RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (17) < 1 2 3 4 5 [6] 7 8 9 10 11 ... >   
  Topic: Otangelo's thread< Next Oldest | Next Newest >  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,15:35   

Quote (NoName @ Nov. 18 2015,15:19)
All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?

Two points here :

How exactly did God create things ? what process was involved ?

http://reasonandscience.heavenforum.org/t1794-h....nvolved

Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.

Argument from incredulity

http://reasonandscience.heavenforum.org/t1724-a....ty#2738

Incredulity is based on human experience and on what we actually know. For example, the belief in abiogenesis can be strongly doubted, one can be skeptical of it, because it has never been observed and all proposals have lead to a dead end so far. So its more than rational to look somewhere else.  What has been observed is biogenesis, life coming from life. What we know is that the complexity in the natural world of living organisms is similar to, in fact much greater than, the complexity of intelligently created devices, such as the clock or the computer. You might implie that incredulity is an unreasonable position, but it is in fact a foundation for all critical thought. Sensible people do not believe things without evidence. Consider the opposite, credulity; there is no context in which that is not a pejorative word! Considering what atheists are willing to believe, can indeed be classed as credulous.

It is also quite proper for a person of one religion or philosophy to be skeptical of the beliefs of another one. The religion of naturalism, which is the basis of evolution, can properly be rejected by a biblical theist. The evolutionist system may be dominant in some parts of the world, but that says nothing about whether it is true. Many have looked at it and found it inadequate; they have found good reasons to be skeptical of it, especially since theism better explains very many features of the natural world.

When i say that something is unbelievable or inconceivable,  i give good reasons. If my whole argument were simply an unsupported statement of unbelief, you would have a good point; to say something is unbelievable without giving a reason is not a good argument. But the problem is that you oversimplify; you do not address the reasons for incredulity.

Incredulity is an argument of scepticism about a certain point of view, and the evolutionist and atheist are not innocent of using such an argument. Incredulity, doubt and scepticism about God and special creation, are implicit in every naturalistic explanation  about abiogenesis and many other facets of their  view points.

This kind of arguments are frequent :

 how can a perfect deity create such a messed up world? (translation: it is inconceivable that a perfect deity could create such a messed up world, therefore, since evolution is a theory of messed-up, random natural forces and actions, it must be true)
 how can (a certain part of a living organism, e.g., the human eye) be designed when it has this mistake or that problem? (translation: it is inconceivable that an intelligent divine designer could create that supposedly malfunctioning part of the living organism; therefore it must have been formed through random, unintelligent, natural forces, i.e. evolution)

All of these arguments could be accurately classed as arguments of incredulity. If no reason is given, any argument from incredulity is weak.

And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

  
Soapy Sam



Posts: 659
Joined: Jan. 2012

(Permalink) Posted: Nov. 18 2015,15:51   

Quote (Otangelo @ Nov. 18 2015,21:30)
Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?

Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.

Hey! Can you ignore me too please? Thanks.

--------------
SoapySam is a pathetic asswiper. Joe G

BTW, when you make little jabs like “I thought basic logic was one thing UDers could handle,” you come off looking especially silly when you turn out to be wrong. - Barry Arrington

  
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,16:04   

Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

Why do you keep telling this same lie?  It doesn't get any better with age or retelling.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,16:06   

Quote (Otangelo @ Nov. 18 2015,15:30)
Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?

Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.

To use your very example:

True or false:

"miracle" = "almost a miracle" ??


Its very simple. YOU LIAR.

I didn't 'ignore all the quotes you provided' as I cited the one that shows you are a liar.

SO THAT'S ANOTHER LIE, THEN.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,16:08   

Quote (Occam's Aftershave @ Nov. 18 2015,16:04)
Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

Why do you keep telling this same lie?  It doesn't get any better with age or retelling.

because YEC creationist, obviously!

Facts just won't stick. Disgusting.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,16:14   

Quote (Otangelo @ Nov. 18 2015,16:35)
   
Quote (NoName @ Nov. 18 2015,15:19)
All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?

Two points here :

How exactly did God create things ? what process was involved ?

Who asked?
Note, too, that 'process' is also an inherently temporal term.  There can be no process if there is no time.
Further, processes are not disembodied or free-floating -- how can there be a process if there are no things (in the broadest sense of the term)?
You're worse at philosophy then you are at science.
[pointless link deleted]
 
Quote
Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.

Argument from incredulity...

Funny, in all that blather there is nothing that rescues your arguments nor shows that my claims regarding them are false.
You are simply arguing from your own prejudicial (in the technical sense of the term) rejection of theories that you cannot even present accurately.  Most, if not all, of your objections to abiogenesis are old, tired, and amount to PRATTs.

 
Quote
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

Oddly enough, nothing you have posted supports this conclusion.  
You continue to squirm around avoiding the question.
Could it be you are not qualified to assert such a claim so boldly and absolutely?  You are not so qualified if you cannot answer the question.
Why is abiogenesis impossible?

The words that so impress you are not remarkable in any way.
The claims were not uttered nor recorded by God.  Even in  the Abrahamic religions, those words are claimed to have been recorded by Moses.  Moses' words are not self-validating.  It is circular, if not question-begging, to simply accept them on the face of things.
Particularly when, on the face of things, that is, the clear text, the beginning of Genesis is a mishmash of commonplace mythology of the Mediterranean basin, particularly the region from Egypt east and northwards to Turkey.
You are asking us to assume your conclusion.
It remains an asserted conclusion, without adequate support, and without any explanatory power whatsoever even if the existence of a god should somehow be shown.
"Poof" is not an explanation.

But all of those words that you bibliolators are so impressed by are entirely irrelevant to the claims I am attacking.
They are, at best, a cop-out.

Nothing you have posted is responsive to the issues raised.
Why is abiogenesis impossible?

New issues, since you raised the subjects:
How does creation happen when there is no time?
There is no 'beginning' without time.

Ontology has progressed since Spencer.  Nor is he particularly noted for his ontology.
You're cherry-picking as part of your furious Gish-gallop to avoid the problems of your own position.
Defend it or explicitly abandon it.

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,16:22   

Shorter response to Otangelo's drivel:

The deity of the Abrahamic religions does not and cannot solve the problem of abiogenesis.
The god (or "God" if you prefer) of Abraham, Isaac, and Jacob is not biologically alive.
Therefore, the problem remains untouched.
If abiogenesis is impossible, than god can't do it either, not being biologically alive.
If God is claimed to be biologically alive, then he rose from abiogenesis, or abiogenesis is possible and there is some prior 'process' which led to his life.
If God is not biologically alive (and he possesses none of the hallmarks of biologically living things), and he 'created' life, then we still have the problem of how.
Asserting it sans positive evidence does not solve the problem of how abiogenesis occurred.
Unless everything, literally, is alive, the problem remains how did life arise?
"Poof" is not an answer.

  
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,16:25   

Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

How do you know it is impossible by all means?  Are you an omnipotent God who tested all means?

Why don't you add this to your "library".

Researchers may have solved origin-of-life conundrum

"The origin of life on Earth is a set of paradoxes. In order for life to have gotten started, there must have been a genetic molecule—something like DNA or RNA—capable of passing along blueprints for making proteins, the workhorse molecules of life. But modern cells can’t copy DNA and RNA without the help of proteins themselves. To make matters more vexing, none of these molecules can do their jobs without fatty lipids, which provide the membranes that cells need to hold their contents inside. And in yet another chicken-and-egg complication, protein-based enzymes (encoded by genetic molecules) are needed to synthesize lipids.

Now, researchers say they may have solved these paradoxes. Chemists report today that a pair of simple compounds, which would have been abundant on early Earth, can give rise to a network of simple reactions that produce the three major classes of biomolecules—nucleic acids, amino acids, and lipids—needed for the earliest form of life to get its start. Although the new work does not prove that this is how life started, it may eventually help explain one of the deepest mysteries in modern science.

“This is a very important paper,” says Jack Szostak, a molecular biologist and origin-of-life researcher at Massachusetts General Hospital in Boston, who was not affiliated with the current research. “It proposes for the first time a scenario by which almost all of the essential building blocks for life could be assembled in one geological setting.”

Here's the actual paper

Common origins of RNA, protein and lipid precursors in a cyanosulfidic protometabolism
Patel et al
Nature Chemistry, 7, 301–307 (2015)

Abstract: A minimal cell can be thought of as comprising informational, compartment-forming and metabolic subsystems. To imagine the abiotic assembly of such an overall system, however, places great demands on hypothetical prebiotic chemistry. The perceived differences and incompatibilities between these subsystems have led to the widely held assumption that one or other subsystem must have preceded the others. Here we experimentally investigate the validity of this assumption by examining the assembly of various biomolecular building blocks from prebiotically plausible intermediates and one-carbon feedstock molecules. We show that precursors of ribonucleotides, amino acids and lipids can all be derived by the reductive homologation of ​hydrogen cyanide and some of its derivatives, and thus that all the cellular subsystems could have arisen simultaneously through common chemistry. The key reaction steps are driven by ultraviolet light, use ​hydrogen sulfide as the reductant and can be accelerated by Cu(I)–Cu(II) photoredox cycling

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,16:56   

Quote (NoName @ Nov. 18 2015,16:22)
"Poof" is not an answer.

What is ?

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,17:09   

Quote (Otangelo @ Nov. 18 2015,17:56)
Quote (NoName @ Nov. 18 2015,16:22)
"Poof" is not an answer.

What is ?

Absence of a definitive answer is better answered by "we don't know yet" than by "poof".
One is susceptible to further investigation and study.  The other is the death of the mind.

As I have shown, that there are living and non-living things is the core problem of abiogenesis.
The Abrahamic god is not a sufficient answer.  Nor does recourse to 'god did it' serve as an explanation, and, in fact, either dethrones the deity or fails to address the problem.  Worse, it requires acceptance of contradictions as noted previously.

So you are left clutching your incredulity, further from an answer than science and reason.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,17:12   

Quote (NoName @ Nov. 18 2015,17:09)
The Abrahamic god is not a sufficient answer.

It might not be to you. But it is certainly to me, and many others...

Limited causal alternatives for origins

http://reasonandscience.heavenforum.org/t1810-l....origins

Its not justified to claim " we don't know ", when a limited range of alternatives and options are available. In regard our our existence, there are just and exactly 3, namely:

chance
design
physical necessity.

since chance, and physical necessity won't cut the cake, the best explanation for our existence is design.


Pretend you wake up in the morning and there's a birthday cake sitting on your kitchen table, and it just happens to be your birthday. What do you think? You ask yourself, "Where did this cake come from?" There are only a couple of possibilities, theoretically. It could have just materialized out of nowhere on your kitchen table coincidentally on your birthday. It could have just "poofed" into existence. I guess that would be in the realm of theoretic possibilities. Or maybe a great, hot, wet wind blew through your neighbor's kitchen gathering up a bunch of ingredients and kind of accidentally baked a cake that landed on your table. The fact that it happened on your birthday is a coincidence. I guess that would be "possible" too. The cake could have come out of nowhere, or could have just assembled itself by chance. Or the other alternative would be that a person baked the cake for you and dropped it off in the middle of the night.

Now here's the trick. When faced with limited options you don't have the liberty not to believe something. If you reject the idea that somebody baked the cake for you, you must assert in its place that the cake either materialized out of nothing or formed itself by accident. When you reject one option you are asserting an alternate option when all the options are clear.

Do you see that? When you are faced with just a limited number of choices, if you reject one choice you've got to opt for one of those that remains. So the question is, which option makes most sense?


http://enrichmentjournal.ag.org/201303....sts.cfm

The Christian Geneticist Francis Collins of Human Genome Project fame said he was an agnostic in college. Yet he confesses that his “I don’t know” was more an “I don’t want to know” attitude — a “willful blindness.”11 This agnosticism eventually gave way to outright atheism — although Collins would later come to faith in Christ. He began reading C.S. Lewis’ Mere Christianity, and Collins realized his own antireligious constructs were “those of a schoolboy.”12

Because the existence of God is a massively important topic, we cannot afford not to pay attention — especially in an age of so many diversions. Philosopher Tom Morris points out that sports, TV, restaurants, concerts, cars, billiards, and a thousand other activities can divert us from the ultimate issues of life. As a result, we don’t “tune into” God. And when a crisis hits (death, hospitalization, natural disaster), we are not really in the best condition to process and make accurate judgments about those deep questions.13 The person who says, “I do not know if God exists,” may have chosen to live by diversions and distractions and thus to ignore God. This is not an innocent ignorance; this ignorance is the result of our neglecting our duty.

So the theist, atheist, and militant (ornery) agnostic all bear a burden of proof; the theist does not have a heavier burden since all claim to know something. Furthermore, even the alleged ordinary agnostic still is not off the hook. For one thing, one cannot remain neutral all his life; he will make commitments or hold beliefs all along the way that reflect either an atheistic or theistic worldview. He is either going to be a practical atheist or practical theist (or a mixture of the two) in some fashion throughout his life. But he can’t straddle the fence for long. Also, the ordinary agnostic may say, “I do not know,” but this often means “I do not care” — the view of an “apatheist.” Refusing to seek out whether God exists or not; refusing to humble oneself to seek whatever light about God is available; living a life of distractions rather than thoughtfully reflecting about one’s meaning, purpose, or destiny leaves one culpable in his ignorance, not innocent.

  
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,17:17   

Quote (Otangelo @ Nov. 18 2015,17:12)
It might not be to you. But it is certainly to me, and many others...

If you're content to stay pitifully ignorant about the natural world and accept "POOF!  GAWDDIDIT" for everything then more power to you.  Just don't expect anyone with an IQ higher than room temperature (Celsius) to agree with you.  And certainly don't expect to change anyone's mind by C&Ping the bog-standard Creationist lies and misinformation.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,17:25   

As I said, the death of the mind.

That pretty much makes you a zombie.

You can't justify your claims, you can't defend them, you accept atemporal  processes and atemporal causation, both manifestly internally contradictory.

As has been obvious from the start, you are making prejudicial assertions in service of your agenda and your incredulity.

That this is satisfactory to you is shameful.

  
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,17:27   

Quote (Otangelo @ Nov. 18 2015,17:12)
Its not justified to claim " we don't know ", when a limited range of alternatives and options are available. In regard our our existence, there are just and exactly 3, namely:

chance
design
physical necessity.

since chance, and physical necessity won't cut the cake, the best explanation for our existence is design.

But the combination of chance and physical necessity in the form of evolution does the job quite nicely.

Sorry, no need for your Magic Designing Poofter.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,17:46   

It is perhaps worth noting that design is only required in the face of physical necessity.
Without limitations, material limits or restrictions, i.e., physical necessity, design is superfluous.
The Abrahamic god, claimed to be omniscient and omnipotent, need not design.  The very notion is outside the scope of consideration of any such being.
Thus, we have good grounds for rejecting your claims of signs of divine or non-natural design -- they must be spurious.
If there are such signs, they undercut the claims made for the nature of god.

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 18 2015,17:59   

What is the information VALUE from this string of DNA
Quote
ATG GTG GAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTGAAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC GGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGC
ACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAGTCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCTCAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTCAAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCTGAG AAC TTC AGG TGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACAGT
TTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTT
TCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGA
AATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTT
GCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTT
AATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTA
TCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAAC
AGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT


Now calculate the information VALUE of this string
Quote
ATG GTG GAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
GAG AAC TTC AGG GTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT


1) Show your work?
2) How does the mutation in bold change the information VALUE of the string?
3) Why is this change impossible?

BTW: I will not accept C&P posts. Do the math, show your work, derive your conclusions from the math. Or, like every other creationist, admit that you can't.

P.S. I should add that if you ignore me too, then there's basically no one else on this site. You'll basically be spamming a thread that no one will ever read and you won't listen to any responses.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,18:33   

Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly

please cite me where i make that admittance.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,18:34   

Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?

i am bad on math. sorry

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,18:44   

Quote (Otangelo @ Nov. 18 2015,19:33)
 
Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly

please cite me where i make that admittance.

It's implied by your remarks regarding Genesis 1:1, above.  The first post on this page.
Either god created time, which commits you to atemporal causes and atemporal processes, or god did not create the five Spencerian ontological categories you are so impressed by.

But again, this is beside the point.
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

We can return to the more recently raised issues of your ontological confusions and absurdities after we've cleared that up.

  
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 18 2015,18:53   

Quote (Otangelo @ Nov. 18 2015,10:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?

There are many reasons. I will post a small list to begin with:

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

Miller was using the atmospheres of the other Solar System planets known by spectrographic analysis. This was his professor Harold Urey's hypothesis. Charles Darwin's idea was that the origin of life was in a reducing environment because the decomposition products of tissues were reduced. He was incorrect, Urey was correct.

You clearly have no experience in chemistry.

The early earth had a reduced atmosphere. We know this in several ways. The most significant is geological data.

Matthew A. Pasek, Jelte P. Harnmeijer, Roger Buick, Maheen Gull, and Zachary Atlas
2013 "Evidence for reactive reduced phosphorus species in the early Archean ocean" PNAS 2013 ; published ahead of print June 3, 2013, doi:10.1073/pnas.1303904110

Colin Goldblatt, Timothy M. Lenton and Andrew J. Watson
2006 "Bistability of atmospheric oxygen and the Great Oxidation" Nature 443, 683-686 (12 October 2006) | doi:10.1038/nature05169

Manfred Schidlowski, Peter W. U. Appel, Rudolf Eichmann and Christian E. Junge
1979 "Carbon isotope geochemistry of the 3.7 × 109-yr-old Isua sediments, West Greenland: implications for the Archaean carbon and oxygen cycles" Geochim. Cosmochim. Acta 43, 189-199

Zahnle, Kevin, Laura Schaefer and Bruce Fegley
2010 “Earth's Earliest Atmospheres” Cold Spring Harbor Perspectives in Biology

Ozone with a reducing atmosphere;

Noll KS, Roush TL, Cruikshank DP, Johnson RE, Pendleton YJ.
1997 “Detection of ozone on Saturn's satellites Rhea and Dione. “ Nature 1997 Jul 3;388(6637):45-7

Additionally, UV shielding would only be needed in continental terrains;

Sagan, Carl, Christopher Chyba
1997  “The Early Faint Sun Paradox: Organic Shielding of Ultraviolet-Labile Greenhouse Gases” Science v. 276 (5316): 1217-1221

E. T. Wolf and O. B. Toon
2010 “Fractal Organic Hazes Provided an Ultraviolet Shield for Early Earth” Science 4 June 328: 1266-1268 [DOI: 10.1126/science.1183260]

Watanabe, Y., Martini, J.E.J., Ohmoto, H.
2000 “Geochemical evidence for terrestrial ecosystems 2.6 billion years ago.” letters, Nature, 408, 574-578 (2000).  (terrestrial bio by 2.6 to 2.7 Ga implies sufficient O2 for an biogenic Ozone UV shield)

But, an even better UV shield is ice. And, Ice is an excellent location for several key chemical steps;

Cleaves, H. James, Stanley L. Miller
1998 “Oceanic protection of prebiotic organic compounds from UV radiation” PNAS-USA v. 95, issue 13: 7260-7263

Bada, Jeffrey. L., C. Bigham, Stanley L. Miller
1994 “Impact melting of frozen oceans on the early Earth: Implications for the origin of life” PNAS-USA v.91: 1248-1250

BERNSTEIN, MP, JP DWORKIN, SA SANDFORD, GW COOPER &
LJ ALLAMANDOLA
2002 "Racemic amino acids from the ultraviolet photolysis of interstellar ice analogues"  Nature 416, 401 - 403 (2002)

Attwater, J., Wochner, A., & Holliger, P.
2013 "In-ice evolution of RNA polymerase ribozyme activity" Nature chemistry, 5(12), 1011-1018.

Bernstein, M. P. et al.  
1999 "UV irradiation of polycyclic aromatic hydrocarbons in ices: Production of alcohols, quinones, and ethers" Science 283, 1135–1138

Blank, J.G., Gregory H. Miller, Michael J. Ahrens, Randall E. Winans
2001 “Experimental shock chemistry of aqueous amino acid solutions and the cometary delivery of prebiotic compounds” Origins of Life and Evolution of the Biosphere 31(1-2):
15-51,

GM MUÑOZ CARO, UJ MEIERHENRICH, WA SCHUTTE, B BARBIER, A ARCONES SEGOVIA, H ROSENBAUER, WHP THIEMANN, A BRACK & JM GREENBERG
2002 "Amino acids from ultraviolet irradiation of interstellar ice analogues"  Nature 416, 403 - 406 (2002)

Miyakawa S, Cleaves HJ, Miller SL.
2002 "The cold origin of life: B. Implications based on pyrimidines and purines produced from frozen ammonium cyanide solutions" Orig Life Evol Biosph. 2002 Jun;32(3):209-18

Cleaves HJ, Nelson KE, Miller SL.
2006 "The prebiotic synthesis of pyrimidines in frozen solution" Naturwissenschaften. 2006 Mar 22

And, the final nail in this particular creationist fraud is that abiotic amino acid synthesis can happen in the presence of oxygen;

Cleaves, H. James, John H. Chalmers, Antonio Lazcano, Stanley L. Miller, Jeffrey L. Bada
2008 “A Reassessment of Prebiotic Organic Synthesis in Neutral Planetary Atmospheres” Orig Life Evol Biosph (2008) 38:105–115

So, to review; the Miller/Urey hypothesis was confirmed; the UV "problem" was not a problem.

--------------
"Science is the horse that pulls the cart of philosophy."

L. Susskind, 2004 "SMOLIN VS. SUSSKIND: THE ANTHROPIC PRINCIPLE"

   
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,18:55   

Quote (Otangelo @ Nov. 18 2015,18:34)
 
Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?

i am bad on math. sorry

You pretty much suck at science too but that's not stopping you.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,20:04   

Quote (NoName @ Nov. 18 2015,18:44)
Quote (Otangelo @ Nov. 18 2015,19:33)
 
Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly

please cite me where i make that admittance.

It's implied by your remarks regarding Genesis 1:1, above.  The first post on this page.
Either god created time, which commits you to atemporal causes and atemporal processes, or god did not create the five Spencerian ontological categories you are so impressed by.

But again, this is beside the point.
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

We can return to the more recently raised issues of your ontological confusions and absurdities after we've cleared that up.

What i said, does not imply that God created outside of time. That is impossible.

http://www.leaderu.com/offices....on.html

the cause of the Big Bang operated at to, that is, simultaneously (or coincidentally{1}) with the Big Bang. Philosophical discussions of causal directionality routinely treat simultaneous causation, the question being how to distinguish A as the cause and B as the effect when these occur together at the same time [Dummett and Flew (1954); Mackie (1966); Suchting (1968-69); Brier (1974), pp. 91-98; Brand (1979)].{2} Even on a mundane level, we regularly experience simultaneous causation;

Non of the alternatives make sense to me :

5 Easy Steps to refute Atheism

http://reasonandscience.heavenforum.org/t1877-5....sm#3144

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 18 2015,20:07   

Quote (Otangelo @ Nov. 18 2015,18:34)
Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?

i am bad on math. sorry

So you have no way of knowing that they are lying to you?

But you trust them. Why?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,20:11   

Quote (Dr.GH @ Nov. 18 2015,18:53)
Quote (Otangelo @ Nov. 18 2015,10:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?

There are many reasons. I will post a small list to begin with:

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

Miller was using the atmospheres of the other Solar System planets known by spectrographic analysis. This was his professor Harold Urey's hypothesis. Charles Darwin's idea was that the origin of life was in a reducing environment because the decomposition products of tissues were reduced. He was incorrect, Urey was correct.

You clearly have no experience in chemistry.



Matthew A. Pasek, Jelte P. Harnmeijer, Roger Buick, Maheen Gull, and Zachary Atlas
2013 "Evidence for reactive reduced phosphorus species in the early Archean ocean" PNAS 2013 ; published ahead of print June 3, 2013, doi:10.1073/pnas.1303904110

Colin Goldblatt, Timothy M. Lenton and Andrew J. Watson
2006 "Bistability of atmospheric oxygen and the Great Oxidation" Nature 443, 683-686 (12 October 2006) | doi:10.1038/nature05169

Manfred Schidlowski, Peter W. U. Appel, Rudolf Eichmann and Christian E. Junge
1979 "Carbon isotope geochemistry of the 3.7 × 109-yr-old Isua sediments, West Greenland: implications for the Archaean carbon and oxygen cycles" Geochim. Cosmochim. Acta 43, 189-199

Zahnle, Kevin, Laura Schaefer and Bruce Fegley
2010 “Earth's Earliest Atmospheres” Cold Spring Harbor Perspectives in Biology

Ozone with a reducing atmosphere;

Noll KS, Roush TL, Cruikshank DP, Johnson RE, Pendleton YJ.
1997 “Detection of ozone on Saturn's satellites Rhea and Dione. “ Nature 1997 Jul 3;388(6637):45-7

Additionally, UV shielding would only be needed in continental terrains;

Sagan, Carl, Christopher Chyba
1997  “The Early Faint Sun Paradox: Organic Shielding of Ultraviolet-Labile Greenhouse Gases” Science v. 276 (5316): 1217-1221

E. T. Wolf and O. B. Toon
2010 “Fractal Organic Hazes Provided an Ultraviolet Shield for Early Earth” Science 4 June 328: 1266-1268 [DOI: 10.1126/science.1183260]

Watanabe, Y., Martini, J.E.J., Ohmoto, H.
2000 “Geochemical evidence for terrestrial ecosystems 2.6 billion years ago.” letters, Nature, 408, 574-578 (2000).  (terrestrial bio by 2.6 to 2.7 Ga implies sufficient O2 for an biogenic Ozone UV shield)

But, an even better UV shield is ice. And, Ice is an excellent location for several key chemical steps;

Cleaves, H. James, Stanley L. Miller
1998 “Oceanic protection of prebiotic organic compounds from UV radiation” PNAS-USA v. 95, issue 13: 7260-7263

Bada, Jeffrey. L., C. Bigham, Stanley L. Miller
1994 “Impact melting of frozen oceans on the early Earth: Implications for the origin of life” PNAS-USA v.91: 1248-1250

BERNSTEIN, MP, JP DWORKIN, SA SANDFORD, GW COOPER &
LJ ALLAMANDOLA
2002 "Racemic amino acids from the ultraviolet photolysis of interstellar ice analogues"  Nature 416, 401 - 403 (2002)

Attwater, J., Wochner, A., & Holliger, P.
2013 "In-ice evolution of RNA polymerase ribozyme activity" Nature chemistry, 5(12), 1011-1018.

Bernstein, M. P. et al.  
1999 "UV irradiation of polycyclic aromatic hydrocarbons in ices: Production of alcohols, quinones, and ethers" Science 283, 1135–1138

Blank, J.G., Gregory H. Miller, Michael J. Ahrens, Randall E. Winans
2001 “Experimental shock chemistry of aqueous amino acid solutions and the cometary delivery of prebiotic compounds” Origins of Life and Evolution of the Biosphere 31(1-2):
15-51,

GM MUÑOZ CARO, UJ MEIERHENRICH, WA SCHUTTE, B BARBIER, A ARCONES SEGOVIA, H ROSENBAUER, WHP THIEMANN, A BRACK & JM GREENBERG
2002 "Amino acids from ultraviolet irradiation of interstellar ice analogues"  Nature 416, 403 - 406 (2002)

Miyakawa S, Cleaves HJ, Miller SL.
2002 "The cold origin of life: B. Implications based on pyrimidines and purines produced from frozen ammonium cyanide solutions" Orig Life Evol Biosph. 2002 Jun;32(3):209-18

Cleaves HJ, Nelson KE, Miller SL.
2006 "The prebiotic synthesis of pyrimidines in frozen solution" Naturwissenschaften. 2006 Mar 22

And, the final nail in this particular creationist fraud is that abiotic amino acid synthesis can happen in the presence of oxygen;

Cleaves, H. James, John H. Chalmers, Antonio Lazcano, Stanley L. Miller, Jeffrey L. Bada
2008 “A Reassessment of Prebiotic Organic Synthesis in Neutral Planetary Atmospheres” Orig Life Evol Biosph (2008) 38:105–115

So, to review; the Miller/Urey hypothesis was confirmed; the UV "problem" was not a problem.

Quote
The early earth had a reduced atmosphere. We know this in several ways. The most significant is geological data.


I don't think so.

http://reasonandscience.heavenforum.org/t1556-t....osphere

http://rstb.royalsocietypublishing.org/content....31.long

Even at ca 3.2 Ga, thick and widespread kerogenous shales are consistent with aerobic photoautrophic marine plankton, and U–Pb data from ca 3.8 Ga metasediments suggest that this metabolism could have arisen by the start of the geological record. Hence, the hypothesis that oxygenic photosynthesis evolved well before the atmosphere became permanently oxygenated seems well supported.

Michael Denton:

   "Ominously, for believers in the traditional organic soup scenario, there is no clear geochemical evidence to exclude the possibility that oxygen was present in the Earth's atmosphere soon after the formation of its crust."

Zircons have been identified that carry signatures identifying them with the Hadean – and zircons are remarkably stable once formed. Using zircons dated to almost 4.4 Ga, the researchers have analysed their redox state (a measure of the degree of oxygenation of the mineral). This gives a handle on the type of gases that would have been outgassed by the magmas, and so, according to these models of Earth history, the type of atmosphere that would have been formed.

  It is important to realise what was predicted by prevailing theories: the redox state of the magmas with which the zircons were associated was expected to be strongly reducing. This prediction is a necessary part of the Earth having a reducing atmosphere in the Hadean. The research findings did not confirm the prediction.
Harry Clemmey and Nick Badham, “Oxygen in the Precambrian Atmosphere: An Evaluation of the Geological Evidence,” Geology, 10, no. 3, (March 1982): 141.

  
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,20:16   

Quote (Otangelo @ Nov. 18 2015,20:04)
Non of the alternatives make sense to me :

Scientifically determined reality doesn't depend on some ignorant YEC's inability to comprehend it.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,20:20   

Quote (NoName @ Nov. 18 2015,18:44)
Why is abiogenesis impossible?

ah, want more proof. Here we go....

DNA is irreducible complex

http://reasonandscience.heavenforum.org/t2093-d....complex

Individual bases : take away the sugar in the DNA backbone = no function
Take away the phosphate in the backbone = no function
Take away the nucleic acid bases = no function
Evolution is not a driving force at this stage, since replication of the cell depends on DNA.
So the individual DNA molecules are irreducible complex
DNA in general ( the double helix )
Unless the two types, purines, and pyrimidines are present, and so the individual four bases = no function, and no hability of information storage
The enzymes and proteins for assembly and synthesis of the DNA structure must also be present, otherwise, no DNA double helix......

Origin of the DNA deoxyribonucleic acid  double helix

http://reasonandscience.heavenforum.org/t2028-o....e-helix

Self-organizing biochemical cycles 1

https://www.ncbi.nlm.nih.gov/pmc....MC18793

How were ribonucleotides first formed on the primitive earth? This is a very difficult problem. Stanley Miller's synthesis of the amino acids by sparking a reducing atmosphere (2) was the paradigm for prebiotic synthesis for many years, so at first, it was natural to suppose that similar methods would meet with equal success in the nucleotide field. However, nucleotides are intrinsically more complicated than amino acids, and it is by no means obvious that they can be obtained in a few simple steps under prebiotic conditions. A remarkable synthesis of adenine (3) and more or less plausible syntheses of the pyrimidine nucleoside bases (4) have been reported, but the synthesis of ribose and the regiospecific combination of the bases, ribose, and phosphate to give β-nucleotides remain problematical.

1) https://www.ncbi.nlm.nih.gov/pmc....MC18793

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,20:22   

Yeah, you don't understand "proof", either.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,20:28   

Quote (Otangelo @ Nov. 18 2015,20:20)
ah, want more proof. Here we go....

DNA is irreducible complex

You've already been shown how IC structures can evolve through natural processes.  Either you're really stupid or really dishonest, or both.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 18 2015,20:28   

Isn't it fascinating how he links to his own ramblings and to peer-reviewed research he's never read as if he is making some kind of point.

It's almost cute.

Did you ever actually read that Nature article I asked you about (that YOU posted)? The one that actually has a completely different conclusion than the one that was given to you... I mean, that you developed.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Occam's Aftershave



Posts: 1788
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,20:33   

Quote (OgreMkV @ Nov. 18 2015,20:28)
Isn't it fascinating how he links to his own ramblings and to peer-reviewed research he's never read as if he is making some kind of point.

It's almost cute.

Did you ever actually read that Nature article I asked you about (that YOU posted)? The one that actually has a completely different conclusion than the one that was given to you... I mean, that you developed.

He's also copied to his "library" a number of papers from Science and Nature in their entirety, in direct violation of their clearly spelled out copyright policy.

I wonder if we should drop a dime on him?   :p

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
  490 replies since Nov. 15 2015,11:01 < Next Oldest | Next Newest >  

Pages: (17) < 1 2 3 4 5 [6] 7 8 9 10 11 ... >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]