind of creative power at all. All it does is kill of the runts. The secret to evolution, then, has to be in the "random variation" part. Darwin, in his time, believed that random variation in heredity produced all manner of species. He said: most of the time it's harmful, but occasionally it's helpful and from these variations come all kinds of beautiful forms that appear to be designed. So, my first serious criticism is that Perry has totally misunderstood the nature of selection which comes in a wide variety of types. There is stabilizing selection, disruptive selection, directional selection (positive and negative), differential types such as frequency dependent selection. Each of which as a different effect on the genome. To reduce these to the above characterization is a gross simplification of the phenomena. Then we get: Quote What is meant by "random variation"? Thousands of biology books say it's accidental copying errors in DNA. They say, essentially, that it's corrupted data that occasionally turns out to be beneficial instead of harmful. This is where Darwin and the biology books are wrong. As a communication engineer I know - with 100.000000000% certainty - that this is impossible. Nowhere in the vast field of engineering is there any such thing as "the percentage of the time that corrupted data is helpful instead of harmful." It's ALWAYS harmful. Always. Copying errors and data transmission errors never help the signal. They only hurt it. Mutations have a wide variety of causes and effects and to reduce them to copy errors only is quite misleading - it may play well with folks who know nothing about biology but folks who do might consider such oversimplifications to be misleading. I would also argue, like several others above, that the asserted analogy between data/information and genes is not sufficiently strong enough to carry the weight of the argument being made. The analogy is asserted but there is actual proof to back up the asserted equivalency. -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Pages: (2) < [1] 2 >

Track this topic	Email this topic	Print this topic

© 2002-2009 Antievolution.org Powered by Ikonboard 3.0.2a © 2001 Ikonboard