Printable Version of Topic

-Antievolution.org Discussion Board
+--Forum: After the Bar Closes...
+---Topic: Otangelo's thread started by Otangelo


Posted by: Otangelo on Nov. 15 2015,11:01

Quote (OgreMkV @ July 27 2015,11:56)
Kirk Dunstan has an amazing case of hypocrisy.

He posts about whether we should have faith in science here: < http://www.evolutionnews.org/2015.......51.html >

Of course, he completely fails to mention that ID fails all of the tests he mentions.
---------------------QUOTE-------------------




---------------------QUOTE-------------------
Of course, he completely fails to mention that ID fails all of the tests he mentions.
---------------------QUOTE-------------------



Does it ? Could you provide a list of ID predictions that failed ?

In my book, the picture looks  different

< http://reasonandscience.heavenforum.org/t1659-c....ictions >
Posted by: Occam's Aftershave on Nov. 15 2015,14:48

Quote (Otangelo @ Nov. 15 2015,11:01)
 
Quote (OgreMkV @ July 27 2015,11:56)
Kirk Dunstan has an amazing case of hypocrisy.

He posts about whether we should have faith in science here: < http://www.evolutionnews.org/2015.......51.html >

Of course, he completely fails to mention that ID fails all of the tests he mentions.
---------------------QUOTE-------------------


   

---------------------QUOTE-------------------
Of course, he completely fails to mention that ID fails all of the tests he mentions.
---------------------QUOTE-------------------



Does it ? Could you provide a list of ID predictions that failed ?

In my book, the picture looks  different

< http://reasonandscience.heavenforum.org/t1659-c....ictions >
---------------------QUOTE-------------------


ID hasn't made any predictions that are exclusive to "Design".  Every claimed ID prediction is actually a postdiction of events that are attributable to natural evolutionary processes.  Every.  Last.  One.

IDiots love to play at science.  They got tired of having no peer reviewed science articles so they created their own bogus IDiot journal, Bio-Complexity, so they could claim peer review.  They got tired of having no predictions so they made some simple observations and claimed they are predicted by ID.  Most are of the form "ID predicts the sky will be blue so a blue sky supports ID" worthless stupidity.

The simple fact is ID can't make any testable predictions unless and until they define the capabilities and limitations of their "Designer".  Of course they never will because their "Designer" is their omnipotent God who literally could produce anything.
Posted by: OgreMkV on Nov. 15 2015,15:07

Quote (Otangelo @ Nov. 15 2015,11:01)
Quote (OgreMkV @ July 27 2015,11:56)
Kirk Dunstan has an amazing case of hypocrisy.

He posts about whether we should have faith in science here: < http://www.evolutionnews.org/2015.......51.html >

Of course, he completely fails to mention that ID fails all of the tests he mentions.
---------------------QUOTE-------------------




---------------------QUOTE-------------------
Of course, he completely fails to mention that ID fails all of the tests he mentions.
---------------------QUOTE-------------------



Does it ? Could you provide a list of ID predictions that failed ?

In my book, the picture looks  different

< http://reasonandscience.heavenforum.org/t1659-c....ictions >
---------------------QUOTE-------------------


Complex systems can't evolve: Behe 1996
Of course, he's changed his mind and said that SOME complex system can't evolve. Of course, he's wrong.

More than two positive mutations in one gene are nearly impossible (also Behe). Failed. At least one example I know of shows that 4 clusters of positive mutations evolved in a single ribozyme in less than 72 hours.

If you will look very carefully, you will discover (as I have) that there is no mention of Junk DNA by any ID proponent until well after biologists have given evidence for it. Even further, they don't explain WHY ID predicts junk DNA... or no junk DNA.

Mutations cause organisms to degrade (many ID proponents). Total failure. It's trivial to show that many mutations are positive.

etc. etc. etc.
Posted by: Otangelo on Nov. 15 2015,18:18

Quote (Occam's Aftershave @ Nov. 15 2015,14:48)
Quote (Otangelo @ Nov. 15 2015,11:01)
their "Designer" is their omnipotent God who literally could produce anything.
---------------------QUOTE-------------------



Of course not.

Most people would say that part of God’s omnipotence is that he can “do anything.” But that’s not really true. It’s more precise to say that he has the power to do all things that power is capable of doing. Power can’t make an illogical statement logical; it can’t create, for example, a square circle. And while an omnipotent Creator can make beings who possess free will, he can’t do that while at the same time controlling their behavior. This would be a contradiction that “power” cannot overcome. In other words, God could prevent all wrongdoing from occurring, or even most of it, but he couldn’t do so without blocking or limiting or overriding our free will.

Furthermore, precisely the opposite of what evolution predicts, ID does. That is :

A vast amount of complex and specified information encoded in a biochemical language;
A computer-like system of commands and codes that processes the information.
Molecular machines and multi-machine systems.
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.
---------------------QUOTE-------------------


Quote (Otangelo @ Nov. 15 2015,11:01)
their "Designer" is their omnipotent God who literally could produce anything.
---------------------QUOTE-------------------



Of course not.

Most people would say that part of God’s omnipotence is that he can “do anything.” But that’s not really true. It’s more precise to say that he has the power to do all things that power is capable of doing. Power can’t make an illogical statement logical; it can’t create, for example, a square circle. And while an omnipotent Creator can make beings who possess free will, he can’t do that while at the same time controlling their behavior. This would be a contradiction that “power” cannot overcome. In other words, God could prevent all wrongdoing from occurring, or even most of it, but he couldn’t do so without blocking or limiting or overriding our free will.

Furthermore, precisely the opposite of what evolution predicts, ID does. That is :

A vast amount of complex and specified information encoded in a biochemical language;
A computer-like system of commands and codes that processes the information.
Molecular machines and multi-machine systems.
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.
Posted by: Otangelo on Nov. 15 2015,18:26

Quote (OgreMkV @ Nov. 15 2015,15:07)
[quote=OgreMkV,July 27 2015,11:56]

If you will look very carefully, you will discover (as I have) that there is no mention of Junk DNA by any ID proponent until well after biologists have given evidence for it. Even further, they don't explain WHY ID predicts junk DNA... or no junk DNA.

Mutations cause organisms to degrade (many ID proponents). Total failure. It's trivial to show that many mutations are positive.

etc. etc. etc.
---------------------QUOTE-------------------


Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? Or where are the transitional fossils prior the Cambrian explosion ? Or that genes and functional parts would  be re-used in different unrelated organisms ? Where are the millions of intermediate forms that should be there ? Did it predict that DNA repair mechanisms would be found ? Or that adaptation to the environment, aka micro change, would be a built in mechanism in the genome ?

These findings are all in line with what we expect to find if a intelligent creator were in play.... and we did.
Posted by: OgreMkV on Nov. 15 2015,18:38

Quote (Otangelo @ Nov. 15 2015,18:26)
[quote=OgreMkV,Nov. 15 2015,15:07]
Quote (OgreMkV @ July 27 2015,11:56)


If you will look very carefully, you will discover (as I have) that there is no mention of Junk DNA by any ID proponent until well after biologists have given evidence for it. Even further, they don't explain WHY ID predicts junk DNA... or no junk DNA.

Mutations cause organisms to degrade (many ID proponents). Total failure. It's trivial to show that many mutations are positive.

etc. etc. etc.
---------------------QUOTE-------------------


Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? Or where are the transitional fossils prior the Cambrian explosion ? Or that genes and functional parts would  be re-used in different unrelated organisms ? Where are the millions of intermediate forms that should be there ? Did it predict that DNA repair mechanisms would be found ? Or that adaptation to the environment, aka micro change, would be a built in mechanism in the genome ?

These findings are all in line with what we expect to find if a intelligent creator were in play.... and we did.
---------------------QUOTE-------------------


Let me explain something to you. Meyer is a liar. If you think that Precambrian fossils don't exist then you are ignorant of reality. The only question becomes, "Are you willing to learn?"

I personally spent about 9 months digging into the issue you mention in response to writings by ID proponent Meyer. Do you know what I found? Not that he was wrong, but that he purposefully lied in his book about what science says on those subjects.

How do I know he lied? Because that is only possible explanation for having so many papers misrepresented to be the exact opposite of what they actually said.

Now, here's the question again. Are you willing to learn?

I can provide you with about 25,000 words and about 75 peer-reviewed research papers that show that there are plenty of Pre-cambrian fossils, that explains the origin of the body plans (which are pre-cambrian, the millions of intermediate forms that you think don't exist, and what evolution actually is.

Do you want them, will you read them, and will you admit that you are wrong afterwards?

Finally, I would like to point out that you are demanding information, very specific information, when you cannot respond in kind about intelligent design.

Tell us, in detail, what does ID predict about DNA repair enzymes? Why? What part of ID results in that prediction?

You tell us, in detail, where does information in the ID paradigm come from? What evidence do you have that such a source exists? (And, please say "the design". Because circular logic is so much fun to play with.)

So, the ball is in your court. If you are willing to learn, I will happily explain to you, in detail, where ID proponents have lied to you. Are you tough enough to handle it? And can you respond to the same level of detail about your own pet notions?
Posted by: OgreMkV on Nov. 15 2015,18:39

Quote (Otangelo @ Nov. 15 2015,18:26)
These findings are all in line with what we expect to find if a intelligent creator were in play.... and we did.
---------------------QUOTE-------------------


Really? You've found an intelligent creator?

What is it? What did it do? When? When was the most recent time it acted? What tools does it use?

How do you know all of the above?
Posted by: Otangelo on Nov. 15 2015,19:40

Quote (OgreMkV @ Nov. 15 2015,18:38)

---------------------QUOTE-------------------


Quote (OgreMkV @ Nov. 15 2015,15:07)

It's trivial to show that many mutations are positive.
---------------------QUOTE-------------------



ah yah ? how so ? please explain.



---------------------QUOTE-------------------

Let me explain something to you. Meyer is a liar. If you think that Precambrian fossils don't exist then you are ignorant of reality. The only question becomes, "Are you willing to learn?"

I personally spent about 9 months digging into the issue you mention in response to writings by ID proponent Meyer. Do you know what I found? Not that he was wrong, but that he purposefully lied in his book about what science says on those subjects.

How do I know he lied? Because that is only possible explanation for having so many papers misrepresented to be the exact opposite of what they actually said.

Now, here's the question again. Are you willing to learn?

I can provide you with about 25,000 words and about 75 peer-reviewed research papers that show that there are plenty of Pre-cambrian fossils, that explains the origin of the body plans (which are pre-cambrian, the millions of intermediate forms that you think don't exist, and what evolution actually is.

Do you want them, will you read them, and will you admit that you are wrong afterwards?
---------------------QUOTE-------------------



I have read Meyer's book only partially. I know precambrian fossils exist. That is a non-issue. What does not exist, however, i repeat, are millions of intermediate fossils that should show a clear gradative increase of complexity in order to get to the cambrian fossils.

THESE DO NOT EXIST. Refute my claim, if you think i am wrong.

Example ? Show me the precursors of the Trilobite, and the trilobite eye.




---------------------QUOTE-------------------

Finally, I would like to point out that you are demanding information, very specific information, when you cannot respond in kind about intelligent design.

Tell us, in detail, what does ID predict about DNA repair enzymes? Why? What part of ID results in that prediction?

You tell us, in detail, where does information in the ID paradigm come from? What evidence do you have that such a source exists? (And, please say "the design". Because circular logic is so much fun to play with.)
---------------------QUOTE-------------------



Post-diction's, or adaptation of a theory, is common in science ==>> see the Big bang theory.

Truth being told, nobody really predicted DNA repair mechanisms.

The relevant question about them is : How are they best explained, through Design, or the ToE, or natural mechanisms ? ( since they had to emerge prior to life, since life depends on them, evolution is not even a viable option to explain their origin.

In my view, they are best explained through design.

I have a lengthy topic at my virtual library about the issue :

DNA repair mechanisms, designed with special care in order to provide integrity of DNA, and  essential for living organisms of all domains.


< http://reasonandscience.heavenforum.org/t2043-d....ir#3475 >

Maintaining the genetic stability that an organism needs for its survival requires not only an extremely accurate mechanism for replicating DNA, but also mechanisms for repairing the many accidental lesions that occur continually in DNA.

DNA damage is an alteration in the chemical structure of DNA, such as a break in a strand of DNA, a base missing from the backbone of DNA, or a chemically changed base.  Naturally occurring DNA damages arise more than 60,000 times per day per mammalian cell.   DNA damage appears to be a fundamental problem for life. DNA damages are a major primary cause of cancer. DNA damages give rise to mutations and epimutations. The mutations, if not corrected,  would be propagated throughout subsequent cell generations. Such a high rate of random changes in the DNA sequence would have disastrous consequences for an organism

Different pathways for DNA repair exists, Nucleotide excision repair (NER),  Base excision repair (BER),  DNA mismatch repair (MMR),  Repair through alkyltransferase-like proteins (ATLs) amongst others.

Its evident that the repair mechanism is essential for the cell to survive. It could not have evolved after life arose, but must have come into existence before. The mechanism is highly complex and elaborated, as consequence, the design inference is justified and seems to be the best way to explain its existence.

Base excision repair (BER)  involves a category of enzymes  known as  DNA-N-glycosylases.

One example of DNA's  automatic error-correction utilities are enough to stagger the imagination.  There are dozens of repair mechanisms to shield our genetic code from damage; one of them was portrayed in Nature  in terms that should inspire awe.

From Nature's article :
Structure of a repair enzyme interrogating undamaged DNA elucidates recognition of damaged DNA 11

How DNA repair proteins distinguish between the rare sites of damage and the vast expanse of normal DNA is poorly understood. Recognizing the mutagenic lesion 8-oxoguanine (oxoG) represents an especially formidable challenge, because this oxidized nucleobase differs by only two atoms from its normal counterpart, guanine (G).  The X-ray structure of the trapped complex features a target G nucleobase extruded from the DNA helix but denied insertion into the lesion recognition pocket of the enzyme. Free energy difference calculations show that both attractive and repulsive interactions have an important role in the preferential binding of oxoG compared with G to the active site. The structure reveals a remarkably effective gate-keeping strategy for lesion discrimination and suggests a mechanism for oxoG insertion into the hOGG1 active site.

Of the four bases in DNA (C, G, A, and T) cytosine or C is always supposed to pair with guanine, G, and adenine, A, is always supposed to pair with thymine, T.  The enzyme studied by Banerjee et al. in Nature is one of a host of molecular machines called BER glycosylases; this one is called human oxoG glycosylase repair enzyme (hOGG1), and it is specialized for finding a particular type of error: an oxidized G base (guanine).  Oxidation damage can be caused by exposure to ionizing radiation (like sunburn) or free radicals roaming around in the cell nucleus.  The normal G becomes oxoG, making it very slightly out of shape.  There might be one in a million of these on a DNA strand.  While it seems like a minor typo, it can actually cause the translation machinery to insert the wrong amino acid into a protein, with disastrous results, such as colorectal cancer.  12

The machine latches onto the DNA double helix and works its way down the strand, feeling every base on the way.  As it proceeds, it kinks the DNA strand into a sharp angle.  It is built to ignore the T and A bases, but whenever it feels a C, it knows there is supposed to be a G attached.  The machine has precision contact points for C and G.  When the C engages, the base paired to it is flipped up out of the helix into a slot inside the enzyme that is finely crafted to mate with a pure, clean G.  If all is well, it flips the G back into the DNA helix and moves on.  If the base is an oxoG, however, that base gets flipped into another slot further inside, where powerful forces yank the errant base out of the strand so that other machines can insert the correct one.

Now this is all wonderful stuff so far, but as with many things in living cells, the true wonder is in the details.  The thermodynamic energy differences between G and oxoG are extremely slight – oxoG contains only one extra atom of oxygen – and yet this machine is able to discriminate between them to high levels of accuracy.

The author, David, says in the Nature article :

Structural biology:  DNA search and rescue

DNA-repair enzymes amaze us with their ability to search through vast tracts of DNA to find subtle anomalies in the structure. The human repair enzyme 8-oxoguanine glycosylase (hOGG1) is particularly impressive in this regard because it efficiently removes 8-oxoguanine (oxoG), a damaged guanine (G) base containing an extra oxygen atom, and ignores undamaged bases.

Natural selection cannot act without accurate replication, yet the protein machinery for the level of accuracy required is itself built by the very genetic code it is designed to protect.  Thats a catch22 situation.  It would have been challenging enough to explain accurate transcription and translation alone by natural means, but as consequence of UV radiation, it  would have quickly been destroyed through accumulation of errors.  So accurate replication and proofreading are required for the origin of life. How on earth could proofreading enzymes emerge, especially with this degree of fidelity, when they depend on the very information that they are designed to protect?  Think about it....  This is one more prima facie example of chicken and egg situation. What is the alternative explanation to design ? Proofreading DNA by chance ?  And a complex suite of translation machinery without a designer?

I enjoy to learn about the wonder of these incredible mechanisms. If the apostle Paul could understand that creation demands a Creator as he wrote in Romans chapter one 18, how much more we today with all the revelations about cell biology and molecular machines?



---------------------QUOTE-------------------

So, the ball is in your court. If you are willing to learn, I will happily explain to you, in detail, where ID proponents have lied to you. Are you tough enough to handle it? And can you respond to the same level of detail about your own pet notions?
---------------------QUOTE-------------------



I am always keen to learn. It depends however, from who, and if i regard the information given as trust worthy, and the inferences drawn of the evidence compelling.

The same question goes to you. Are you willing to permit the evidence to lead wherever it is ? Even if it is towards the oposit direction that you wish ?
Posted by: Occam's Aftershave on Nov. 15 2015,20:12

Quote (Otangelo @ Nov. 15 2015,18:18)
       
Quote (Occam's Aftershave @ Nov. 15 2015,14:48)
 their "Designer" is their omnipotent God who literally could produce anything.
---------------------QUOTE-------------------

Of course not.
---------------------QUOTE-------------------



Then describe for us the powers and limitations of your Designer.  Tell us what discoveries would falsify the claim "A Designer did it".



---------------------QUOTE-------------------
Furthermore, precisely the opposite of what evolution predicts, ID does. That is :
---------------------QUOTE-------------------



Why do those things fall out of your ID claims when you admit you have no idea how a Designer would do things?  If we saw the exact opposite you'd claim the Designer did it too.



---------------------QUOTE-------------------
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.
---------------------QUOTE-------------------



Making analogies between human designed things and terms with naturally occurring objects isn't evidence for ID. Creationist FAIL.
Posted by: Occam's Aftershave on Nov. 15 2015,20:23

Quote (Otangelo @ Nov. 15 2015,19:40)

I have read Meyer's book only partially. I know precambrian fossils exist. That is a non-issue. What does not exist, however, i repeat, are millions of intermediate fossils that should show a clear gradative increase of complexity in order to get to the cambrian fossils.

THESE DO NOT EXIST. Refute my claim, if you think i am wrong.
---------------------QUOTE-------------------



Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.

Fossilization is extremely rare and gets even more rare the farther back in time you go.  Why do you IDiots think we should have a complete fossil record for events and creatures that existed around a billion years ago?  

 

---------------------QUOTE-------------------
The relevant question about them is : How are they best explained, through Design, or the ToE, or natural mechanisms ? ( since they had to emerge prior to life, since life depends on them, evolution is not even a viable option to explain their origin.

In my view, they are best explained through design.
---------------------QUOTE-------------------



The usual argument from personal incredulity.  "Gee, this is so complex I can't imagine how it evolved, therefore it must be designed".  Before you bore us even more do you have anything not based on your own ignorance or personal incredulity?  Any positive evidence for ID at all?
Posted by: Otangelo on Nov. 15 2015,20:45

Quote (Occam's Aftershave @ Nov. 15 2015,20:12)

---------------------QUOTE-------------------


Quote (Otangelo @ Nov. 15 2015,18:18)
 Then describe for us the powers and limitations of your Designer.  Tell us what discoveries would falsify the claim "A Designer did it".
---------------------QUOTE-------------------



I have explained that the designer cannot only tell the truth, and lie at the same time. Or create a square circle. He cannot do illogical things.

For instance, in order to top design, proponents of naturalism would have to be able to provide BETTER explanations in regard of all relevant questions of origins. So far, they have miserably failed.

For example:

< http://reasonandscience.heavenforum.org/t1279-a....le#1772 >

The total lack of any kind of experimental evidence leading even to re-creation of life; not to mention spontaneous emergence of life… is the most humiliating embracement to the evolutionists and the whole so-called “scientific establishment” around it…

One good start would be to be able to come up with a highly likely scenario of abiogenesis....



---------------------QUOTE-------------------

Why do those things fall out of your ID claims when you admit you have no idea how a Designer would do things?  If we saw the exact opposite you'd claim the Designer did it too.
---------------------QUOTE-------------------



Who told you i have no idea ?

How exactly did God create things ? what process was involved ?

< http://reasonandscience.heavenforum.org/t1794-h....nvolved >

Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.



---------------------QUOTE-------------------
Making analogies between human designed things and terms with naturally occurring objects isn't evidence for ID. Creationist FAIL.
---------------------QUOTE-------------------



Why is it fail ? because you wish so ?
Posted by: OgreMkV on Nov. 15 2015,20:46

Quote (Otangelo @ Nov. 15 2015,19:40)
I am always keen to learn. It depends however, from who, and if i regard the information given as trust worthy, and the inferences drawn of the evidence compelling.

The same question goes to you. Are you willing to permit the evidence to lead wherever it is ? Even if it is towards the oposit direction that you wish ?
---------------------QUOTE-------------------


Define a trustworthy source? Do you consider Nature trustworthy? You must since you used it.


Let me ask you a question. Name one ancestor in the maternal line from between 60 and 100 generation prior to yourself. If you can't, then how do you know you are human?

I guess we can be happy that you didn't cut and paste the entire FORUM POST. Tell, us, what is the nature article that is referred to in that post? Have you read it? Or is "Admin" a trustworthy source? If so, why?

Please explain, in your own words, how this article supports an ID inference.

OK, hit us with the evidence. Do what no ID proponent has ever done, hit us with the evidence.
Posted by: OgreMkV on Nov. 15 2015,20:56

Since you like Nature:
< http://www.nature.com/nature....a0.html >
The Late Precambrian fossil Kimberella is a mollusc-like bilaterian organism

Indeed, here's one of my blog posts with 19 references to precambrian fossils.  http://www.skepticink.com/smilodonsretreat/2013/10/22/a-survey-of-precambrian-animals/

Since 2012, Google Scholar reports 4000+ hits on Precambrian and fossils.

For example, here’s a new  Ediacaran organism that represents the oldest multielement organism with structural support through either biomineralization or chitin. < http://geology.gsapubs.org/content....7.short >

Here’s some prokaryote and eukaryote cells preserved in one billion year old lake sediments. < http://geology.gsapubs.org/content....7.short >

Here’s a new tubular Ediacaran fossil from India. < http://onlinelibrary.wiley.com/doi....d=false >

A discussion of the origin of Athropods, with 4 reference papers: < http://www.skepticink.com/smilodo....-part-2 >

Here's an excellent discussion on the lengths that ID authors go to ignore certain parts of a paper that would directly refute them if they read the whole thing: < http://www.skepticink.com/smilodo....er-mine >

Your turn. Explain, in detail, what you think ID is, how it works, and how you know so.

Now I expect a minimum of 25 peer-reviewed papers that you have read and can explain in your own words that support the ID notion that you accept.
Posted by: Otangelo on Nov. 15 2015,20:58

Quote (Occam's Aftershave @ Nov. 15 2015,20:23)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.
---------------------QUOTE-------------------



Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ? If they were not, why do proponents of evolution not change their mind ? maybe, because their position is not scientific, but rather religious after all ? What evidence would you accept that the ToE is false ? A cambrian rabbit ?

Michael Denton stated:

“It is still, as it was in Darwin's day, overwhelmingly true that the first representatives of all the major classes of organisms known to biology are already highly characteristic of their class when they make their initial appearance in the fossil record. This phenomenon is particularly obvious in the case of the invertebrate fossil record. At its first appearance in the ancient paleozoic seas, invertebrate life was already divided into practically all the major groups with which we are familiar today

anthropologist Edmund Ronald Leach stated:

“ Missing links in the sequence of fossil evidence were a worry to Darwin. He felt sure they would eventually turn up, but they are still missing and seem likely to remain so

One of the most famous proponents of evolution was the late Harvard paleontologist Stephen Jay Gould. But Gould admitted,

"The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology. We fancy ourselves as the only true students of life’s history, yet to preserve our favored account of evolution by natural selection, we view our data as so bad that we never see the very process we profess to study.

In a 1977 paper titled "The Return of Hopeful Monsters", Gould wrote:

"All paleontologists know that the fossil record contains precious little in the way of intermediate forms; transitions between major groups are characteristically abrupt.



---------------------QUOTE-------------------

Fossilization is extremely rare and gets even more rare the farther back in time you go.  Why do you IDiots think we should have a complete fossil record for events and creatures that existed around a billion years ago?  
---------------------QUOTE-------------------



Does the ToE also predict that we should find non-permineralized fossils, and collagen, and proteins preserved in fossils ? And carbon through C14 dating methods ? And if we find such things, is it not obvious and indicative that the dating methods are all bollocks, and fossils are rather young ?? Does that evidence not add to all the other, and provide a BIG blow to deep time nonsense assertions ?

< http://reasonandscience.heavenforum.org/t1767-c....e-young >



---------------------QUOTE-------------------
The usual argument from personal incredulity.  "Gee, this is so complex I can't imagine how it evolved, therefore it must be designed".  Before you bore us even more do you have anything not based on your own ignorance or personal incredulity?  Any positive evidence for ID at all?
---------------------QUOTE-------------------



Argument from incredulity

< http://reasonandscience.heavenforum.org/t1724-a....ty#2738 >

Incredulity is based on human experience and on what we actually know. For example, the belief in abiogenesis can be strongly doubted, one can be skeptical of it, because it has never been observed and all proposals have lead to a dead end so far. So its more than rational to look somewhere else.  What has been observed is biogenesis, life coming from life. What we know is that the complexity in the natural world of living organisms is similar to, in fact much greater than, the complexity of intelligently created devices, such as the clock or the computer. You might implie that incredulity is an unreasonable position, but it is in fact a foundation for all critical thought. Sensible people do not believe things without evidence. Consider the opposite, credulity; there is no context in which that is not a pejorative word! Considering what atheists are willing to believe, can indeed be classed as credulous.

It is also quite proper for a person of one religion or philosophy to be skeptical of the beliefs of another one. The religion of naturalism, which is the basis of evolution, can properly be rejected by a biblical theist. The evolutionist system may be dominant in some parts of the world, but that says nothing about whether it is true. Many have looked at it and found it inadequate; they have found good reasons to be skeptical of it, especially since theism better explains very many features of the natural world.

When i say that something is unbelievable or inconceivable,  i give good reasons. If my whole argument were simply an unsupported statement of unbelief, you would have a good point; to say something is unbelievable without giving a reason is not a good argument. But the problem is that you oversimplify; you do not address the reasons for incredulity.

Incredulity is an argument of scepticism about a certain point of view, and the evolutionist and atheist are not innocent of using such an argument. Incredulity, doubt and scepticism about God and special creation, are implicit in every naturalistic explanation  about abiogenesis and many other facets of their  view points.

This kind of arguments are frequent :

 how can a perfect deity create such a messed up world? (translation: it is inconceivable that a perfect deity could create such a messed up world, therefore, since evolution is a theory of messed-up, random natural forces and actions, it must be true)
 how can (a certain part of a living organism, e.g., the human eye) be designed when it has this mistake or that problem? (translation: it is inconceivable that an intelligent divine designer could create that supposedly malfunctioning part of the living organism; therefore it must have been formed through random, unintelligent, natural forces, i.e. evolution)

All of these arguments could be accurately classed as arguments of incredulity. If no reason is given, any argument from incredulity is weak.


When a person accuses opposing arguments of
incredulity when they are actually guilty of it themselves, (disbelieving and
being skeptical of what is true and repeatedly proven) and they make attempts
to evade the current evidence and observation instead of dealing with alleged
evidence by refuting it and acknowledging that it exists.
IOW, my argument is not in disbelieving what is objectively factual, it is
actually your argument that is doing this in the face of what we DO observe.



---------------------QUOTE-------------------
 Any positive evidence for ID at all?
---------------------QUOTE-------------------



< http://reasonandscience.heavenforum.org/t1983-i....norance >

We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems: we have positive experience-based knowledge of a cause that is sufficient to generate new specified information, namely, intelligence. We are not ignorant of how information arises. We know from experience that conscious intelligent agents can create informational sequences and systems. To quote Quastler again, "The creation of new information is habitually associated with conscious activity."2 Experience teaches that whenever large amounts of specified complexity or information are present in an artifact or entity whose causal story is known, invariably creative intelligence—intelligent design—played a role in the origin of that entity. Thus, when we encounter such information in the large biological molecules needed for life, we may infer—based on our knowledge of

established cause-and-effect relationships—that an intelligent cause operated in the past
to produce the specified information necessary to the origin of life.

For this reason, the design inference defended here does not constitute an argument from ignorance. Instead, it constitutes an "inference to the best explanation" based upon our best available knowledge. To establish an explanation as best, a historical scientist must cite positive evidence for the causal adequacy of a proposed cause. Indeed, unlike an argument from ignorance, an inference to the best explanation does not assert the adequacy of one causal explanation merely on the basis of the inadequacy of some other causal explanation. Instead, it asserts the superior explanatory power of a proposed cause based upon its proven—its known—causal adequacy and
based upon a lack of demonstrated efficacy among the competing proposed causes.
Posted by: Otangelo on Nov. 15 2015,21:05

Quote (OgreMkV @ Nov. 15 2015,20:46)
Quote (Otangelo @ Nov. 15 2015,19:40)
I am always keen to learn. It depends however, from who, and if i regard the information given as trust worthy, and the inferences drawn of the evidence compelling.

The same question goes to you. Are you willing to permit the evidence to lead wherever it is ? Even if it is towards the oposit direction that you wish ?
---------------------QUOTE-------------------


Define a trustworthy source? Do you consider Nature trustworthy? You must since you used it.


Let me ask you a question. Name one ancestor in the maternal line from between 60 and 100 generation prior to yourself. If you can't, then how do you know you are human?

I guess we can be happy that you didn't cut and paste the entire FORUM POST. Tell, us, what is the nature article that is referred to in that post? Have you read it? Or is "Admin" a trustworthy source? If so, why?

Please explain, in your own words, how this article supports an ID inference.

OK, hit us with the evidence. Do what no ID proponent has ever done, hit us with the evidence.
---------------------QUOTE-------------------


[/quote]Or is "Admin" a trustworthy source? If so, why?[/quote]

Just to clarify, i am the Admin of reasonandscience, which is my personal virtual library.
Posted by: Occam's Aftershave on Nov. 15 2015,21:09

Quote (Otangelo @ Nov. 15 2015,20:58)

   
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.
---------------------QUOTE-------------------


Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ?
---------------------QUOTE-------------------



Science has hundreds of well documented transitional sequences in the fossil record, far more than enough to confirm macroevolution.  Only an IDiot would demand that every last fossil in every last lineage be discovered.

(snip the Creationist IDiot quotes, the blatant quote-mining of Gould, the same stupid YEC PRATT claims about dino soft tissue and C-14 dating)

Do you have anything to add besides the usual ID-Creationist C&Ped stupidity?
Posted by: Otangelo on Nov. 15 2015,21:14

Quote (OgreMkV @ Nov. 15 2015,20:56)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Indeed, here's one of my blog posts with 19 references to precambrian fossils.  http://www.skepticink.com/smilodonsretreat/2013/10/22/a-survey-of-precambrian-animals/
---------------------QUOTE-------------------



I said previously, the problem is not the inexistence of precambrian fossils, but the missing intermediate ones.



---------------------QUOTE-------------------

Here’s some prokaryote and eukaryote cells preserved in one billion year old lake sediments. < http://geology.gsapubs.org/content....7.short >
---------------------QUOTE-------------------



Cool. Now explain to me how biomass can remain preserved for 1bio years, LOL........



---------------------QUOTE-------------------

A discussion of the origin of Athropods, with 4 reference papers: < http://www.skepticink.com/smilodo....-part-2 >
---------------------QUOTE-------------------



It would be interesting if you were able to explain on a molecular level, how you think new body parts, like legs, fins, wings etc emerged.

I wrote recently about the origin of tetrapods...

" Tetrapods evolved " . Really ?  

< http://reasonandscience.heavenforum.org/t2219-t....trapods >

Recently i saw following youtube video : < https://www.youtube.com/watch?v....vHYbZ9w >



I thought  how much brainpower was required to program and make these robots. In the natural world , according to proponents of naturalism, the required coordination and invention of new limbs was due just to random natural processes. That made me have a closer look what mainstream scientific papers have to say about the subject. How did the first limbs  of tetrapods emerge ? What mechanism is required to grow body parts like legs, and how do proponents of evolution explain the arise of tetrapods ?

According to proponents of evolution, tetrapods arose from a lineage of fish. This kind of dramatic change over time is called macroevolution.
The transition from life in water to life on land would have necessitated dramatic structural changes of the whole body to withstand the increased effects of gravity, amongst other new requirements.
Many aspects of tetrapod origins remain elusive. Its supposed evolution has generated great interest, but the earliest phases of their history are poorly understood. Recent studies have questioned long-accepted hypotheses about the origin of the pentadactyl limb, the phylogeny of tetrapods and the environment in which the first tetrapods lived.
The ‘earliest’ known tetrapods with feet and legs are now thought to have been aquatic animals; proponents of evolution  therefore argue that feet and legs evolved in a shallow water environment and were only later co-opted for use on the land.

Most discussions of the topic concentrate to elucidate if the fossil record permits to find transitional forms that permit infer a water to land transition. Not only are there hudge gaps, but the idea bears big problems conceptually, and as a whole.

< http://reasonandscience.heavenforum.org/t1808-t....ht=land >

Moreover, as Behe explained nicely : In order to say that some function is understood, every relevant step in the process must be elucidated. The relevant steps in biological processes occur ultimately at the molecular level, so a satisfactory explanation of a biological phenomenon such as the arise of tetrapods must include  how the transition occurred on a molecular explanation. It is no longer sufficient  for an ‘evolutionary explanation’ of that power to invoke only the anatomical structures of whole eyes, as Darwin did in the 19th century and as most popularizers of evolution continue to do today. Anatomy is, quite simply, irrelevant. So is the fossil record. It does not matter whether or not the fossil record is consistent with evolutionary theory, any more than it mattered in physics that Newton’s theory was consistent with everyday experience. The fossil record has nothing to tell us about, say, whether or how the interactions of 11-cis-retinal with rhodopsin, transducin, and phosphodiesterase could have developed step-by-step. Neither do the patterns of biogeography matter, or of population genetics, or the explanations that evolutionary theory has given for rudimentary organs or species abundance.

So rather than stick to anatomy comparisons of fossils that might bear some similarity that could be interpreted as intermediates and evolution of tetrapod limbs from fish fins , let us try to elucidate how significant the  functional and morphological shift was it in terms of the underlying genetic mechanisms . The fossil record provides insight into supposed  morphological changes. However, to understand the underlying mechanisms, we must peer into the gene regulatory networks of living vertebrates.

Do new anatomical structures arise de novo, or do they evolve from pre-existing structures? Advances in developmental genetics, palaeontology and evolutionary developmental biology have recently supposedly  shed light on the origins of  the structures that most intrigued Charles Darwin, including  tetrapod limbs. According to proponents of evolution, structures arose by the modification of pre-existing genetic regulatory circuits.

The genetic program instructs how to make new structures, but that program must be precisely programmed, and  the genetic regulatory circuits need also to be programmed . That is, two separate programs need to emerge, that is 1. the program which defines the physical form and structure, and 2. the program which instructs  where to find the genetic information in the genome, and when to express is during development, that is in the right sequence. That are different layers of information, which must exist fully developed in order to make the new anatomical parts  in question.

The instructions that control when and where a gene is expressed are written in the sequence of DNA bases located in the regulatory region of the gene. These instructions are written in a language that is often called the ‘gene regulatory code’. This code is read and interpreted by proteins called transcription factors that bind to specific sequences of DNA (or ‘DNA words’) and increase or decrease gene expression. Changes in gene expression between species could therefore be due to changes in the transcription factors and/or changes in the instructions within the regulatory regions of specific genes.

In order for communication to happen, 1. The sequence of DNA bases located in the regulatory region of the gene is required , and 2. transcription factors that read the code. If one of both is missing, communication fails, the gene that has to be expressed, cannot be encountered, and the whole procedure of gene expression fails. This is a irreducible complex system. The gene regulatory code could not arise in a step-wise manner either, since if that were the case, the code has only the right significance if fully developed.  Thats a example par excellence of intelligent design.

< http://reasonandscience.heavenforum.org/t2220-s....rmation >

During vertebrate limb development, Hoxd genes are transcribed in two temporal phases; an early wave controls growth and polarity up to the forearm and a late wave patterns the digits. In this issue of Developmental Cell, Tarchini and Duboule (2006) report that two opposite regulatory modules direct early collinear expression of Hoxd genes.

Question : how could natural mechanisms have programmed and directed the right temporal phases of gene transcription of the right genes,  and early wave control ? Furthermore, the limbs develop at the right place, the right coordinates and positional information is required, they could develop anywhere on the body. Did natural mechanisms find out about the right place by trial and error ? There were myriads of positions possible to add the limb. How could the right and precise coordination of axial position be achieved by mutations ?

The problem is that nature has too many options and without design couldn’t sort them all out. Natural mechanisms are too unspecific to determine any particular outcome. Mutation and natural selection could theoretically form a new complex morphological feature like a  leg or a limb with the right size and form , and arrange to find out the right body location to grow them , but it could  also produce all kinds of other new body forms, and grow and attach them anywhere on the body, most of which have no biological advantage or are most probably deleterious to the organism. Natural mechanisms have no constraints, they could produce any kind of novelty. Its however that kind of freedom that makes it extremely unlikely that mere natural developments provide new specific evolutionary arrangements that are advantageous to the organism.  Nature would have to arrange almost a infinite number of trials and errors until getting a new positive  arrangement. Since that would become a highly  unlikely event, design is a better explanation.

Going over through several mainstream scientific papers, i have not come across one of them, that were able to provide a detailed description how exactly the morphological transition could have occurred through evolution.

Some biologists have also envisioned special mutations in regulatory homeobox or "Hox" genes, where simple mutations might be able to make large developmental changes in an organism which might case a radically different phenotype. However, manipulating "Hox" genes does little to solve the problem of generating novel functional biostructures, for making large changes in phenotype are rarely beneficial. Hox gene mutations may be a more simple mechanism for generating large change, but they also do not escape the problem of the "hopeful monster":"The drawback for scientists is that nature's shrewd economy conceals enormous complexity. Researchers are finding evidence that the Hox genes and the non-Hox homeobox genes are not independent agents but members of vast genetic networks that connect hundreds, perhaps thousands, of other genes. Change one component, and myriad others will change as well--and not necessarily for the better. Thus dreams of tinkering with nature's toolbox to bring to life what scientists call a "hopeful monster"- such as a fish with feet--are likely to remain elusive."Furthermore, many biologists forget when invoking Hox gene mutations that Hox genes can only re-arrange parts which are already there--they cannot create truly novel structures.

Casey Luskin : Hox mutations will never create new "body part genes", and thus cannot add truly new phenotypic functions into the genome, and at best we are left with the quandaries associated with "pre-adaptation". The majority of evolutionary change must take place through evolving new "body part genes", which Hox mutations cannot do. One reviewer in Nature recognizes this fact:"Schwartz ignores the fact that homeobox genes are selector genes. They can do nothing if the genes regulated by them are not there. It is these genes that specify in detail the adaptive structure of the organs. To be sure, turning on a homeobox gene at the wrong place can result in the appearance of an ectopic organ, but only if the genes for that organ are present in the same individual. It is totally wrong to imply that an eye could be produced by a macromutation when no eye was ever present in the lineage before.
Posted by: Occam's Aftershave on Nov. 15 2015,21:15

Quote (Otangelo @ Nov. 15 2015,21:05)
Just to clarify, i am the Admin of reasonandscience, which is my personal virtual library.
---------------------QUOTE-------------------


I had a quick look through it.  Seems like you collected every last Creationist/IDiot bit of anti-science nonsense and outright lies posted on the web in the last decade.  It's the mother of all PRATT lists.  Heck, I bet it would even make the YEC C&P King Philip Cunningham (batshit77) envious.  :D
Posted by: Otangelo on Nov. 15 2015,21:22

Quote (Occam's Aftershave @ Nov. 15 2015,21:09)

---------------------QUOTE-------------------


Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Science has hundreds of well documented transitional sequences in the fossil record, far more than enough to confirm macroevolution.
---------------------QUOTE-------------------



I don't think so.

“In Chen’s view, his evidence supports a history of life that runs opposite to the standard evolutionary tree diagrams, a progression he calls top-down evolution.”
Jun-Yuan Chen is professor at the Nanjing Institute of Paleontology and Geology
< http://www.fredheeren.com/boston.....ton.htm >

The following quote is part of a personal letter from Colin Patterson to Luther Sunderland:

      "I fully agree with your comments on the lack of direct illustration of evolutionary transitions in my book. If I knew of any, fossil or living, I would certainly have included them. . .I will lay it on the line, There is not one such fossil for which one might make a watertight argument."

      Dr. Colin Patterson, senior paleontologist at the British Museum of Natural History. The quote is from a personal letter dated 10th April 1979 from Dr. Patterson to creationist Luther D. Sunderland and is referring to Dr. Patterson's book "Evolution" (1978, Routledge & Kegan Paul Ltd.).


More, Louis T. [late Professor of Physics, University of Cincinnati, USA], "The Dogma of Evolution," Princeton University Press: Princeton NJ, 1925, Second Printing, p.160.

"The more one studies palaeontology, the more certain one becomes that evolution is based on faith alone; exactly the same sort of faith which it is necessary to have when one encounters the great mysteries of religion."

[QUOTE][(snip the Creationist IDiot quotes, the blatant quote-mining of Gould, the same stupid YEC PRATT claims about dino soft tissue and C-14 dating)/QUOTE]

If soft tissue  and non permineralized fossils, beside carbon C14 dating is not evidence for young fossils, then i don't know what is.....

Beside this :

The relevant steps in biological processes occur ultimately at the molecular level

< http://www.uncommondescent.com/intelli....details >

In order to say that some function is understood, every relevant step in the process must be elucidated. The relevant steps in biological processes occur ultimately at the molecular level, so a satisfactory explanation of a biological phenomenon such as sight, or digestion, or immunity, must include a molecular explanation. It is no longer sufficient, now that the black box of vision has been opened, for an ‘evolutionary explanation’ of that power to invoke only the anatomical structures of whole eyes, as Darwin did in the 19th century and as most popularizers of evolution continue to do today. Anatomy is, quite simply, irrelevant. So is the fossil record. It does not matter whether or not the fossil record is consistent with evolutionary theory, any more than it mattered in physics that Newton’s theory was consistent with everyday experience. The fossil record has nothing to tell us about, say, whether or how the interactions of 11-cis-retinal with rhodopsin, transducin, and phosphodiesterase could have developed step-by-step. Neither do the patterns of biogeography matter, or of population genetics, or the explanations that evolutionary theory has given for rudimentary organs or species abundance.

The point which Professor Behe makes for vision applies equally to macroevolution as a whole. The relevant steps in macroevolutionary processes occur ultimately at the molecular level, so a satisfactory explanation of macroevolution must include a molecular explanation.

If, for some reason, certain macroevolutionary transitions appear to be highly improbable from a chemical standpoint, then that in itself is a good reason to be skeptical of the view that Darwin’s theory of evolution is an all-inclusive theory of biology.

(Why Evolution Is True. 2009. Oxford University Press, Glossary, pp. 268-269).

Macroevolution has also been defined by Professor Jerry Coyne as “large changes in body form or the evolution of one type of plant or animal from another type”

Evolutionary change occurs on different scales: ‘microevolution’ is generally equated with events at or below the species level whereas ‘macroevolution’ is change above the species level, including the formation of species.

< http://www.evolutionnews.org/2014....61.html >

In nature, evolution occurs at the molecular level of specific, individual mutations, so it is there we must look to evaluate possible evolutionary paths. Studies with less detail can say very little on the topic.

Behe, Darwins Black Box, pg.38:
Other ages have been unable to answer many questions that interested them. Furthermore, because we can't yet evaluate the question of eye evolution or beetle evolution does not mean we can't evaluate Darwinism's claims for any biological structure. When we descend from the level of a whole animal (such as a beetle) or whole organ (such as an eye) to the molecular level, then in many cases we can make a judgment on evolution because all of the parts of many discrete molecular systems are known.
Posted by: Occam's Aftershave on Nov. 15 2015,21:25

Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?
Posted by: Otangelo on Nov. 15 2015,21:26

Quote (Occam's Aftershave @ Nov. 15 2015,21:15)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
I had a quick look through it.
---------------------QUOTE-------------------



Thats a good way to form a prejudice.

Rather than simply copy others say, i mostly educate myself in regard of how specially molecular biological systems work through mainstream books like Molecular biology of the cell, of Bruce Alberts, and from there on infer what best explains their origins.
Posted by: Occam's Aftershave on Nov. 15 2015,21:29

Quote (Otangelo @ Nov. 15 2015,21:22)

     
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Science has hundreds of well documented transitional sequences in the fossil record, far more than enough to confirm macroevolution.
---------------------QUOTE-------------------



I don't think so.
---------------------QUOTE-------------------


No one gives a shit what you think.  The transitional fossils sequences exist and all the C&Ped quote-mined quotes and IDiot denials in the world won't change that.  If you don't have a better explanation for the physical evidence you've got nothing.
Posted by: Otangelo on Nov. 15 2015,21:30

Quote (Occam's Aftershave @ Nov. 15 2015,21:25)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?
---------------------QUOTE-------------------



I copy from my library, and i copy what i elaborated and inferred from the scientific evidence i am encountering .......
Posted by: Otangelo on Nov. 15 2015,21:34

Quote (Occam's Aftershave @ Nov. 15 2015,21:29)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
The transitional fossils sequences exist
---------------------QUOTE-------------------



1. Similarities does not support evolution. It does prove they look similar.
Similarities has nothing to do with evolution, because it does not prove they came from a the same biological descendant. Because they look similar means they look similar, it does not mean they evolved from simpler life forms.

2. The very fossil evidence that you claim as an evidence in support of evolution in fact defies lending a support. palentologists say that not a single fossil supports the evolution of a single species. Only three prominent sequences. (!) whale (2) horse (3) elephant are said to have been verified through fossils. But each of these sequences have been seriously questioned in literature. The fossils DO NOT SHOW a nearly continous gradation of change over long span of years. but fully developed organisms appear in the fossils entirely discrete and unique with minimal links. No explanations to the mechanism behind the morphological changes that are needed to convert a land trotting mammal to a LIVING SUBMARINE-LIKE WHALE. Questions are galore that the theory of evolution cannot answer or even explain with suiffcient evidence. 
Posted by: Occam's Aftershave on Nov. 15 2015,21:35

Quote (Otangelo @ Nov. 15 2015,21:30)
 
Quote (Occam's Aftershave @ Nov. 15 2015,21:25)
Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?
---------------------QUOTE-------------------



I copy from my library, and i copy what i elaborated and inferred from the scientific evidence i am encountering .......
---------------------QUOTE-------------------


I take it your answer is no, you can't manage a coherent argument with support from the primary scientific literature.

What a surprise.  ;)
Posted by: OgreMkV on Nov. 15 2015,21:46

Quote (Otangelo @ Nov. 15 2015,20:58)
Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ? If they were not, why do proponents of evolution not change their mind ? maybe, because their position is not scientific, but rather religious after all ? What evidence would you accept that the ToE is false ? A cambrian rabbit ?


---------------------QUOTE-------------------

Actually, they have been found. Quite a bit of them. But you won't find that in creationist literature.

Of course, one thing that evolution does do, is make predictions. For example, the location, time period, and type of fossils that might be found there. Which, not only has been done dozens of times, but there are some excellent stories written for the casual writer... for example, Shubin's "Your Inner Fish".

Name a time when ID or creationism was used to predict the location, time period, and type of fossil.
 

---------------------QUOTE-------------------


Michael Denton stated:

“It is still, as it was in Darwin's day, overwhelmingly true that the first representatives of all the major classes of organisms known to biology are already highly characteristic of their class when they make their initial appearance in the fossil record. This phenomenon is particularly obvious in the case of the invertebrate fossil record. At its first appearance in the ancient paleozoic seas, invertebrate life was already divided into practically all the major groups with which we are familiar today


---------------------QUOTE-------------------

Oh good. Argument by authority. Sadly, I disagree with Denton. Just out of curiosity, do you refer to biochemists for all your paleontology research?

Anyway. This thinking is completely backward. All the major groups were invented by Linneaus and, as far as I'm concerned, is a terrible idea. It's like we have defined styles of cars now, but now we have to try and fit the Cugnot Steam Trolley into our modern classification system. Is it an F1, SUV, sedan?
 

---------------------QUOTE-------------------


anthropologist Edmund Ronald Leach stated:

“ Missing links in the sequence of fossil evidence were a worry to Darwin. He felt sure they would eventually turn up, but they are still missing and seem likely to remain so


---------------------QUOTE-------------------


What the hell does Darwin have to do with anything?

Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution. None of which support any notion of ID. These papers are as far beyond Darwin could even imagine as my cell phone is to a Victorian detective.
 

---------------------QUOTE-------------------


One of the most famous proponents of evolution was the late Harvard paleontologist Stephen Jay Gould. But Gould admitted,

"The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology. We fancy ourselves as the only true students of life’s history, yet to preserve our favored account of evolution by natural selection, we view our data as so bad that we never see the very process we profess to study.


---------------------QUOTE-------------------


Seriously? Your going to use one of the world's most famous evolutionary biologists and paleontologists to attack evolution. The guy who literally wrote the book on it?

You aren't too bright are you?

Of course, you might continue with the rest of the quote. I hate quoteminers and you seem to be doing a smashing job so far.

The rest of the quote
 

---------------------QUOTE-------------------
Darwin's argument still persists as the favored escape of most paleontologists from the embarrassment of a record that seems to show so little of evolution [directly]. In exposing its cultural and methodological roots, I wish in no way to impugn the potential validity of gradualism (for all general views have similar roots). I only wish to point out that it is never "seen" in the rocks.

Paleontologists have paid an exorbitant price for Darwin's argument. We fancy ourselves as the only true students of life's history, yet to preserve our favored account of evolution by natural selection we view our data as so bad that we never see the very process we profess to study.

For several years, Niles Eldredge of the American Museum of Natural History and I have been advocating a resolution to this uncomfortable paradox. We believe that Huxley was right in his warning [1]. The modern theory of evolution does not require gradual change. In fact, the operation of Darwinian processes should yield exactly what we see in the fossil record. [It is gradualism we should reject, not Darwinism.]
---------------------QUOTE-------------------



 

---------------------QUOTE-------------------


In a 1977 paper titled "The Return of Hopeful Monsters", Gould wrote:

"All paleontologists know that the fossil record contains precious little in the way of intermediate forms; transitions between major groups are characteristically abrupt.


---------------------QUOTE-------------------


Again, another quote mine. You might want to continue the quote...
 

---------------------QUOTE-------------------

But all theories of discontinuous change are not anti-Darwinian, as Huxley pointed out nearly 120 years ago. Suppose that a discontinuous change in adult form arises from a small genetic alteration. Problems of discordance with other members of the species do not arise, and the large, favorable variant can spread through a population in Darwinian fashion. Suppose also that this large change does not produce a perfected form all at once, but rather serves as a "key" adaptation to shift its possessor toward a new mode of life. Continued success in this new mode may require a large set of collateral alterations, morphological and behavioral; these may arise by a more traditional, gradual route once the key adaptation forces a profound shift in selective pressures.
---------------------QUOTE-------------------



 

---------------------QUOTE-------------------


 

---------------------QUOTE-------------------

Fossilization is extremely rare and gets even more rare the farther back in time you go.  Why do you IDiots think we should have a complete fossil record for events and creatures that existed around a billion years ago?  
---------------------QUOTE-------------------



Does the ToE also predict that we should find non-permineralized fossils, and collagen, and proteins preserved in fossils ? And carbon through C14 dating methods ? And if we find such things, is it not obvious and indicative that the dating methods are all bollocks, and fossils are rather young ?? Does that evidence not add to all the other, and provide a BIG blow to deep time nonsense assertions ?

[URL=http://reasonandscience.heavenforum.org/t1767-carbon-14-dated-dinosaur-bones-and-non-permineralized-soft-tissue-evidences-fossils-



are-young]http://reasonandscience.heavenforum.org/t1767-c....e-young[/URL]


---------------------QUOTE-------------------


Let me guess... "triceratops horns" that come from strata with bison horns and actually look a lot like bison horns. sigh
 

---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
The usual argument from personal incredulity.  "Gee, this is so complex I can't imagine how it evolved, therefore it must be designed".  Before you bore us even more do you have anything not based on your own ignorance or personal incredulity?  Any positive evidence for ID at all?
---------------------QUOTE-------------------



Argument from incredulity

< http://reasonandscience.heavenforum.org/t1724-a....ty#2738 >

Incredulity is based on human experience and on what we actually know. For example, the belief in abiogenesis can be strongly doubted, one can be skeptical of it, because it has never been observed and all proposals have lead to a dead end so far.

---------------------QUOTE-------------------



Wrong. Abiogenesis is an extremely well studied subject. One in which every single molecule and system needed for life has been observed to occur without an intelligent agent given the right conditions.

Of course, I'll just add, how hypocritical of you this particular thing is... since you demand life from scratch, yet have utterly failed to even begin to support the idea of ID.

Here's a hint. Even if you were to prove evolution 100% totally wrong, right now... it still doesn't make ID true. Only positive supporting evidence can do that and you don't have any. I know that because if you did, you would have published it and have gotten the Nobel prize.

BTW: Are you also GIBHOR, banned from the international skeptics forum? If not, then you are plagiarizing him and that's not right either.

Are you also GodExists, banned from the thethinkingatheist forum? If not, then you are plagiarizing him too.

 

---------------------QUOTE-------------------


So its more than rational to look somewhere else.  What has been observed is biogenesis, life coming from life.

---------------------QUOTE-------------------



That's true. But that has nothing to do with before there was life on Earth does it? We know that there a period with no life. And we know there was a period with life. We know that a large variety of chemical reactions results in concentrations of chemicals that can self-assemble into complex long chain structures, that even have the ability to self-reproduce.

What's your explanation and what is the evidence for it.

Just because something is complex doesn't mean it needs a designer. That's an anthropomorphic assumption on your part and it's a false assumption that you are NOT THINKING CRITICALLY about.
 

---------------------QUOTE-------------------


What we know is that the complexity in the natural world of living organisms is similar to, in fact much greater than, the complexity of intelligently created devices, such as the clock or the computer.

You might implie that incredulity is an unreasonable position, but it is in fact a foundation for all critical thought. Sensible people do not believe things without evidence. Consider the opposite, credulity; there is no context in which that is not a pejorative word! Considering what atheists are willing to believe, can indeed be classed as credulous.


---------------------QUOTE-------------------


You are absolutely correct. SO, provide the evidence for your claims that ID is valid. We're all waiting.

So far, I've shown that your claims are very much not correct. Therefore, you claims about evolution are not valid. This is supported by evidence (ignoring the actual fossil record, purposefully misquoting people, etc).
 

---------------------QUOTE-------------------


It is also quite proper for a person of one religion or philosophy to be skeptical of the beliefs of another one. The religion of naturalism, which is the basis of evolution, can properly be rejected by a biblical theist. The evolutionist system may be dominant in some parts of the world, but that says nothing about whether it is true. Many have looked at it and found it inadequate; they have found good reasons to be skeptical of it, especially since theism better explains very many features of the natural world.


---------------------QUOTE-------------------


You can reject naturalism all you want. Hypocrite.

But if you do, then you should be living in a cave, eating carrion and rotten fruit. But you aren't. You're enjoying the results of all that naturalistic thinking all the while complaining about it.
 

---------------------QUOTE-------------------



When i say that something is unbelievable or inconceivable,  i give good reasons. If my whole argument were simply an unsupported statement of unbelief, you would have a good point; to say something is unbelievable without giving a reason is not a good argument. But the problem is that you oversimplify; you do not address the reasons for incredulity.

Incredulity is an argument of scepticism about a certain point of view, and the evolutionist and atheist are not innocent of using such an argument. Incredulity, doubt and scepticism about God and special creation, are implicit in every naturalistic explanation  about abiogenesis and many other facets of their  view points.

---------------------QUOTE-------------------



Great. Provide the evidence that god exists and I will accept him. But it'll take a lot of evidence.

SNIP

Here's the deal. No one here cares about your god. And, if you use god as a basis for your science, then it can never be taught in a school. Thanks for that own goal, BTW/

 

---------------------QUOTE-------------------


We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems: we have positive experience-based knowledge of a cause that is sufficient to generate new specified information, namely, intelligence.

---------------------QUOTE-------------------


So what?
 

---------------------QUOTE-------------------

We are not ignorant of how information arises. We know from experience that conscious intelligent agents can create informational sequences and systems.

---------------------QUOTE-------------------


So what?
 

---------------------QUOTE-------------------

To quote Quastler again, "The creation of new information is habitually associated with conscious activity."

---------------------QUOTE-------------------


But not ALL the time and that's where the entire argument fails.
 

---------------------QUOTE-------------------

Experience teaches that whenever large amounts of specified complexity

---------------------QUOTE-------------------


Define this term. Use math.
 

---------------------QUOTE-------------------


or information


---------------------QUOTE-------------------


Define this term. Use math.
 

---------------------QUOTE-------------------


are present in an artifact or entity whose causal story is known, invariably creative intelligence—intelligent design—played a role in the origin of that entity. Thus, when we encounter such information in the large biological molecules needed for life, we may infer—based on our knowledge of established cause-and-effect relationships—that an intelligent cause operated in the past
to produce the specified information necessary to the origin of life.


---------------------QUOTE-------------------


And that's the leap that cause the entire argument to fail.

Just because intelligence CAN do so, doesn't mean that intelligence is REQUIRED to do so.

Further we need evidence that an intelligence CAN do so is required, because no known intelligence can do that.



---------------------QUOTE-------------------


For this reason, the design inference defended here does not constitute an argument from ignorance. Instead, it constitutes an "inference to the best explanation" based upon our best available knowledge. To establish an explanation as best, a historical scientist must cite positive evidence for the causal adequacy of a proposed cause. Indeed, unlike an argument from ignorance, an inference to the best explanation does not assert the adequacy of one causal explanation merely on the basis of the inadequacy of some other causal explanation. Instead, it asserts the superior explanatory power of a proposed cause based upon its proven—its known—causal adequacy and based upon a lack of demonstrated efficacy among the competing proposed causes.
---------------------QUOTE-------------------


And it's all so much bullshit.

But thanks for recycling an argument that has been defunct for over a century now.
Posted by: Otangelo on Nov. 15 2015,21:47

Quote (Occam's Aftershave @ Nov. 15 2015,21:35)
Quote (Otangelo @ Nov. 15 2015,21:30)
 
Quote (Occam's Aftershave @ Nov. 15 2015,21:25)
Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?
---------------------QUOTE-------------------



I copy from my library, and i copy what i elaborated and inferred from the scientific evidence i am encountering .......
---------------------QUOTE-------------------


I take it your answer is no, you can't manage a coherent argument with support from the primary scientific literature.

What a surprise.  ;)
---------------------QUOTE-------------------




---------------------QUOTE-------------------

I take it your answer is no, you can't manage a coherent argument with support from the primary scientific literature.

What a surprise.  ;)
---------------------QUOTE-------------------



Feel free to substantiate your assertion.
Posted by: OgreMkV on Nov. 15 2015,21:47

"Cool. Now explain to me how biomass can remain preserved for 1bio years, LOL........"

If you think minerilization doesn't occur, you really need to learn some stuff before even attempting this.
Posted by: Occam's Aftershave on Nov. 15 2015,21:48

Quote (Otangelo @ Nov. 15 2015,21:34)

1. Similarities does not support evolution. It does prove they look similar.
Similarities has nothing to do with evolution, because it does not prove they came from a the same biological descendant. Because they look similar means they look similar, it does not mean they evolved from simpler life forms.
---------------------QUOTE-------------------



The morphological similarities combined with the physical /temporal distribution of the fossils create a distinct phylogenetic tree.  This same phylogenetic tree also emerges from the genetic record of extant animals.  Taken together they're conclusive evidence for macroevolution over deep time.



---------------------QUOTE-------------------
2. The very fossil evidence that you claim as an evidence in support of evolution in fact defies lending a support. palentologists say that not a single fossil supports the evolution of a single species. Only three prominent sequences. (!) whale (2) horse (3) elephant are said to have been verified through fossils. But each of these sequences have been seriously questioned in literature.
---------------------QUOTE-------------------



What a crock.  We've got sequences for the sirenians, and for the giraffidae, and felidae, and canidae, and dozens of other well known families.  Your credibility is zero.



---------------------QUOTE-------------------
The fossils DO NOT SHOW a nearly continous gradation of change over long span of years. but fully developed organisms appear in the fossils entirely discrete and unique with minimal links.
---------------------QUOTE-------------------



(facepalm) what would a half-developed animal look like?



---------------------QUOTE-------------------
No explanations to the mechanism behind the morphological changes that are needed to convert a land trotting mammal to a LIVING SUBMARINE-LIKE WHALE.
---------------------QUOTE-------------------



Of course we know of the evolutionary mechanisms and have even mapped most of the major genetic changes.  Where are you getting this nonsense?
Posted by: Occam's Aftershave on Nov. 15 2015,21:52

Quote (Otangelo @ Nov. 15 2015,21:47)
Feel free to substantiate your assertion.
---------------------QUOTE-------------------


That you can't manage a coherent argument with support from the primary scientific literature?

That's easy enough.  I'll just wait here while you sputter and bluster and C&P more Creationist crap without ever once making a coherent argument with support from the primary scientific literature.   You'll demonstrate for me.  :)
Posted by: OgreMkV on Nov. 15 2015,21:58

Quote (Otangelo @ Nov. 15 2015,21:34)
[quote=Occam's Aftershave,Nov. 15 2015,21:29][/quote]


---------------------QUOTE-------------------
The transitional fossils sequences exist
---------------------QUOTE-------------------



1. Similarities does not support evolution. It does prove they look similar.
Similarities has nothing to do with evolution, because it does not prove they came from a the same biological descendant. Because they look similar means they look similar, it does not mean they evolved from simpler life forms.

2. The very fossil evidence that you claim as an evidence in support of evolution in fact defies lending a support. palentologists say that not a single fossil supports the evolution of a single species. Only three prominent sequences. (!) whale (2) horse (3) elephant are said to have been verified through fossils. But each of these sequences have been seriously questioned in literature. The fossils DO NOT SHOW a nearly continous gradation of change over long span of years. but fully developed organisms appear in the fossils entirely discrete and unique with minimal links. No explanations to the mechanism behind the morphological changes that are needed to convert a land trotting mammal to a LIVING SUBMARINE-LIKE WHALE. Questions are galore that the theory of evolution cannot answer or even explain with suiffcient evidence. 
---------------------QUOTE-------------------


You really don't understand how this works do you?

I once had an ID proponent try to argue that moles and certain insect could be related because the looked similar. They both have big claws on the front used for digging. Yes, let's completely ignore the VAST array of evidence that doesn't support relatedness (reproduction method, growth method, non-digging anatomy, biochemical structures, etc. etc. etc.). Let's just focus on that one thing.

Dude, the people who do this work aren't looking at a dinosaur and a bird and saying "They look similar so they must be related". There is a significant amount of work that goes into a claim like that... with significant amounts of evidence. But don't let that change your mind. I'd hate for you to actually think about evidence.

I will continue to note that you have not responded in a positive way to any of the questions I've asked.

If you need a list, I will provide it.

But again, how can you prove you are human if you don't know any of your ancestors 60 generations ago? Without that, you can't know that you aren't the result of aliens, monkeys, neanderthals, or whatever.

Yes, it's a stupid argument... and you are using the exact same argument.

About whales. Answer this question... What defines a cetacean?
Posted by: Otangelo on Nov. 15 2015,22:09

Quote (OgreMkV @ Nov. 15 2015,21:46)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Wrong. Abiogenesis is an extremely well studied subject. One in which every single molecule and system needed for life has been observed to occur without an intelligent agent given the right conditions.
---------------------QUOTE-------------------



haha. Thats precious...




---------------------QUOTE-------------------
Here's a hint. Even if you were to prove evolution 100% totally wrong, right now... it still doesn't make ID true.
---------------------QUOTE-------------------



A Positive, Testable Case for Intelligent Design

< http://www.evolutionnews.org/2011....11.html >



---------------------QUOTE-------------------

BTW: Are you also GIBHOR, banned from the international skeptics forum? If not, then you are plagiarizing him and that's not right either.

Are you also GodExists, banned from the thethinkingatheist forum? If not, then you are plagiarizing him too.  
---------------------QUOTE-------------------



Yes, i am both.



---------------------QUOTE-------------------

That's true. But that has nothing to do with before there was life on Earth does it? We know that there a period with no life. And we know there was a period with life. We know that a large variety of chemical reactions results in concentrations of chemicals that can self-assemble into complex long chain structures, that even have the ability to self-reproduce.
---------------------QUOTE-------------------



No, we do not know that.

No evidence that RNA molecules ever had the broad range of catalytic activities

< http://reasonandscience.heavenforum.org/t2024-t....fe#3415 >

OOL theorist Leslie Orgel notes that

an "RNA World" could only form the basis for life, "if prebiotic RNA had two properties not evident today: a capacity to replicate without the help of proteins and an ability to catalyze every step of protein synthesis." The RNA world is thus a hypothetical system behind which there is little positive evidence, and much materialist philosophy: "The precise events giving rise to the RNA world remain unclear … investigators have proposed many hypotheses, but evidence in favor of each of them is fragmentary at best. The full details of how the RNA world, and life, emerged may not be revealed in the near future.

The best claimed evidence of an "RNA World" includes the fact that there are RNA enzymes and genomes, and that cells use RNA to convert the DNA code into proteins. However, RNA plays only a supporting role in the cell, and there is no known biochemical system completely composed of RNA.

RNA experts have created a variety of RNA molecules which can perform biochemical functions through what is commonly termed "test tube evolution." However, "test tube evolution" is just a description for what is in reality nothing more than chemical engineering in the laboratory employing Darwinian principles; that does not imply that there is some known pathway through which these molecules could arise naturally.

In order a molecule to be a self replicator , it has to be a homopolymer, of which the backbone must have the same repetitive units; they must be identical. On the prebiotic world, the generation of a homopolymer was however impossible.

Steven A. Benner, Ph.D. Chemistry, Harvard, prominent origin-of-life researcher and creator of the Foundation for Applied Molecular Evolution, was posted on Huffington Post on December 6, 2013.  In it he said,

"We have failed in any continuous way to provide a recipe that gets from the simple molecules that we know were present on early Earth to RNA."

That lead Leslie Orgel to say :

It would take a miracle if a strand of RNA ever appeared on the primitive Earth.

(Dover, 1999, p. 218).

I would have thought it relevant to point out for biologists in general that not one self-replicating RNA has emerged to date from quadrillions (1024) of artificially synthesized, random RNA sequences

How  could the first living cells with DNA-based molecular biology have originated by spontaneous chemical processes on the prebiotic Earth? Primordial DNA synthesis would have required the presence of specific enzymes, but how could these enzymes be synthesized without the genetic information in DNA and without RNA for translating that information into the amino acid sequence of the protein enzymes? In other words, proteins are required for DNA synthesis and DNA is required for protein synthesis.

This classic "chicken-and-egg" problem made it immensely difficult to conceive of any plausible prebiotic chemical pathway to the molecular biological system. Certainly no such chemical pathway had been demonstrated




---------------------QUOTE-------------------

What's your explanation and what is the evidence for it.

Just because something is complex doesn't mean it needs a designer. That's an anthropomorphic assumption on your part and it's a false assumption that you are NOT THINKING CRITICALLY about.
---------------------QUOTE-------------------



For instance, thats not how we formulate our arguments.

What type of biological system could not be formed by “numerous successive, slight modifications?” Well, for starters, a system that is irreducibly complex.

By irreducibly complex I mean a single system composed of several well-matched interacting parts that contribute to the basic function, wherein the removal of any one of the [core] parts causes the system to effectively cease functioning.


But today, there are many such cases observed in nature.

High information content machine-like irreducibly complex and interdependent structures,  of which photosynthesis, the eye, the human body, nitrogenase, the ribosome, the cell, rubisco, photosystem II, the oxygen evolving complex etc. are prime examples, are commonly found in nature.
Since Evolution is unable to  provide a advantage of adaptation in each evolutionary step, and is unable to select it,  1) Darwinism’s prediction is falsified; 2) Design’s prediction is confirmed.

Premise One: Despite a thorough search, no material causes have been discovered that demonstrate the power to produce large amounts of specified information, irreducible and interdependent biological systems.
Premise Two: Intelligent causes have demonstrated the power to produce large amounts of specified information, irreducible and interdependent systems of all sorts.
Conclusion: Intelligent design constitutes the best, most causally adequate, explanation for the information and irreducible complexity in the cell, and interdependence of proteins, organelles, and bodyparts, and even of animals and plants, aka moths and flowers, for example.  
 


---------------------QUOTE-------------------

You an reject naturalism all you want. Hypocrite.

---------------------QUOTE-------------------



you can namecall me as much as you want. That does not make your position become more true. Provide better explanations for origins, and we talk.



---------------------QUOTE-------------------

But if you do, then you should be living in a cave, eating carrion and rotten fruit. But you aren't. You're enjoying the results of all that naturalistic thinking all the while complaining about it.
---------------------QUOTE-------------------



I dont think its the moment to elucidate the consequences of your world view on humanity.



---------------------QUOTE-------------------

Great. Provide the evidence that god exists and I will accept him. But it'll take a lot of evidence.
---------------------QUOTE-------------------



What evidence do you expect ?




---------------------QUOTE-------------------

Here's the deal. No one here cares about your god. And, if you use god as a basis for your science, then it can never be taught in a school. Thanks for that own goal, BTW/
---------------------QUOTE-------------------



Well, i believe God certainly cares about you and has shown his love to you, too. And he has proven it.... But it might come a time, when he will not care about you either, anymore, since you rejected him. But then it will be too late.  



---------------------QUOTE-------------------

But not ALL the time and that's where the entire argument fails.
---------------------QUOTE-------------------



1. The pattern in DNA is a code.

2. All codes we know the origin of are designed.

3. Therefore we have 100% inference that DNA is designed and 0% inference that it is not.

Provide one, just ONE example of coded information arising by natural mechanisms, without intelligence involved, and you top my proof. Just one.

Code, by definition, implies intelligence and the genetic code is real code, mathematically identical to that of language, computer codes etc. all of which can only arise by intelligent convention of symbologies. The genome contains meta information and there is now evidence of meta-programming as well. Meta info is information on information and we now know the genome contains such structures. But meta information cannot arise without knowledge of the original information.Meta programming is even more solid evidence of intelligence at work.
Posted by: Otangelo on Nov. 15 2015,22:13

Quote (OgreMkV @ Nov. 15 2015,21:47)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
"Cool. Now explain to me how biomass can remain preserved for 1bio years, LOL........"

If you think minerilization doesn't occur, you really need to learn some stuff before even attempting this.
---------------------QUOTE-------------------



Indeed. In these cases, it did not occur.

Soft tissue cannot remain non-permineralized for  millions of years. That adds to the C14 carbon dating evidence. The best explanation is in my view that the fossils are younger than thought for a long time.

Troy Lawrence Before the global flood, the canopy of water that once surrounded the atmosphere, shielded the atmosphere from UV and other high energy cosmic rays. Thus, the conversion of N2 to C14 was blocked, therefore, the atmosohere had trace amounts of C14 before the flood. And for this reason, C14 dating makes a dead creature that died with trace C14 appear much older than reality.

Organic preservation of fossil musculature with ultracellular detail

< http://www.ncbi.nlm.nih.gov/pmc....2842642 >

SEM images of organically preserved muscle fibres in fossils from Grube Messel.
The muscle is preserved organically, in three dimensions, and with the highest fidelity of morphological preservation yet documented from the fossil record.

All specimens are from the collections of the Forschungsinstitut Senckenberg, Frankfurt. Samples were picked from fossils under a binocular microscope, mounted on SEM stubs, gold-coated and examined with a Hitachi S-3500N variable pressure microscope equipped with an EDAX Genesis energy dispersive spectrometer.

Microspectroscopic Evidence of Cretaceous Bone Proteins

Low concentrations of the structural protein collagen have recently been reported in dinosaur fossils based primarily on mass spectrometric analyses of whole bone extracts. However, direct spectroscopic characterization of isolated fibrous bone tissues, a crucial test of hypotheses of biomolecular preservation over deep time, has not been performed. Here, we demonstrate that endogenous proteinaceous molecules are retained in a humerus from a Late Cretaceous mosasaur (an extinct giant marine lizard).

< http://journals.plos.org/plosone....0019445 >

MICROSTRUCTURE AND BIOGEOCHEMISTRY OF THE ORGANICALLY PRESERVED EDIACARAN METAZOAN SABELLIDITES

Journal of Paleontology, 88(2), 2014, p. 224–239
MAŁGORZATA MOCZYDŁOWSKA,1 FRANCES WESTALL,2 AND FRE´ DE´RIC FOUCHER2

< http://www.monash.edu/.......4-e.pdf >

The remains of marine worms ‘dated’ at 550 million years old found in Russia have been examined by a team of researchers led by Professor Małgorzata Moczydłowska (pronounced approx. “mou-go-ZHAH-ta mo-chid-WOF-ska”) of Uppsala University, Sweden.3

The tube of S. cambriensis was flexible, as shown by its soft deformation and preservation—Moczydłowska et al., Journal of Paleontology, 2014
They found that the tube casings of the seabed worm Sabellidites cambriensis were still soft and flexible. After comprehensive laboratory analysis, the researchers assessed the seabed worm’s remains to be still composed of the original organic compounds. They ruled out the possibility of modern contaminants and of preservation by various means of mineralization. In the researchers’ own words (from their Journal of Paleontology paper):

“The Sabellidites organic body is preserved without permineralization. Minerals have not replicated any part of the soft tissue and the carbonaceous material of the wall is primary, preserving the original layering of the wall, its texture, and fabrics.”3

And:

“The tube of S. cambriensis was flexible, as shown by its soft deformation and preservation, and composed of fibers perfect in habit and parallel arranged in sheets, and then sheets in layers.”

Within days they were covered by sediment, perhaps stirred up by a storm—Professor Małgorzata Moczydłowska

Accompanying electron microscope photographs showed these ‘perfect in habit’ fibres to be less than half a thousandth of a millimetre wide. Yet these delicate fibres are still soft after supposedly half a billion years!?

The researchers were even able to chemically tease the fibres apart for further examination, and concluded that the structure of the fossil worm tube casing is “consistent with the ß chitin tubes of siboglinid animals”.3 In other words, the same as seabed dwelling worms such as beard worms today (see photo above). Why has there been no evolution in all that (supposed) time?
Posted by: Otangelo on Nov. 15 2015,22:17

Quote (Occam's Aftershave @ Nov. 15 2015,21:48)

---------------------QUOTE-------------------




---------------------QUOTE-------------------

Of course we know of the evolutionary mechanisms and have even mapped most of the major genetic changes.  Where are you getting this nonsense?
---------------------QUOTE-------------------



haha. the crowd here makes some funny assertions.

EVEN PROPONENTS OF EVOLUTION  ADMIT TO NOT KNOWING HOW EVOLUTION SUPPOSEDLY WORKS:

“Although the vast majority of research in evolutionary biology is focused on adaption, a general theory for the population-genetic mechanisms by which complex adaptations are acquired remains to be developed.”
Proceedings of the National Academy of Sciences of the U.S., “Scaling expectations for the time to establishment of complex adaptations”, September 7, 2010, doi:10.1073/pnas.1010836107.
< http://www.pnas.org/content....bstract >
“Students should realize that although virtually all scientists accept the general concept of evolution of species, scientists do have different opinions on how fast and by what mechanisms evolution proceeds.”
The American Association for the Advancement of Science, Educational Benchmarks, (F) Evolution of Life
< http://www.project2061.org/publica....5.htm#F >
“Scientists are still uncovering the specifics of how, when, and why evolution produced the life we see on Earth today.”
Smithsonian’s National Museum of Natural History’s website, “Foundational Concepts: Evolution” page
< http://www.nmnh.si.edu/paleo....e3.html >
“But they are trying to figure out how evolution happens, and that’s not an easy job.”
University of California Museum of Paleontology and the National Center for Science Education
< http://evolution.berkeley.edu/evolibr....0 >
“Much of the recent experimental work on natural selection has focused on three goals: determining how common it is, identifying the precise genetic changes that give rise to the adaptations produced by natural selection, and assessing just how big a role natural selection plays in a key problem of evolutionary biology—the origin of new species.”
Scientific American Magazine, “The Evolution of Evolution: Testing Natural Selection with Genetics”, December 18, 2008.
< http://www.sciam.com/article....nt=true >

< http://www.discovery.org/a....443 >

microbiologist James Shapiro of the University of Chicago declared in National Review that "There are no detailed Darwinian accounts for the evolution of any fundamental biochemical or cellular system, only a variety of wishful speculations." (Shapiro 1996)
In Nature University of Chicago evolutionary biologist Jerry Coyne stated,
"There is no doubt that the pathways described by Behe are dauntingly complex, and their evolution will be hard to unravel. . . . We may forever be unable to envisage the first proto-pathways." (Coyne 1996)

In a particularly scathing review in Trends in Ecology and Evolution Tom Cavalier-Smith, an evolutionary biologist at the University of British Columbia, nonetheless wrote, "For none of the cases mentioned by Behe is there yet a comprehensive and detailed explanation of the probable steps in the evolution of the observed complexity.

Evolutionary biologist Andrew Pomiankowski agreed in New Scientist, "Pick up any biochemistry textbook, and you will find perhaps two or three references to evolution. Turn to one of these and you will be lucky to find anything better than 'evolution selects the fittest molecules for their biological function.'" (Pomiankowski 1996)
Posted by: Otangelo on Nov. 15 2015,22:19

Quote (Occam's Aftershave @ Nov. 15 2015,21:52)
Quote (Otangelo @ Nov. 15 2015,21:47)
Feel free to substantiate your assertion.
---------------------QUOTE-------------------


That you can't manage a coherent argument with support from the primary scientific literature?

That's easy enough.  I'll just wait here while you sputter and bluster and C&P more Creationist crap without ever once making a coherent argument with support from the primary scientific literature.   You'll demonstrate for me.  :)
---------------------QUOTE-------------------




---------------------QUOTE-------------------

That you can't manage a coherent argument with support from the primary scientific literature?

That's easy enough.  I'll just wait here while you sputter and bluster and C&P more Creationist crap without ever once making a coherent argument with support from the primary scientific literature.   You'll demonstrate for me.  :)
---------------------QUOTE-------------------



ahh. So a baseless assertion after all. Thought so.... ???
Posted by: Occam's Aftershave on Nov. 15 2015,22:22

Quote (Otangelo @ Nov. 15 2015,22:09)

1. The pattern in DNA is a code.
---------------------QUOTE-------------------



Only in that it's a physical process that maps the inputs to the outputs.  It doesn't use arbitrary symbols to abstractly represent other values like communication codes do.  There is more than one definition of "code".



---------------------QUOTE-------------------
2. All codes we know the origin of are designed.
---------------------QUOTE-------------------



False.  We know many natural processes that encode information with no need of external intelligence.  



---------------------QUOTE-------------------
3. Therefore we have 100% inference that DNA is designed and 0% inference that it is not.
---------------------QUOTE-------------------



Since 2 is false so is your conclusion.



---------------------QUOTE-------------------
Provide one, just ONE example of coded information arising by natural mechanisms, without intelligence involved, and you top my proof. Just one.
---------------------QUOTE-------------------



I'll give you two.  Tree ring widths encode data about the rainfall conditions in the year of their formation.  The spectral lines in starlight encode data on the chemical composition of the star that produced them.

Creationist FAIL again.
Posted by: Occam's Aftershave on Nov. 15 2015,22:25

Quote (Otangelo @ Nov. 15 2015,22:19)
ahh. So a baseless assertion after all. Thought so
---------------------QUOTE-------------------


LOL!  You're demonstrating my point with every blithering idiotic Creationist C&Ped word you post.  There's not an original thought in sight.  :D
Posted by: Quack on Nov. 16 2015,02:41

Patterns in nature.

Are not atoms, every single one of them, in addition to being what they are, also a 'code'?

A configuration of nuclear particles, i.e. Neutrons and Protons, and a number of Electrons corresponding to the configuration of the nucleus? That is the code, the code that allow us to determine their properties. But they are not Newtonian balls of matter.

If my understanding is correct, atoms are quantum physical objects. That they "obey the laws of QM" may be an exaggeration, There ain't no such thing as Quantum Law, is there?

But when atoms assemble, create molecules, the bigger they grow, the less they appear as QM objects, and above a certain (blurrred?) level, molecules attain full membership in the Newtonian world?

The world would be a better world without the ID camp and their obsession with codes.

I am only speculating but I am not finished studying yet.

I want to know everything but realize there's a limit to what I can master. After so many years, I still am not comfortable with relativity
Posted by: Otangelo on Nov. 16 2015,05:31

Quote (Occam's Aftershave @ Nov. 15 2015,22:22)

---------------------QUOTE-------------------


Quote (Otangelo @ Nov. 15 2015,22:09)

1. The pattern in DNA is a code.
---------------------QUOTE-------------------



Only in that it's a physical process that maps the inputs to the outputs.  It doesn't use arbitrary symbols to abstractly represent other values like communication codes do.  There is more than one definition of "code".[/quote]

Thats PRECISELY what the DNA code does. It represents YOU for example.



---------------------QUOTE-------------------

 Tree ring widths encode data about the rainfall conditions in the year of their formation.  The spectral lines in starlight encode data on the chemical composition of the star that produced them.

Creationist FAIL again.
---------------------QUOTE-------------------



Thats correct. But they do not represent something else, like the DNA code does. Thats the salient thing about it. The DNA provides a codified representation as a book, a morse code, or a compunter code does.

Feel free to try again.

Fail AGAIN ? AGAIN ?? lol...... . i don
Posted by: Otangelo on Nov. 16 2015,05:34

Quote (Occam's Aftershave @ Nov. 15 2015,22:25)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
 There's not an original thought in sight.  :D
---------------------QUOTE-------------------



Would you not have just superficially skipped over my answers, you would have discovered the contrary.....
Posted by: Cubist on Nov. 16 2015,06:08

Quote (Otangelo @ Nov. 15 2015,20:58)
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.
---------------------QUOTE-------------------


Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ?
---------------------QUOTE-------------------


No. What ToE predicts is that "these transitional fossils" actually did exist at some time in the past. ToE is silent on the question of whether or not "these transitional fossils" should still exist in the present day; it neither mandates their present-day existence, nor forbids their present-day existence.

If you're genuinely interested in the question of what factors influence the survival of a once-living specimen over time, you should look into the scientific field of study called "taphonomy". If you are, instead, only interested in citing lack-of-surviving-fossils as a killer 'gotcha' argument against evolution… well, feel free to keep on treading the mendacious road you're already on.



---------------------QUOTE-------------------
Does the ToE also predict that we should find non-permineralized fossils, and collagen, and proteins preserved in fossils ?
---------------------QUOTE-------------------


No. Once again, you're attempting to fault evolution for its failure to provide answers to questions which are addressed by the scientific field called taphonomy.



---------------------QUOTE-------------------
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…

---------------------QUOTE-------------------


We "know from broad and repeated experience" that human agents "can and do produce information-rich systems", yes. To the best of my knowledge, we have no experience whatsoever of "information-rich systems" being produced by "intelligent agents" other than humans. Perhaps you'd care to cite some evidence of "information-rich systems" being produced by "intelligent agents" other than humans?
Posted by: Cubist on Nov. 16 2015,06:19

Quote (Otangelo @ Nov. 15 2015,22:09)
1. The pattern in DNA is a code.
---------------------QUOTE-------------------


By at least one definition of the word, sure.



---------------------QUOTE-------------------
2. All codes we know the origin of are designed.
---------------------QUOTE-------------------


More specifically: All codes we know the origin of are designed by human beings. If you have any example of a code whose origin is known, and that origin is not a human being (or group thereof), please do cite that example.



---------------------QUOTE-------------------
3. Therefore we have 100% inference that DNA is designed…
---------------------QUOTE-------------------


More specifically: We have 100% inference that DNA is designed by human beings.



---------------------QUOTE-------------------
Provide one, just ONE example of coded information arising by natural mechanisms, without intelligence involved, and you top my proof.
---------------------QUOTE-------------------


Provide one, just ONE example of coded information arising from any source other than human beings.
Posted by: Cubist on Nov. 16 2015,06:26

Quote (Otangelo @ Nov. 15 2015,22:13)
Troy Lawrence Before the global flood, the canopy of water that once surrounded the atmosphere, shielded the atmosphere from UV and other high energy cosmic rays.
---------------------QUOTE-------------------


Vapor canopy, eh? Interesting. YEC organization Answers in Genesis < has rejected the 'vapor canopy' model >; perhaps you might want to get in touch with AiG and let them know that the vapor canopy is, too, a viable candidate for the source of the Floodwaters.
Posted by: Occam's Aftershave on Nov. 16 2015,08:43

Quote (Otangelo @ Nov. 16 2015,05:31)

Thats PRECISELY what the DNA code does. It represents YOU for example.
---------------------QUOTE-------------------


Only in the same way tree ring widths represent rainfall amounts and spectral absorption lines in starlight represent elements.  


---------------------QUOTE-------------------
Thats correct. But they do not represent something else, like the DNA code does. Thats the salient thing about it. The DNA provides a codified representation as a book, a morse code, or a compunter code does.
---------------------QUOTE-------------------


No, it does not.  The key here is abstraction.  Intelligently designed codes (i.e Morse) all use abstraction where arbitrary symbols (dots, dashes) represents some other quantity in order to pass a message.  There is zero abstraction in DNA --> protein.  It's an unguided, unintelligent chemical process.  There is no sender or receiver, no message passed using symbols.

Sorry, the "DNA is a code, therefore ID" argument has been dead for a decade.  Find some new stupidity to copypasta.
Posted by: NoName on Nov. 16 2015,08:50

Quote (Otangelo @ Nov. 15 2015,23:13)
...
Troy Lawrence Before the global flood, the canopy of water that once surrounded the atmosphere, shielded the atmosphere from UV and other high energy cosmic rays. ...
---------------------QUOTE-------------------


This is physically impossible for a variety of reasons.
The most telling may be the energy impacts of such a 'canopy of water' falling to earth for 40 days and 40 nights, to such a depth that the mountains were covered.
That volume of water, falling over that time period, would release energy equivalent to multi-megaton nuclear explosions on every square meter of the planet every second over the duration of the flood.

It would be worth your while to calculate the amount of water it would take to shield the atmosphere from UV and high energy cosmic rays sufficiently to affect the N2 to C14 conversion.
Calculate the difference between that volume of water and the amount of water currently on earth.
Then calculate the energy effect of that volume of water falling over the span of the flood.
Posted by: sparc on Nov. 16 2015,08:55

Doesn't EN&V deserve its exclusive thread anymore?
I don't want to read Otangelo's BS when I am looking for DI's ID BS.
Thus, I suggest a separate zhread for Otangelo like those we have for Gary Gaulin and Edgar Postrado or, ideally, a common thread for the three of them to allow for some entertaining interactions.
You may move my post to the bathroom wall if it should not be appropriate.
Posted by: Quack on Nov. 16 2015,10:04

Quote (sparc @ Nov. 16 2015,08:55)
Doesn't EN&V deserve its exclusive thread anymore?
I don't want to read Otangelo's BS when I am looking for DI's ID BS.
Thus, I suggest a separate zhread for Otangelo like those we have for Gary Gaulin and Edgar Postrado or, ideally, a common thread for the three of them to allow for some entertaining interactions.
You may move my post to the bathroom wall if it should not be appropriate.
---------------------QUOTE-------------------


A common thread? IMO a good idea, might produce some of the entertainment presently lacking from those threads.
Posted by: Otangelo on Nov. 16 2015,12:03

Quote (Cubist @ Nov. 16 2015,06:08)

---------------------QUOTE-------------------


Quote (Occam's Aftershave @ Nov. 15 2015,20:23)

No. What ToE predicts is that "these  fossils" actually did exist at some time in the past. ToE is silent on the question of whether or not "these  fossils" should still exist in the present day; it neither mandates their present-day existence, nor forbids their present-day existence.
---------------------QUOTE-------------------



thats like putting the horse in front of the cart. So the ToE would be making absolute claims, and be  true, no matter if there is evidence to support its assertions,  or not....



---------------------QUOTE-------------------

If you're genuinely interested in the question of what factors influence the survival of a once-living specimen over time, you should look into the scientific field of study called "taphonomy". If you are, instead, only interested in citing lack-of-surviving-fossils as a killer 'gotcha' argument against evolution… well, feel free to keep on treading the mendacious road you're already on.
---------------------QUOTE-------------------



You might explain how taphonomy supports the idea that non permineralized fossils, and soft tissue, can remain preserved for millions if not hundreds of millions of years.....



---------------------QUOTE-------------------
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…
We "know from broad and repeated experience" that human agents "can and do produce information-rich systems", yes. To the best of my knowledge, we have no experience whatsoever of "information-rich systems" being produced by "intelligent agents" other than humans. Perhaps you'd care to cite some evidence of "information-rich systems" being produced by "intelligent agents" other than humans?
---------------------QUOTE-------------------



Neither do we have experience that non - intelligence has EVER produced codified information..... We have imho plenty of evidence that spirits can exist without a body, which gives support to the inference that a non physical intelligent designer created the living beings on earth.

< http://reasonandscience.heavenforum.org/t1284-n....dualism >
Posted by: Otangelo on Nov. 16 2015,12:17

Quote (Occam's Aftershave @ Nov. 16 2015,08:43)

---------------------QUOTE-------------------




---------------------QUOTE-------------------

Only in the same way tree ring widths represent rainfall amounts and spectral absorption lines in starlight represent elements.  
---------------------QUOTE-------------------



I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.

In human language, symbols are arbitrary. In DNA they are fixed by chemistry. This is a very big difference. By that criteria many other things are codes too: The spatial distribution of the sizes of pebbles below a rapids, the pattern and orientation of sand dunes, the layers inside a hailstone, and tree rings. All contain the transformation of one representation (time, for example) into another (tree rings). Tree rings also encode information about local climate in their varying widths. Mr. Marshall must give a formal definition of “code” rather than a series of examples that conceal significant differences.
The definition of code I have provided is sufficient and applies whether the code is arbitrary or not. Again, I define “Coded Information” as a system of symbols used by an encoding and decoding mechanism, which transmits a message representing an idea or plan.
If there are pebbles below a rapids, there are pebbles below a rapids. There is no coded information associated with them – unless you measure their size, in which case you have created information to describe the pebbles, based on your chosen symbols and units of measurement. Same with orientation of sand dunes, layers of hailstone. Those objects represent only themselves; there is no encoding and decoding mechanism within these material objects, such as there is in DNA. If someone says the layers of a hailstone are an encoding mechanism, I reply that there is no convention of symbols, nor is there a decoding mechanism.
The information in DNA is independent of the communication medium insofar as every strand of DNA in your body represents a complete plan for your body; even though the DNA strand itself is only a sequence of symbols made up of chemicals (A, G, C, T). We could store a CAD drawing of a hard drive on the same model of hard drive, but the medium and the message are two distinctly different things. Such symbolic relationships only exist within the realm of living things; they do not occur naturally.
Posted by: Otangelo on Nov. 16 2015,12:18

i forgot to provide the link to the information above :

< http://cosmicfingerprints.com/dna-ath....na-code >
Posted by: NoName on Nov. 16 2015,12:43

Quote (Otangelo @ Nov. 16 2015,13:17)
...
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.
...
---------------------QUOTE-------------------


Paying strict attention to meaning, no, you actually can't.
Giving you the wiggle room to claim that "well, under these and those conditions one can, in principle" yadda yadda yadda, gives us the same amount of room to  claim that the same holds for tree rings.

The genetic 'code' requires a vast complex of chemical 'machinery' to be transcribed.  It is part of a complex chemical system comprised of complex subsystems.  It is non-functional on its own.
Were it not, cloning would be trivial.  Transplantation of cellular nuclei would be trivial.
Genetic disease would be rare.  Transcription errors even rarer.

The claim is absurd on the face of it to all who understand anything about the actual factual nature of genes and cells.
Posted by: Occam's Aftershave on Nov. 16 2015,13:08

Quote (Otangelo @ Nov. 16 2015,12:17)
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.
---------------------QUOTE-------------------


Go ahead then.  Make a copy of a genome out of sticks and modeling clay, have it make a stick and modeling clay protein.

Put up or shut up.
Posted by: Otangelo on Nov. 16 2015,13:09

Quote (NoName @ Nov. 16 2015,12:43)
Quote (Otangelo @ Nov. 16 2015,13:17)
...
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.
...
---------------------QUOTE-------------------


Paying strict attention to meaning, no, you actually can't.
Giving you the wiggle room to claim that "well, under these and those conditions one can, in principle" yadda yadda yadda, gives us the same amount of room to  claim that the same holds for tree rings.

The genetic 'code' requires a vast complex of chemical 'machinery' to be transcribed.  It is part of a complex chemical system comprised of complex subsystems.  It is non-functional on its own.
Were it not, cloning would be trivial.  Transplantation of cellular nuclei would be trivial.
Genetic disease would be rare.  Transcription errors even rarer.

The claim is absurd on the face of it to all who understand anything about the actual factual nature of genes and cells.
---------------------QUOTE-------------------


Quote (Otangelo @ Nov. 16 2015,13:17)
...
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.
...
Paying strict attention to meaning, no, you actually can't.
---------------------QUOTE-------------------



Its actually as much coded information, as a alphabet. I can even translate the information written through the alphabet, to the genetic code :

< http://dulbrich.is2.byuh.edu/dna....dna >




---------------------QUOTE-------------------


The genetic 'code' requires a vast complex of chemical 'machinery' to be transcribed.  It is part of a complex chemical system comprised of complex subsystems.  It is non-functional on its own.
Were it not, cloning would be trivial.  Transplantation of cellular nuclei would be trivial.
Genetic disease would be rare.  Transcription errors even rarer.

The claim is absurd on the face of it to all who understand anything about the actual factual nature of genes and cells.
---------------------QUOTE-------------------



What claim ? What good would the DNA double helix be for without the machinery to transcribe and translate it to make proteins ? So both are required. That constitutes a interdependent system. There is no reason for the DNA double helix to arise by its own. And even IF both were present, the DNA , and the transcription factors / RNA polymerase, you need also the Promoter region, and in eukaryotic cells TATA box, the sequence which provides the signal for initiation of transcription. If it were not at the right place, bye bye ....... How did it get there, and at the right place ? trial and error ?? LOL....

The cell is a gigantic interdependent and irreducible complex system.....
Posted by: Occam's Aftershave on Nov. 16 2015,13:16

Quote (Otangelo @ Nov. 16 2015,13:09)
Its actually as much coded information, as a alphabet. I can even translate the information written through the alphabet, to the genetic code :

< http://dulbrich.is2.byuh.edu/dna............dna >
---------------------QUOTE-------------------


(facepalm) You can take information written in the English alphabet and save it by spelling words with dog turds too.  That doesn't make dog turds be designed.

Where do the IDiots find these guys?   :D
Posted by: Otangelo on Nov. 16 2015,13:22

Quote (Occam's Aftershave @ Nov. 16 2015,13:16)

---------------------QUOTE-------------------


Quote (Otangelo @ Nov. 16 2015,13:09)
Its actually as much coded information, as a alphabet. I can even translate the information written through the alphabet, to the genetic code :

< http://dulbrich.is2.byuh.edu/dna............dna >
(facepalm) You can take information written in the English alphabet and save it by spelling words with dog turds too.  That doesn't make dog turds be designed.

Where do the IDiots find these guys?   :D
---------------------QUOTE-------------------



Of course. You can take whatever medium you wish to store information. The X of the question is not what material you use, but the special arrangement which constitutes coded information.
The 3 letter codons are genetic words, and constitute genetic information.

Where do the EvoTards ™ find these guys?
Posted by: Occam's Aftershave on Nov. 16 2015,13:27

Quote (Otangelo @ Nov. 16 2015,13:22)
Of course. You can take whatever medium you wish to store information. The X of the question is not what material you use, but the special arrangement which constitutes coded information.
The 3 letter codons are genetic words, and constitute genetic information.
---------------------QUOTE-------------------


Then go ahead and make a genome out of sticks and clay and have it produce a clay protein.  Or use Lego. Or metal bits from an Erector Set.

You claim the codons are arbitrary chosen symbols so any material should work to pass the message, right?

Idiot.
Posted by: Otangelo on Nov. 16 2015,13:41

I have my own thread ? Thats cool, haha.

:D

I just want EvoTard's ™ which have no education to stay away, people that cannot debate without resorting to name calling.
Posted by: Occam's Aftershave on Nov. 16 2015,13:45

Quote (Otangelo @ Nov. 16 2015,13:41)
I just want EvoTard's ™ which have no education to stay away, people that cannot debate without resorting to name calling.
---------------------QUOTE-------------------


Takes a real IDiot to whine about name calling in the same sentence he name calls.  :p

Talk about a poster boy for Dunning-Kruger.
Posted by: Dr.GH on Nov. 16 2015,14:24

ID creationism predicted that multiple sequential mutations could not happen. Falsified;

"Acceleration of Emergence of Bacterial Antibiotic Resistance in Connected Microenvironments" Qiucen Zhang, Guillaume Lambert, David Liao, Hyunsung Kim, Kristelle Robin,    Chih-kuan Tung, Nader Pourmand, Robert H. Austin, Science 23 September 2011: Vol. 333 no. 6050 pp. 1764-1767

“It is surprising that four apparently functional SNPs should fix in a population within 10 hours of exposure to antibiotic in our experiment. A detailed understanding of the order in which the SNPs occur is essential, but it is unlikely that the four SNPs emerged simultaneously; in all likelihood they are sequential (21–23). The device and data we have described here offer a template for exploring the rates at which antibiotic resistance arises in the complex fitness landscapes that prevail in the mammalian body. Furthermore, our study provides a framework for exploring rapid evolution in other contexts such as cancer (24).

Multi-site mutations, functional mutations, TEN HOURS, why sequential mutations are functional, and more likely, and with medical applications.

ID Creationism insisted that the Cambrian phyla were "fully formed, and that all modern phyla were represented in the Cambrian. Falsified;

Precambrian Ediacaran/Cambrian;

Erwin, Douglas H., James W. Valentine
2013 "The Cambrian Explosion: The Construction of Animal Diversity" New York: Roberts and Company Publishers

Valentine, James W.
2005 “On the Origin of Phyla” University of Chicago Press

A. Yu. Zhuravlev, R. A. Wood, A. M. Penny
"Ediacaran skeletal metazoan interpreted as a lophophorate" Proc. R. Soc. B 2015 282 20151860; DOI: 10.1098/rspb.2015.1860. Published online 4 November 2015.

ID Creationism claimed embryology data that supported evolution was faked, and that embryology falsified evolution and supported ID Creationism. Falsified;

Ossa-Fuentes L, Mpdozis J and Vargas AO (2015). Bird embryos uncover homology and evolution of the dinosaur ankle. Nature Communications. DOI: 10.1038/natcomms9902

Diaz, R. E.,&Trainor, P. A. (2015). Hand/foot splitting and the ‘re-evolution’of mesopodial skeletal elements during the evolution and radiation of chameleons. BMC evolutionary biology, 15(1), 184.

< http://www.science20.com/news_ar....-159819 >

Richards, Robert J.
2008 “The Tragic Sense of Life: Ernst Haeckel and the Struggle over Evolutionary Thought” University of
Chicago Press.

ID Creationism claims that nested hierarchies from DNA are because their god used "common tool kits." Falsified by hierarchies built by silenced pathological genes;

Sverdlov, ED. 2000. Retroviruses and primate evolution. BIOESSAYS Volume: 22 Issue: 2 Pages: 161-171.

Welkin E. Johnson and John M. Coffin
"Constructing primate phylogenies from ancient retrovirus sequences" PNAS 1999 96 (18) 10254-10260; doi:10.1073/pnas.96.18.10254

Heui-Soo Kim, Osamu Takenaka, Timothy J. Crow
"Isolation and phylogeny of endogenous retrovirus sequences belonging to the HERV-W family in primates" J Gen Virol October 1999 vol. 80 no. 10: 2613-2619

ID Creationism claims complex organs cannot have evolved. Falsified by Paley's favorites;

Ivan R Schwab
2011 “Evolution's Witness: How Eyes Evolved”  Oxford University Press

Teaford, Mark F., Moya Meredith Smith, and Mark W.J. Ferguson
2000/2006 “Development, Function and Evolution of Teeth” Cambridge University Press

The fact is that Behe's "irreducible complexity" was neither original, nor an argument against evolution;

Hermann J. Muller,
1918 "Genetic Variability, Twin Hybrids and Constant Hybrids, in a Case of Balanced Lethal Factors", Genetics, Vol 3, No 5: 422-499, Sept 1918.
(This is the real source for a “irreducible complexity" argument only it was the argument for evolution. Behe was apparently unaware it was published).


Posted by: Otangelo on Nov. 16 2015,14:53

Answers at Panda's Thumb

< http://www.antievolution.org/cgi-bin....2;st=30 >

ID creationism predicted that multiple sequential mutations could not happen. Falsified;

"Acceleration of Emergence of Bacterial Antibiotic Resistance in Connected Microenvironments" Qiucen Zhang, Guillaume Lambert, David Liao, Hyunsung Kim, Kristelle Robin,    Chih-kuan Tung, Nader Pourmand, Robert H. Austin, Science 23 September 2011: Vol. 333 no. 6050 pp. 1764-1767

“It is surprising that four apparently functional SNPs should fix in a population within 10 hours of exposure to antibiotic in our experiment. A detailed understanding of the order in which the SNPs occur is essential, but it is unlikely that the four SNPs emerged simultaneously; in all likelihood they are sequential (21–23). The device and data we have described here offer a template for exploring the rates at which antibiotic resistance arises in the complex fitness landscapes that prevail in the mammalian body. Furthermore, our study provides a framework for exploring rapid evolution in other contexts such as cancer (24).

Answer :

The question in demand is not if multiple sequential mutations could or could not  happen.

Mutations cannot produce new information

< http://reasonandscience.heavenforum.org/t1664-m....rmation >


The development of new functions is the only thing important for evolution. We are not talking about small functional changes, but radical ones. Some organism had to learn how to convert sugars to energy. Another had to learn how to take sunlight and turn it into sugars. Another had to learn how to take light and turn it into an interpretable image in the brain. These are not simple things, but amazing processes that involve multiple steps, and functions that involve circular and/or ultra-complex pathways will be selected away before they have a chance to develop into a working system. For example, DNA with no function is ripe for deletion, and making proteins/enzymes that have no use until a complete pathway or nano-machine is available is a waste of precious cellular resources.

For evolution to work, they have to come up from scratch, they have to be carefully balanced and regulated with respect to other processes, and they have to work before they will be kept. Saying a gene can be copied and then used to prototype a new function is not what evolution requires, for this cannot account for radically new functionality. Thus, gene duplication cannot answer the most fundamental questions about evolutionary history. Likewise, none of the common modes of mutation (random letter changes, inversions, deletions, etc.) have the ability to do what evolution requires.

When discussing whether or not mutations can create new information, evolutionists routinely bring up an overly-simplistic view of mutation and then claim to have solved the problem while waving their hand over the real issue: the antagonism between ultra-complexity and random mutation.

If a four-dimensional genome is hard enough to grasp, there is also a huge amount of ‘meta-information’ in the genome. This is information about the information! This is the information that tells the cell how to maintain the information, how to fix it if it breaks, how to copy it, how to interpret what is there, how to use it, when to use it, and how to pass it on to the next generation. This is all coded in that linear string of letters and life could not exist without it. In fact, life was designed from a top-down perspective, apparently with the meta-information coming first.

protein folds in general are multi-mutation features, requiring many amino acids to be fixed before the assembly provides any functional advantage.

Another study by Axe and Ann Gauger found that merely converting one enzyme into a closely related enzyme -- the kind of conversion that evolutionists claim can easily happen -- would require a minimum of seven simultaneous changes,6exceeding the probabilistic resources available for evolution over the Earth's history. This data implies that many biochemical features are so complex that they would require many mutations before providing any advantage to an organism, and would thus be beyond the "edge" of what Darwinian evolution can do.

ID Creationism insisted that the Cambrian phyla were "fully formed, and that all modern phyla were represernted in the Cambrian. Falsified;

Precambian Edicaran/Cambrian
Erwin, Douglas H., James W. Valentine
2013 "The Cambrian Explosion: The Construction of Animal Diversity" New York: Roberts and Company Publishers

Valentine, James W.
2005 “On the Origin of Phyla” University of Chicago Press

Answer :

< http://creation.com/cambria....versity >

The Cambrian explosion features such things as the sudden appearance of the phyla, strong discontinuities between the phyla, difficulties in grouping phyla according to evolutionary relationships, and the early appearance of many essentially modern traits. Special creation remains the most parsimonious explanation for the Cambrian explosion.

< http://www.trueorigin.org/trilobi....yes.asp >

Trilobites  appear suddenly in the fossil record without any transitions. There are no fossils between simple single-cell organisms, such as bacteria, and complex invertebrates, such as trilobites. How do you explain then the appearance of the most sophisticated eye ever observed in nature ?

< http://www.peripatus.gen.nz/taxa.......te.html >

The big problem with the earliest known trilobites, is that they are trilobites. That is to say, their earliest representatives – from the order Redlichiida and in particular the Fallotaspididae (fig. 2A) – are distinctly and emphatically trilobites, and they do not look like anything else. They provide few clues to which other arthropod groups may be their close relatives, or to their origins.

Although it is true that one or two of the Ediacaran forms such as Spriggina (fig. 2B) superficially resemble early trilobites, to date the detailed case for such an ancestry is far from compelling.

This problem is particularly galling in one respect: it has not escaped the notice of those well-known oxymorons, the creation science brigade. However, those of us with an interest in the origins of things are compensated with a fascinating puzzle.

ID Creationism claims complex organs cannot have evolved. Falsified by Paley's favorites;

Ivan R Schwab
2011 “Evolution's Witness: How Eyes Evolved”  Oxford University Press

Teaford, Mark F., Moya Meredith Smith, and Mark W.J. Ferguson
2000/2006 “Development, Function and Evolution of Teeth” Cambridge University Press

Answer:

Eye / brain is a interdependent and irreducible complex system

< http://reasonandscience.heavenforum.org/t1638-e....-system >

< http://www.detectingdesign.com/humaney....ye.html >

the first step in vision is the detection of photons.  In order to detect a photon, specialized cells use a molecule called 11-cis-retinal.  When a photon of light interacts with this molecule, it changes its shape almost instantly.  It is now called trans-retinal.  This change in shape causes a change in shape of another molecule called rhodopsin.  The new shape of rhodopsin is called metarhodopsin II.  Metarhodopsin II now sticks to another protein called transducinforcing it to drop an attached molecule called GDP and pick up another molecule called GTP.  The GTP-transducin-metarhodopsin II molecule now attaches to another protein called phosphodiesterase.  When this happens,phosphodiesterase cleaves molecules called cGMPs.  This cleavage of cGMPs reduces their relative numbers in the cell.  This reduction in cGMP is sensed by an ion channel.  This ion channel shuts off the ability of the sodium ion to enter the cell.  This blockage of sodium entrance into the cell causes an imbalance of charge across the cell's membrane.  This imbalance of charge sends an electrical current to the brain.  The brain then interprets this signal and the result is called vision.

Many other proteins are now needed to convert the proteins and other molecules just mentioned back to their original forms so that they can detect another photon of light and signal the brain.  If any one of these proteins or molecules is missing, even in the simplest eye system, vision will not occur

The question now of course is, how could such a system evolve gradually?  All the pieces must be in place simultaneously.  For example, what good would it be for an earthworm that has no eyes to suddenly evolve the protein 11-cis-retinal in a small group or "spot" of cells on its head?  These cells now have the ability to detect photons, but so what?  What benefit is that to the earthworm?  Now, lets say that somehow these cells develop all the needed proteins to activate an electrical charge across their membranes in response to a photon of light striking them.  So what?!  What good is it for them to be able to establish an electrical gradient across their membranes if there is no nervous pathway to the worm's minute brain?   Now, what if this pathway did happen to suddenly evolve and such a signal could be sent to the worm's brain.  So what?!  How is the worm going to know what to do with this signal?  It will have to learn what this signal means.  Learning and interpretation are very complicated processes involving a great many other proteins in other unique systems.  Now the earthworm, in one lifetime, must evolve the ability to pass on this ability to interpret vision to its offspring.  If it does not pass on this ability, the offspring must learn as well or vision offers no advantage to them.  All of these wonderful processes need regulation.  No function is beneficial unless it can be regulated (turned off and on).  If the light sensitive cells cannot be turned off once they are turned on, vision does not occur.  This regulatory ability is also very complicated involving a great many proteins and other molecules - all of which must be in place initially for vision to be beneficial.

The fact is that Behe's "irreducible complexity" was neither original, nor an argument against evolution;

Hermann J. Muller,
1918 "Genetic Variability, Twin Hybrids and Constant Hybrids, in a Case of Balanced Lethal Factors", Genetics, Vol 3, No 5: 422-499, Sept 1918.
(This is the real source for a “irreducible complexity" argument only it was the argument for evolution. Behe was apparently unaware it was published).



Answer :

It might not be original, but that it is a BIG blow in regard of the ToE. Oh yeah. It is !!

I have described 17 IC systems so far. Feel free to pick any of these, and refute my claim that they are IC.

< http://reasonandscience.heavenforum.org/t2166-a....systems >
Posted by: Otangelo on Nov. 16 2015,14:55

for better visualisation, you can read my answer here:

< http://reasonandscience.heavenforum.org/t2230-a....mb#4370 >
Posted by: Occam's Aftershave on Nov. 16 2015,14:59

Quote (Otangelo @ Nov. 16 2015,14:55)
for better visualisation, you can read my answer here:

< http://reasonandscience.heavenforum.org/t2230-a....mb#4370 >
---------------------QUOTE-------------------


Gee, a Creationist doing the Gish Gallop with links to all the usual IDiot / YECkery sites.

How clever.
Posted by: Occam's Aftershave on Nov. 16 2015,15:07

Quote (Otangelo @ Nov. 16 2015,14:53)
Mutations cannot produce new information
---------------------QUOTE-------------------


That's easily disproven by the simple logic that whatever one mutation can do another in a later generation can undo.

If A -> B is a loss of information then

B -> A is a gain of information.

That's true no matter how you define "information".

These occurrences have been empirically observed in real life too.  They're called back mutations.

< Back mutation can produce phenotype reversion in Bloom syndrome somatic cells >

Of course here's where the IDiots start squirming and claiming "it's not new information, it's just different information!"   :D
Posted by: Dr.GH on Nov. 16 2015,15:08

Re: Origin of life

The new chewtoy repeated a lot of creationist nonsense about RNA, complexity, and activity. Here are some refuting articles;

Lee DH, Granja JR, Martinez JA, Severin K, Ghadri MR.
1996 “A self-replicating peptide.” Nature Aug 8;382(6591):525-8

Reader, J. S.  and G. F. Joyce
2002 "A ribozyme composed of only two different nucleotides." Nature vol 420, pp 841-844.

Anthony D. Keefe, Jack W. Szostak
2001 “Functional proteins from a random-sequence library” Nature 410, 715-718

Ekland, EH, JW Szostak, and DP Bartel
1995 "Structurally complex and highly active RNA ligases derived from random RNA sequences"  Science: Vol. 269. no. 5222, pp. 364-370

Powner, Matthew W., Béatrice Gerland & John D. Sutherland
2009 “Synthesis of activated pyrimidine ribonucleotides in prebiotically plausible conditions” Nature Vol; 459, 239-242 doi:10.1038/nature08013

Saladino R, Crestini C, Ciambecchini U, Ciciriello F, Costanzo G, Di Mauro E.
2004 "Synthesis and degradation of nucleobases and nucleic acids by formamide in the presence of montmorillonites" Chembiochem, 5(11):1558-66

In short, activated RNAs can readily form; RNAs do not need to be complex to function as ribozymes; peptides are capable of "evolving" self replication; peptides randomly assembled are highly active.

I'll also toss in the spontaneous formation of phospholipid membranes, and encapsulation;

A.C. Chakrabarti, R.R. Breaker, G.F. Joyce, & D.W. Deamer
1994 "Production of RNA by a Polymerase Protein Encapsulated within Phospho-Lipid Vesicles" Journal of Molecular Evolution 39(6): 555-559

Khvorova A, Kwak YG, Tamkun M, Majerfeld I, Yarus M.  
1999.  "RNAs that bind and change the permeability of phospholipid membranes" Proceedings of the National Academy of the Sciences USA 96:10649-10654.

Yarus M.  
1999 "Boundaries for an RNA world" Current Opinion in Chemical Biology  3:260-267.

Wang KJ, Ferris JP
2005 "Catalysis and selectivity in prebiotic synthesis: initiation of the formation of oligo(U)s on montmorillonite clay by adenosine-5'-methylphosphate" Orig Life Evol Biosph, 35(3):187-212

Martin M. Hanczyc, Shelly M. Fujikawa, and Jack W. Szostak
2003 "Experimental Models of Primitive Cellular Compartments: Encapsulation, Growth, and Division" Science Vol. 302: 618-622.


A book reviewing much of this is;

Deamer, David W.
2011 “First Life: Discovering the Connections between Stars, Cells, and How Life Began” University of California Press


Posted by: Otangelo on Nov. 16 2015,15:14

Quote (Dr.GH @ Nov. 16 2015,15:08)

---------------------QUOTE-------------------


Origin of life

< http://reasonandscience.heavenforum.org/t2024-t....fe#3414 >

refute, if you can.

Your list of scientific papers does not impress me in the slightest.
Posted by: Occam's Aftershave on Nov. 16 2015,15:18

Quote (Otangelo @ Nov. 16 2015,15:14)
 
Quote (Dr.GH @ Nov. 16 2015,15:08)

---------------------QUOTE-------------------


Origin of life

< http://reasonandscience.heavenforum.org/t2024-t....fe#3414 >

refute, if you can.
---------------------QUOTE-------------------


There's nothing to refute.  It's just one more IDiot claiming abiogenesis is impossible, claiming to have proved a negative.



---------------------QUOTE-------------------
Your list of scientific papers does not impress me in the slightest.
---------------------QUOTE-------------------



Of course not since you didn't read them and wouldn't understand them if you did.
Posted by: Texas Teach on Nov. 16 2015,16:14

Quote (Otangelo @ Nov. 16 2015,12:03)
We have imho plenty of evidence that spirits can exist without a body, which gives support to the inference that a non physical intelligent designer created the living beings on earth.
---------------------QUOTE-------------------


Ooooooooooooooooooo...
Posted by: Dr.GH on Nov. 16 2015,16:23

I am certain that the new chewtoy imagined his creationist cut and paste "answered" the obvious ID creationism's failures that I illustrated by scientific citation. He failed miserably.

I'll take the opportunity to rub it in a bit. Chewtoy wrote,
 

---------------------QUOTE-------------------
Eye / brain is a interdependent and irreducible complex system
---------------------QUOTE-------------------





This photo is the eye stalk of a < cubozoan, rhopalium >

There are three different kinds of eyes. The cubozoa have no brains.


Posted by: Otangelo on Nov. 16 2015,16:56

Quote (Dr.GH @ Nov. 16 2015,16:23)

---------------------QUOTE-------------------


[QUOTE][There are three different kinds of eyes. The cubozoa have no brains./QUOTE]

1. You have not read my answer. It was about the signal transduction pathway in photoreceptor cells.

2. Your example does not refute my claim, since its about another organism, not the human eye.
Posted by: Occam's Aftershave on Nov. 16 2015,17:04

Quote (Otangelo @ Nov. 16 2015,16:56)
1. You have not read my answer. It was about the signal transduction pathway in photoreceptor cells.
---------------------QUOTE-------------------


Yeah, we know. "The (insert body part here) is SOOOOO COMPLEX it just couldn't have evolved!  Therefore GODDIDIT!!"

 

---------------------QUOTE-------------------
2. Your example does not refute my claim, since its about another organism, not the human eye.
---------------------QUOTE-------------------



You bluster doesn't support your claim that human eye/brain evolution is impossible.
Posted by: Cubist on Nov. 16 2015,18:43

Replying to the latest Creationist chewtoy seeker after Truth, with relevant context restored as needed

Quote (Otangelo @ Nov. 16 2015,12:03)
Quote (Cubist @ Nov. 16 2015,06:08)
Quote (Otangelo @ Nov. 15 2015,20:58)
 
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.
---------------------QUOTE-------------------


Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ?
---------------------QUOTE-------------------


No. What ToE predicts is that "these transitional fossils" actually did exist at some time in the past. ToE is silent on the question of whether or not "these transitional fossils" should still exist in the present day; it neither mandates their present-day existence, nor forbids their present-day existence.

---------------------QUOTE-------------------

So the ToE would be making absolute claims, and be  true, no matter if there is evidence to support its assertions,  or not...
---------------------QUOTE-------------------


You have chosen to respond to what I wrote—that being, the ToE does not mandate that transitional fossils must necessarily survive to the present day—as if I had actually said something akin to the ToE does not require any evidence at all. Until such time as you elect to reply to what I wrote, rather than to what you imagine I wrote, I see no reason to engage with you further on this point.



---------------------QUOTE-------------------


---------------------QUOTE-------------------


---------------------QUOTE-------------------
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…

---------------------QUOTE-------------------


We "know from broad and repeated experience" that human agents "can and do produce information-rich systems", yes. To the best of my knowledge, we have no experience whatsoever of "information-rich systems" being produced by "intelligent agents" other than humans. Perhaps you'd care to cite some evidence of "information-rich systems" being produced by "intelligent agents" other than humans?
---------------------QUOTE-------------------


Neither do we have experience that non - intelligence has EVER produced codified information...
---------------------QUOTE-------------------


That's nice. It doesn't happen to be the "evidence of 'information-rich systems' being produced by 'intelligent agents' other than humans" I asked you for, but it's nice.
Posted by: Cubist on Nov. 16 2015,18:51

Quote (Otangelo @ Nov. 16 2015,14:53)
Mutations cannot produce new information
---------------------QUOTE-------------------


This is a bog-standard Creationist talking point. In order to give Otangelo an opportunity to demonstrate that he actually comprehends this talking point, and isn't just mindlessly repeating it like a tape recorder, I do have a question.

What does "new information" look like? Given an arbitrary string of nucleotides, and a mutation which alters that string of nucleotides, how can you tell whether or not the post-mutation version of that string contains any "new" information?
Posted by: Otangelo on Nov. 16 2015,18:56

Quote (Cubist @ Nov. 16 2015,18:43)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
You have chosen to respond to what I wrote—that being, the ToE does not mandate that transitional fossils must necessarily survive to the present day—as if I had actually said something akin to the ToE does not require any evidence at all. Until such time as you elect to reply to what I wrote, rather than to what you imagine I wrote,I see no reason to engage with you further on this point.
---------------------QUOTE-------------------



Sorry, i do not understand your replies. What do you mean with :

ToE does not mandate that transitional fossils must necessarily survive to the present day ???

If there are no transitional fossils in the fossil record, how would you confirm  the ToE in regard of paleontology ?




---------------------QUOTE-------------------
That's nice. It doesn't happen to be the "evidence of 'information-rich systems' being produced by 'intelligent agents' other than humans" I asked you for, but it's nice.
---------------------QUOTE-------------------



Once more your sentence is hard to understand. There is no reason to assume that humans are the only beings that can have intelligent thoughts.  Complex, specified, coded information rich, interdependent and irreducible complex systems are best explained through a intelligent designer. Period.
Posted by: Occam's Aftershave on Nov. 16 2015,19:01

Quote (Otangelo @ Nov. 16 2015,18:56)
 Complex, specified, coded information rich, interdependent and irreducible complex systems are best explained through a intelligent designer. Period.
---------------------QUOTE-------------------


The people who designed those bullshit meaningless buzz terms to hang on biological forms may be intelligent but they certainly aren't very honest.
Posted by: Otangelo on Nov. 16 2015,19:03

Quote (Cubist @ Nov. 16 2015,18:51)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
What does "new information" look like? Given an arbitrary string of nucleotides, and a mutation which alters that string of nucleotides, how can you tell whether or not the post-mutation version of that string contains any "new" information?
---------------------QUOTE-------------------



< http://reasonandscience.heavenforum.org/t2062-p....roteins >

Few of the many  possible polypeptide chains will be useful to Cells
Paul Davies puts it more graphically: ‘Making a protein simply by injecting energy is rather like exploding a stick of dynamite under a pile of bricks and expecting it to form a house. You may liberate enough energy to raise the bricks, but without coupling the energy to the bricks in a controlled and ordered way, there is little hope of producing anything other than a chaotic mess.’ It is one thing to produce bricks; it is an entirely different thing to organize the building of a house or factory. If you had to, you could build a house using stones that you found lying around, in all the shapes and sizes in which they came due to natural causes. However, the organization of the building requires something that is not contained in the stones. It requires the intelligence of the architect and the skill of the builder. It is the same with the building blocks of life. Blind chance just will not do the job of putting them together in a specific way. Organic chemist and molecular biologist A.G. Cairns-Smith puts it this way: ‘Blind chance… is very limited… he can produce exceedingly easily the equivalent of letters and small words, but he becomes very quickly incompetent as the amount of organization increases. Very soon indeed long waiting periods and massive material resources become irrelevant.’

Bruce Alberts writes in Molecular biology of the cell :

Since each of the 20 amino acids is chemically distinct and each can, in principle, occur at any position in a protein chain, there are 20 x 20 x 20 x 20 = 160,000 different possible polypeptide chains four amino acids long, or 20n different possible polypeptide chains n amino acids long. For a typical protein length of about 300 amino acids, a cell could theoretically make more than 10^390  different pollpeptide chains. This is such an enormous number that to produce just one molecule of each kind would require many more atoms than exist in the universe. Only a very small fraction of this vast set of conceivable polypeptide chains would adopt a single, stable three-dimensional conformation-by some estimates, less than one in a billion. And yet the vast majority of proteins present in cells adopt unique and stable conformations. How is this possible?

The complexity of living organisms is staggering, and it is quite sobering to note that we currently lack even the tiniest hint of what the function might be for more than 10,000 of the proteins that have thus far been identified in the human genome. There are certainly enormous challenges ahead for the next generation of cell biologists, with no shortage of fascinating mysteries to solve.

Now comes Alberts  striking explanation of how the right sequence arised :

The answer Iies in natural selection. A protein with an unpredictably variable structure and biochemical activity is unlikely to help the survival of a cell that contains it. Such
proteins would therefore have been eliminated by natural selection through the enormously long trial-and-error process that underlies biological evolution. Because evolution has selected for protein function in living organisms, the amino acid sequence of most present-day proteins is such that a single conformation is extremely stable. In addition, this conformation has its chemical properties finely tuned to enable the protein to perform a particular catalltic or structural function in the cell. Proteins are so precisely built that the change of even a few atoms in one amino acid can sometimes disrupt the structure of the whole molecule so severelv that all function is lost.

Proteins are not rigid lumps of material. They often have precisely engineered moving parts whose mechanical actions are coupled to chemical events. It is this coupling of chemistry and movement that gives proteins the extraordinary capabilities that underlie the dynamic processes in living cells

Now think for a moment . It seems that natural selection  is the key answer to any phenomena in biology, where there is no scientific evidence to make a empricial claim. Much has been written about the fact that natural selection cannot produce coded information. Alberts short explanation is a prima facie example about how main stream sciencists  make without hesitation " just so "  claims without being able to provide a shred of evidence, just in order to mantain a paradigm on which the scientific establishment relies, where evolution is THE answer to almost every biochemical phenomena. Fact is that precision, coded information, stability, interdependence and irreducible complexity etc. are products of intelligent minds. The author seems also to forget that natural selection cannot occur before the first living cell replicates. Several hundred proteins had to be already in place and fully operating in order to make even the simplest life possible
Posted by: Wesley R. Elsberry on Nov. 16 2015,19:51

Critique of complex specified information

Critique of Dembski's 'explanatory filter'
Posted by: OgreMkV on Nov. 16 2015,19:54

Since each of the 20 amino acids is chemically distinct and each can, in principle, occur at any position in a protein chain, there are 20 x 20 x 20 x 20 = 160,000 different possible polypeptide chains four amino acids long, or 20n different possible polypeptide chains n amino acids long. For a typical protein length of about 300 amino acids, a cell could theoretically make more than 10^390  different pollpeptide chains. This is such an enormous number that to produce just one molecule of each kind would require many more atoms than exist in the universe. Only a very small fraction of this vast set of conceivable polypeptide chains would adopt a single, stable three-dimensional conformation-by some estimates, less than one in a billion. And yet the vast majority of proteins present in cells adopt unique and stable conformations. How is this possible?


Because, dummy, the proteins and such in YOUR body have been changing and forming correctly (because incorrectly formed proteins means the organism died) over the last billion years.

It's YOU guys who do "poof" it appears. Not evolutionary theory. Get it straight. Evolution isn't what you think it is.

BTW: Did you answer my questions? I doubt it.
Posted by: Occam's Aftershave on Nov. 16 2015,20:29

Quote (Otangelo @ Nov. 16 2015,19:03)
Fact is that precision, coded information, stability, interdependence and irreducible complexity etc. are products of intelligent minds.
---------------------QUOTE-------------------


Those things can be produced by intelligent minds but they don't have to be.  They can also be produced by non-intelligent iterative processes using feedback and heritability, exactly how evolution proceeds.  This has been demonstrated hundreds of times over with the workings of genetic algorithms.

     

---------------------QUOTE-------------------
The author seems also to forget that natural selection cannot occur before the first living cell replicates. Several hundred proteins had to be already in place and fully operating in order to make even the simplest life possible
---------------------QUOTE-------------------



FAIL again.  Evolution begins as soon as you have imperfect self replicators competing for resources.  Even the simplest pre-biotic self-replicating molecules would experience selection pressures.
Posted by: Otangelo on Nov. 16 2015,20:43

Quote (Occam's Aftershave @ Nov. 16 2015,20:29)
     
---------------------QUOTE-------------------




---------------------QUOTE-------------------
The author seems also to forget that natural selection cannot occur before the first living cell replicates. Several hundred proteins had to be already in place and fully operating in order to make even the simplest life possible

FAIL again.  Evolution begins as soon as you have imperfect self replicators competing for resources.  Even the simplest pre-biotic self-replicating molecules would experience selection pressures.
---------------------QUOTE-------------------



That's a pseudo scientific claim at its best.

< http://reasonandscience.heavenforum.org/t2110-w....ts#3797 >

Based on the conjoint analysis of several computational and experimental strategies designed to define the minimal set of protein-coding genes that are necessary to maintain a functional bacterial cell, we propose a minimal gene set composed of 206 genes. Such a gene set will be able to sustain the main
vital functions of a hypothetical simplest bacterial cell with the following features.

(i) A virtually complete DNA replication machinery, composed of one nucleoid DNA binding protein, SSB, DNA helicase, primase, gyrase, polymerase III, and ligase. No initiation and recruiting proteins seem to be essential, and the DNA gyrase is the only topoisomerase included, which should perform
both replication and chromosome segregation functions.

(ii) A very rudimentary system for DNA repair, including only one endonuclease, one exonuclease, and a uracyl-DNA glycosylase.

(iii) A virtually complete transcriptional machinery, including the three subunits of the RNA polymerase, a  factor, an RNA helicase, and four transcriptional factors (with elongation, antitermination, and transcription-translation coupling functions). Regulation of transcription does not appear to be essential in bacteria with reduced genomes, and therefore the minimal gene set does not contain any transcriptional regulators.

(iv) A nearly complete translational system. It contains the 20 aminoacyl-tRNA synthases, a methionyl-tRNA formyltransferase, five enzymes involved in tRNA maturation and modification, 50 ribosomal proteins (31 proteins for the large ribosomal subunit and 19 proteins for the small one), six proteins necessary for ribosome function and maturation (four of which are GTP binding proteins whose specific function is not well known), 12 translation factors, and 2 RNases involved in RNA degradation.

(v) Protein-processing, -folding, secretion, and degradation functions are performed by at least three proteins for posttranslational modification, two molecular chaperone systems (GroEL/S and DnaK/DnaJ/GrpE), six components of the translocase machinery (including the signal recognition particle, its receptor, the three essential components of the translocase channel, and a signal peptidase), one endopeptidase, and two proteases.

(vi) Cell division can be driven by FtsZ only, considering that, in a protected environment, the cell wall might not be necessary for cellular structure.

(vii) A basic substrate transport machinery cannot be clearly defined, based on our current knowledge. Although it appears that several cation and ABC transporters are always present in all analyzed bacteria, we have included in the minimal set only a PTS for glucose transport and a phosphate transporter. Further analysis should be performed to define a more complete set of transporters.

(viii) The energetic metabolism is based on ATP synthesis by glycolytic substrate-level phosphorylation.

(ix) The nonoxidative branch of the pentose pathway contains three enzymes (ribulose-phosphate epimerase, ribosephosphate isomerase, and transketolase), allowing the synthesis of pentoses (PRPP) from trioses or hexoses.

(x) No biosynthetic pathways for amino acids, since we suppose that they can be provided by the environment.

(xi) Lipid biosynthesis is reduced to the biosynthesis of phosphatidylethanolamine from the glycolytic intermediate dihydroxyacetone phosphate and activated fatty acids provided by the environment.

(xii) Nucleotide biosynthesis proceeds through the salvage pathways, from PRPP and the free bases adenine, guanine, and uracil, which are obtained from the environment.

(xiii) Most cofactor precursors (i.e., vitamins) are provided by the environment. Our proposed minimal cell performs only the steps for the syntheses of the strictly necessary coenzymes tetrahydrofolate, NAD, flavin aderine dinucleotide, thiamine diphosphate, pyridoxal phosphate, and CoA.
Posted by: Occam's Aftershave on Nov. 16 2015,20:53

Quote (Otangelo @ Nov. 16 2015,20:43)
That's a pseudo scientific claim at its best.
---------------------QUOTE-------------------


(Snip the rest of the drivel)

OK, you convinced us you can C&P large gobs of non-pertinent information.  Will you ever have an on-topic answer for the questions you keep running from?

How do you define "information" in biology and how do you measure it to tell if some new information arose?

ETA:  It's pretty dishonest to plagiarize a paper and not list it as your source.

< Determination of the Core of a Minimal Bacterial Gene Set >
Posted by: Richardthughes on Nov. 16 2015,20:58

Having fun with the copypastafarian, folks?
Posted by: Occam's Aftershave on Nov. 16 2015,21:01

Quote (Richardthughes @ Nov. 16 2015,20:58)
Having fun with the copypastafarian, folks?
---------------------QUOTE-------------------


I'm starting to think Batshit77 has a twin brother.   :O
Posted by: Dr.GH on Nov. 16 2015,21:26

Quote (Wesley R. Elsberry @ Nov. 16 2015,17:51)
<a href="'http://www.antievolution.org/people/wre/papers/eandsdembski.pdf'" target="_blank">Critique of complex specified information</a>

<a href="'http://www.talkdesign.org/cs/theft_over_toil'" target="_blank">Critique of Dembski's 'explanatory filter'</a>
---------------------QUOTE-------------------


Here ya go.

Read them again!  :D
Posted by: Dr.GH on Nov. 16 2015,21:35

Quote (Otangelo @ Nov. 16 2015,17:03)
The author seems also to forget that natural selection cannot occur before the first living cell replicates.
---------------------QUOTE-------------------


More ignorant bullshit from chewtoy.

Kauffman, Stuart A.
1994 "The Origins of Order: Self -Organization and Selection in Evolution" Oxford: Oxford University Press.

Mulkidjanian, Armen Y.,  Dmitry A Cherepanov, Michael Y Galperin
2003 "Survival of the fittest before the beginning of life: Selection of the first oligonucleotide-like polymers by UV light"  BMC Evolutionary Biology 2003 3:12
Posted by: fnxtr on Nov. 16 2015,21:55



---------------------QUOTE-------------------
Your list of scientific papers does not impress me in the slightest.
---------------------QUOTE-------------------



OK, who else thought of Behe at Dover? "These books are heavy."
Posted by: Dr.GH on Nov. 16 2015,22:42

Quote (fnxtr @ Nov. 16 2015,19:55)


---------------------QUOTE-------------------
Your list of scientific papers does not impress me in the slightest.
---------------------QUOTE-------------------



OK, who else thought of Behe at Dover? "These books are heavy."
---------------------QUOTE-------------------


Bawhaaaahaaha

Rothschild: Are you familiar with Dr. Hurd?

< Behe: No, I am not. >
Posted by: Richardthughes on Nov. 16 2015,22:55

Here's a brand new one: < http://m.pnas.org/content....ull.pdf >
Posted by: Cubist on Nov. 17 2015,03:10

Quote (Otangelo @ Nov. 16 2015,18:56)
Quote (Cubist @ Nov. 16 2015,18:43)
You have chosen to respond to what I wrote—that being, the ToE does not mandate that transitional fossils must necessarily survive to the present day—as if I had actually said something akin to the ToE does not require any evidence at all. Until such time as you elect to reply to what I wrote, rather than to what you imagine I wrote,I see no reason to engage with you further on this point.
---------------------QUOTE-------------------


Sorry, i do not understand your replies. What do you mean with :

ToE does not mandate that transitional fossils must necessarily survive to the present day ???
---------------------QUOTE-------------------


I meant exactly what I said: The theory of evolution does not mandate that any particular fossil (transitional or otherwise) must necessarily survive to the present day. This is because the theory of evolution does not mandate that any particular fossil be immune to physical damage. A fossil which is struck by lightning can end up shattered into zillions of unrecognizable bits; a fossil which is exposed to intense heat (such as the heat from a lightning-ignited forest fire, or from a volcanic lava flow) can end up burned or melted beyond recognition; a fossil which is subjected to intense pressure (such as from the impact of a heavy falling object) can end up crushed/shattered beyond recognition; and so on.

Of course, any fossil which has been identified by a human investigator is a fossil which has not been damaged beyond recognition. Since some fossils are sufficiently intact to be recognized as fossils, it's clear that the percentage of fossils which do get damaged beyond recognition must be something less than 100%. And those fossils which actually are found & identified in the fossil record, are among the less-than-100% of fossils which manage to avoid getting damaged beyond recognition by fire, pressure, lightning, etc.


---------------------QUOTE-------------------
If there are no transitional fossils in the fossil record, how would you confirm  the ToE in regard of paleontology?
---------------------QUOTE-------------------


Dunno. [shrug] Fortunately, the fossil record here in the RealWorld does contain various transitional fossils, so your question doesn't arise.


---------------------QUOTE-------------------


---------------------QUOTE-------------------
That's nice. It doesn't happen to be the "evidence of 'information-rich systems' being produced by 'intelligent agents' other than humans" I asked you for, but it's nice.
---------------------QUOTE-------------------


Once more your sentence is hard to understand. There is no reason to assume that humans are the only beings that can have intelligent thoughts.
---------------------QUOTE-------------------


You said it yourself:


---------------------QUOTE-------------------
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…
---------------------QUOTE-------------------


You argued, on the basis of "broad and repeated experience", that it's reasonable to presume that "intelligent agents… produce information-rich systems". I responded by pointing out that "broad and repeated experience" tells us that "information-rich systems" are not produced by nonspecific, vaguely-defined "intelligent agents" but, rather, by human beings. To the best of my knowledge, we do not have "broad and repeated experience" of "information-rich systems" created by "intelligent agents" other than human beings. More strongly: To the best of my knowledge, we have no experience whatsoever of "information-rich systems" created by "intelligent agents" other than human beings.

If you now want to argue that "information-rich systems" can be created by "agents" other than those (human) agents of which we do have "broad and repeated experience", that's cool—but in that case, you've just abandoned your own argument.
 

---------------------QUOTE-------------------
Complex, specified, coded information rich, interdependent and irreducible complex systems are best explained through a intelligent designer. Period.
---------------------QUOTE-------------------


[shrug] That's nice. Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
Posted by: Otangelo on Nov. 17 2015,03:38

Quote (Dr.GH @ Nov. 16 2015,21:35)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
These results suggest that accumulation of the first polynucleotides could be explained by their abiogenic selection as the most UV-resistant biopolymers.
---------------------QUOTE-------------------



what nonsense !!

< http://dwb.unl.edu/Teacher....yn.html >

Nucleotides are some of the largest monomers that have to be made by the cell and understandably their synthesis involves many steps and large amounts of energy.
Biosynthesis of nucleotides is under tight regulatory control in the cell. Organisms need to make just the right amount of each base; if too much is made, energy is wasted, if too little, DNA replication and cellular metabolism come to a halt. Also, the cell is sensitive to the presence of any premade nucleotides in its environment and will down regulate their de novo synthesis pathways in favor of using what is already present in the surroundings. Bacteria are capable of interconverting purines (adenine and guanine) and interconverting pyrimidines (thymidine, cytidine and uracil). If a growth medium provides a purine and a pyrimidine, many microbes are capable of synthesizing the other needed nucleotides from them.

All nucleotides contain a ribose sugar and phosphate that form the backbone of DNA and RNA. These are synthesized from ribose 5-phosphate, a central metabolite of the pentose phosphate pathway.
Posted by: Otangelo on Nov. 17 2015,03:48

Quote (Cubist @ Nov. 17 2015,03:10)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Fortunately, the fossil record here in the RealWorld does contain various transitional fossils, so your question doesn't arise.
---------------------QUOTE-------------------



I think there is enough evidence to say, the fossil record does NOT confirm the ToE :

Did Darwin also predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found ??

< http://www.uncommondescent.com/darwini....-sanity >

In Explaining the Cambrian Explosion, Has the TalkOrigins Archive Resolved Darwin’s Dilemma? – JonathanM – May 2012
Excerpt: it is the pattern of morphological disparity preceding diversity that is fundamentally at odds with the neo-Darwinian scenario of gradualism. All of the major differences (i.e. the higher taxonomic categories such as phyla) appear first in the fossil record and then the lesser taxonomic categories such as classes, orders, families, genera and species appear later. On the Darwinian view, one would expect to see all of the major differences in body plan appear only after numerous small-scale speciation events. But this is not what we observe.
< http://www.evolutionnews.org/2.....5....71.html >

Challenging Fossil of a Little Fish – 2000
“In Chen’s view, his evidence supports a history of life that runs opposite to the standard evolutionary tree diagrams, a progression he calls top-down evolution.”
Jun-Yuan Chen is professor at the Nanjing Institute of Paleontology and Geology
< http://www.fredheeren.com/boston.....ton.htm >

Scientific study turns understanding about evolution on its head – July 30, 2013
Excerpt: evolutionary biologists,,, looked at nearly one hundred fossil groups to test the notion that it takes groups of animals many millions of years to reach their maximum diversity of form.
Contrary to popular belief, not all animal groups continued to evolve fundamentally new morphologies through time. The majority actually achieved their greatest diversity of form (disparity) relatively early in their histories.
,,,Dr Matthew Wills said: “This pattern, known as ‘early high disparity’, turns the traditional V-shaped cone model of evolution on its head. What is equally surprising in our findings is that groups of animals are likely to show early-high disparity regardless of when they originated over the last half a billion years. This isn’t a phenomenon particularly associated with the first radiation of animals (in the Cambrian Explosion), or periods in the immediate wake of mass extinctions.”,,,
Author Martin Hughes, continued: “Our work implies that there must be constraints on the range of forms within animal groups, and that these limits are often hit relatively early on.
Co-author Dr Sylvain Gerber, added: “A key question now is what prevents groups from generating fundamentally new forms later on in their evolution.,,,
< http://phys.org/news....on.html >



---------------------QUOTE-------------------
Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------



Once its granted that non-intelligence mechanisms are unable to create information-rich systems, your question is moot.

We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.
Posted by: Otangelo on Nov. 17 2015,04:20

Quote (Dr.GH @ Nov. 16 2015,21:35)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Mulkidjanian, Armen Y.,  Dmitry A Cherepanov, Michael Y Galperin
2003 "Survival of the fittest before the beginning of life: Selection of the first oligonucleotide-like polymers by UV light"  BMC Evolutionary Biology 2003 3:12
---------------------QUOTE-------------------



Furthermore, its quite dumb to assume that something can survive, that is not alive.... LOL....

and :

< http://reasonandscience.heavenforum.org/t1279-a....ossible >

In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.
Posted by: The whole truth on Nov. 17 2015,05:11

Quote (Otangelo @ Nov. 17 2015,01:48)
[quote=Cubist,Nov. 17 2015,03:10][/quote]


---------------------QUOTE-------------------
Fortunately, the fossil record here in the RealWorld does contain various transitional fossils, so your question doesn't arise.
---------------------QUOTE-------------------



I think there is enough evidence to say, the fossil record does NOT confirm the ToE :

Did Darwin also predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found ??

< http://www.uncommondescent.com/darwini....-sanity >

In Explaining the Cambrian Explosion, Has the TalkOrigins Archive Resolved Darwin’s Dilemma? – JonathanM – May 2012
Excerpt: it is the pattern of morphological disparity preceding diversity that is fundamentally at odds with the neo-Darwinian scenario of gradualism. All of the major differences (i.e. the higher taxonomic categories such as phyla) appear first in the fossil record and then the lesser taxonomic categories such as classes, orders, families, genera and species appear later. On the Darwinian view, one would expect to see all of the major differences in body plan appear only after numerous small-scale speciation events. But this is not what we observe.
< http://www.evolutionnews.org/2.....5....71.html >

Challenging Fossil of a Little Fish – 2000
“In Chen’s view, his evidence supports a history of life that runs opposite to the standard evolutionary tree diagrams, a progression he calls top-down evolution.”
Jun-Yuan Chen is professor at the Nanjing Institute of Paleontology and Geology
< http://www.fredheeren.com/boston.....ton.htm >

Scientific study turns understanding about evolution on its head – July 30, 2013
Excerpt: evolutionary biologists,,, looked at nearly one hundred fossil groups to test the notion that it takes groups of animals many millions of years to reach their maximum diversity of form.
Contrary to popular belief, not all animal groups continued to evolve fundamentally new morphologies through time. The majority actually achieved their greatest diversity of form (disparity) relatively early in their histories.
,,,Dr Matthew Wills said: “This pattern, known as ‘early high disparity’, turns the traditional V-shaped cone model of evolution on its head. What is equally surprising in our findings is that groups of animals are likely to show early-high disparity regardless of when they originated over the last half a billion years. This isn’t a phenomenon particularly associated with the first radiation of animals (in the Cambrian Explosion), or periods in the immediate wake of mass extinctions.”,,,
Author Martin Hughes, continued: “Our work implies that there must be constraints on the range of forms within animal groups, and that these limits are often hit relatively early on.
Co-author Dr Sylvain Gerber, added: “A key question now is what prevents groups from generating fundamentally new forms later on in their evolution.,,,
< http://phys.org/news.......on.html >



---------------------QUOTE-------------------
Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------



Once its granted that non-intelligence mechanisms are unable to create information-rich systems, your question is moot.

We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.
---------------------QUOTE-------------------


Hey Otangelo, ElShamah, etc., did allah-yahoo-satan-yeshoo-holy-spook "predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found"? Is there such a prediction in the bible and koran? LOL

"We know that...". "We" do, in the way that you're asserting?

I accept that some organisms other than humans are 'intelligent' to some degree, but what you're spewing is delusional bullshit.
Posted by: Otangelo on Nov. 17 2015,05:23

Quote (The whole truth @ Nov. 17 2015,05:11)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Hey Otangelo, ElShamah, etc., did allah-yahoo-satan-yeshoo-holy-spook "predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found"? Is there such a prediction in the bible and koran? LOL
---------------------QUOTE-------------------



Did i mention anywhere any holy book ??!!

All i say is that soft tissue found in fossils indicates a young age, not millions of years.
Posted by: Soapy Sam on Nov. 17 2015,05:38

Quote (Otangelo @ Nov. 17 2015,10:20)
If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.
---------------------QUOTE-------------------


What a load of crap. Photolysis generates a net yield of amino acids from simpler precursors. If amino acids were 'destroyed' by uv light, this would not be the case. Nor is it necessary for things to be restricted to the atmosphere.
Posted by: Otangelo on Nov. 17 2015,05:46

Quote (Soapy Sam @ Nov. 17 2015,05:38)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
What a load of crap. Photolysis generates a net yield of amino acids from simpler precursors.
---------------------QUOTE-------------------



please provide a scientific source to back up your claim


If amino acids were 'destroyed' by uv light, this would not be the case. Nor is it necessary for things to be restricted to the atmosphere.[/QUOTE]

what do you suggest ? oceans ? prebiotic soup ?
Posted by: The whole truth on Nov. 17 2015,06:03

Quote (Otangelo @ Nov. 17 2015,03:23)
[quote=The whole truth,Nov. 17 2015,05:11][/quote]


---------------------QUOTE-------------------
Hey Otangelo, ElShamah, etc., did allah-yahoo-satan-yeshoo-holy-spook "predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found"? Is there such a prediction in the bible and koran? LOL
---------------------QUOTE-------------------



Did i mention anywhere any holy book ??!!

All i say is that soft tissue found in fossils indicates a young age, not millions of years.
---------------------QUOTE-------------------


Did anyone mention Darwin before you did??!11!???111!!!1!!111??!!!11?!11!!!!11?!1.................

As Ogre said:

" What the hell does Darwin have to do with anything?

Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution. None of which support any notion of ID. These papers are as far beyond Darwin could even imagine as my cell phone is to a Victorian detective."

And you should stop playing your dishonest games. The so-called 'designer' that you and the other IDiot-creationists are pushing is the so-called 'Abrahamic God' (allah-yahoo-yeshoo-holy-spook) and 'his' helpers (satan, angels, demons, etc.). Calling your imaginary 'God' and 'his' helpers 'the designer' just shows that you're a con man.

By the way, does your 'God' have a penis?
Posted by: Soapy Sam on Nov. 17 2015,06:16

Quote (Otangelo @ Nov. 17 2015,11:46)
       
Quote (Soapy Sam @ Nov. 17 2015,05:38)

---------------------QUOTE-------------------


       

---------------------QUOTE-------------------
What a load of crap. Photolysis generates a net yield of amino acids from simpler precursors.
---------------------QUOTE-------------------



please provide a scientific source to back up your claim.
---------------------QUOTE-------------------



Google it. Educate yourself. Yields are low, but nonetheless the reaction proceeds in the direction of formation (depending to some degree on the hydrogen cyanide concentration).


     
Quote (Otangelo @ Nov. 17 2015,11:46)
       
Quote (Soapy Sam @ Nov. 17 2015,05:38)

If amino acids were 'destroyed' by uv light, this would not be the case. Nor is it necessary for things to be restricted to the atmosphere.

---------------------QUOTE-------------------

what do you suggest ? oceans ? prebiotic soup ?
---------------------QUOTE-------------------



I suggest not-necessarily-the-atmosphere. If your simplistic schema regarding amino acids and uv were true, it simply precludes long-term retention at the surface (depending, of course, on how cloudy it is...). The simple answer then would be: somewhere else. I don't have to join the dots, I'm simply refuting your simplistic argument.
Posted by: Otangelo on Nov. 17 2015,06:18

Quote (The whole truth @ Nov. 17 2015,06:03)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution.
---------------------QUOTE-------------------



haha, thats a good one.

1. modern science relies on methodological naturalism. Other than natural mechanisms are not permitted as explanation. Since evolution is the only natural proposal of biodiversity, evolution is not the outcome or inference, but the premise. Show one, just ONE scientific paper, that starts with a agostic standpoint, and ends with evolution as the best explanation amongst the two possible ones, that is naturalism, and design. Begging the question is not a exception. Its the norm of 99,999999% scientific papers.

2. Abiogenesis has nothing to do with evolution.

3. When it comes to origins, rather than provide compelling explanations and elucidation of how natural mechanisms provided the outcome in question, a big part admits ignorance , where , if replaced with intelligent design, the inference would make perfect sense. And the gap rather than closing, is widening, the more science opens the black box.

I am collecting these papers which admit ignorance:

< http://reasonandscience.heavenforum.org/t1584-o....science >

[QUOTE][ None of which support any notion of ID./QUOTE]

Furthermore, sometime scientific papers slip through that do implicitly admit intelligent design :

< http://reasonandscience.heavenforum.org/t1498-s....plexity >

This paper published online his summer is a true mind-blower showing the irreducible organizational complexity (author’s description) of DNA analog and digital information, that genes are not arbitrarily positioned on the chromosome etc.


[QUOTE][And you should stop playing your dishonest games./QUOTE]

Thats a acusation i am acostumed with. I am being called dishonest, and other names all the times. Sorry, that is imho not the way to make a point....


 

---------------------QUOTE-------------------
The so-called 'designer' that you and the other IDiot-creationists are pushing is the so-called 'Abrahamic God' (allah-yahoo-yeshoo-holy-spook) and 'his' helpers (satan, angels, demons, etc.). Calling your imaginary 'God' and 'his' helpers 'the designer' just shows that you're a con man.

By the way, does your 'God' have a penis?
---------------------QUOTE-------------------



So you are unaware why we do make a distinction between creationism, and intelligent design ? Educate yourself better, before making foolish acusations and expose your ignorance.
Posted by: Otangelo on Nov. 17 2015,06:21

Quote (Soapy Sam @ Nov. 17 2015,06:16)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Google it. Educate yourself. Yields are low, but nonetheless the reaction proceeds in the direction of formation (depending to some degree on the hydrogen cyanide concentration).
---------------------QUOTE-------------------



I dont have to make your homework. You raise the argument, you back it up.....
Posted by: Soapy Sam on Nov. 17 2015,06:51

Quote (Otangelo @ Nov. 17 2015,12:21)
Quote (Soapy Sam @ Nov. 17 2015,06:16)

---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
Google it. Educate yourself. Yields are low, but nonetheless the reaction proceeds in the direction of formation (depending to some degree on the hydrogen cyanide concentration).
---------------------QUOTE-------------------



I dont have to make your homework. You raise the argument, you back it up.....
---------------------QUOTE-------------------


HAHA! Oh, the irony. Please yourself. If you want to talk shite on the net, failing to back up your own claim that the absence of an ozone layer is fatally inimical to amino acid synthesis, you carry on.

Are we supposed to just take your original bald photolysis assertion as valid unless 'scientifically' refuted? Why should I do work you won't put in yourself, lazy-arse?
Posted by: fusilier on Nov. 17 2015,06:51

[quote=Otangelo,Nov. 15 2015,19:26]
Quote (OgreMkV @ Nov. 15 2015,15:07)
{snip}
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? {snip}
---------------------QUOTE-------------------


I hope I'm not too late with this, but in 1918, 35 years before Prof. Behe was born, H.J. Muller proposed the idea of "interlocking complexity" as a consequence of Descent with Modification.

As other posters have already pointed out, "Complex Specified Information" is completely undefined, except as "That ineffable property which only Go ...err, sorry, ... The Disembodied Telic Entity can produce."
Posted by: The whole truth on Nov. 17 2015,07:11

Quote (Otangelo @ Nov. 17 2015,04:18)
[quote=The whole truth,Nov. 17 2015,06:03]
---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution.
---------------------QUOTE-------------------



haha, thats a good one.

1. modern science relies on methodological naturalism. Other than natural mechanisms are not permitted as explanation. Since evolution is the only natural proposal of biodiversity, evolution is not the outcome or inference, but the premise. Show one, just ONE scientific paper, that starts with a agostic standpoint, and ends with evolution as the best explanation amongst the two possible ones, that is naturalism, and design. Begging the question is not a exception. Its the norm of 99,999999% scientific papers.

2. Abiogenesis has nothing to do with evolution.

3. When it comes to origins, rather than provide compelling explanations and elucidation of how natural mechanisms provided the outcome in question, a big part admits ignorance , where , if replaced with intelligent design, the inference would make perfect sense. And the gap rather than closing, is widening, the more science opens the black box.

I am collecting these papers which admit ignorance:

< http://reasonandscience.heavenforum.org/t1584-o....science >

[QUOTE][ None of which support any notion of ID./QUOTE]

Furthermore, sometime scientific papers slip through that do implicitly admit intelligent design :

< http://reasonandscience.heavenforum.org/t1498-s....plexity >

This paper published online his summer is a true mind-blower showing the irreducible organizational complexity (author’s description) of DNA analog and digital information, that genes are not arbitrarily positioned on the chromosome etc.




---------------------QUOTE-------------------
[And you should stop playing your dishonest games./QUOTE]

Thats a acusation i am acostumed with. I am being called dishonest, and other names all the times. Sorry, that is imho not the way to make a point....


   

---------------------QUOTE-------------------
The so-called 'designer' that you and the other IDiot-creationists are pushing is the so-called 'Abrahamic God' (allah-yahoo-yeshoo-holy-spook) and 'his' helpers (satan, angels, demons, etc.). Calling your imaginary 'God' and 'his' helpers 'the designer' just shows that you're a con man.

By the way, does your 'God' have a penis?
---------------------QUOTE-------------------



So you are unaware why we do make a distinction between creationism, and intelligent design ? Educate yourself better, before making foolish acusations and expose your ignorance.
---------------------QUOTE-------------------


"So you are unaware why we do make a distinction between creationism, and intelligent design ?"

I'm thoroughly aware of why you cdesign proponentsists try to make a distinction between creationism and intelligent design.

"Other than natural mechanisms..."

And your detailed, scientific evidence and compelling explanation and elucidation of the alleged other than natural (just say supernatural, con man) "mechanisms" is? Is 'speaking' things into existence a "mechanism"?  

"Abiogenesis has nothing to do with evolution."

Really? Then shouldn't you IDiot-creationists stop connecting abiogenesis to evolution and shut the hell up about "origins"?

"if replaced with intelligent design, the inference would make perfect sense..."

You're absolutely right and I've been telling people for years that Fifi the Pink Unicorn God and her herd of My Little Ponies (with some help from the Flying Spaghetti Monster) are the intelligent designers-creators-guiders of everything. I'm sure that you agree with me.

"This paper published online his summer is a true mind-blower showing the irreducible organizational complexity (author’s description) of DNA analog and digital information, that genes are not arbitrarily positioned on the chromosome etc."

Therefor jesus?

"Thats a acusation i am acostumed with. I am being called dishonest, and other names all the times. Sorry, that is imho not the way to make a point...."

My point is accurate.
Posted by: Otangelo on Nov. 17 2015,14:55

Quote (Soapy Sam @ Nov. 17 2015,06:51)

---------------------QUOTE-------------------




---------------------QUOTE-------------------

HAHA! Oh, the irony.
---------------------QUOTE-------------------



yep......photolysis actually isnt helping your case....

< http://reasonandscience.heavenforum.org/t1556-t....osphere >

Ozone plays a beneficial role by absorbing most of the biologically damaging ultraviolet sunlight (called UV-B), allowing only a small amount to reach the Earth's surface. Ozone thus plays a key role in the temperature structure of the Earth's atmosphere. Without the filtering action of the ozone layer, more of the Sun's UV-B radiation would penetrate the atmosphere and would reach the Earth's surface.
In the atmosphere Oxygen is freed by the process called photolysis. This is when high energy sunlight breaks apart oxygen bearing molecules to produce free oxygen. One of the most well known photolysis it the ozone cycle. O2 oxygen molecule is broken down to atomic oxygen by the ultra violet radiation of sunlight. This free oxygen then recombines with existing O2 molecules to make O3 or ozone. This cycle is important because it helps to shield the Earth from the majority of harmful ultra violet radiation turning it to harmless heat before it reaches the Earth’s surface.

The assumption of an oxygen-free atmosphere has also been rejected on theoretical grounds. The ozone layer around planet earth consists of a thin but critical blanket of oxygen gas in the upper atmosphere. This layer of oxygen gas blocks deadly levels of ultraviolet radiation from the sun.9 Without oxygen in the early atmosphere, there could have been no ozone layer over that early earth. Without an ozone layer, all life on the surface of planet earth would face certain death from exposure to intense ultraviolet radiation. Furthermore, the chemical building blocks of proteins, RNA and DNA, would be quickly annihilated because ultraviolet radiation destroys their chemical bonds.10 It doesn't matter if these newly formed building blocks are in the atmosphere, on dry ground, or under water.
Posted by: Otangelo on Nov. 17 2015,14:58

Quote (The whole truth @ Nov. 17 2015,07:11)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
You're absolutely right and I've been telling people for years that Fifi the Pink Unicorn God and her herd of My Little Ponies (with some help from the Flying Spaghetti Monster) are the intelligent designers-creators-guiders of everything. I'm sure that you agree with me.
---------------------QUOTE-------------------



I dear you. How couldnt i agree more... LOL...

The problem is with the "God concept" of the so called "invisible pink unicorn."

< http://reasonandscience.heavenforum.org/t1881-w....ht=pink >

First, the ipu is NOT infinite (or it wouldn't be a unicorn) so it does NOT compare with an Infinite Creator.

Second, you know that unicorns (especially pink ones) are a literary
construct which DO NOT explain infinite regress (with respect to Uncaused
Cause, or Unmoved Mover).

Third, you don't have people all over the world worshipping the ipu and
claiming to have a personal relationship with this ipu. There are no
worship songs that I am aware of that are sung by congregations to
the ipu.

Fourth, we are not created in the Image of a horse with a single horn, in
that horses in general do not think, create and work with complex mathematics. Horses are not artistic.

Fifth, the ipu is temporal and moves from place to place and experience
duration (and is limited) from a linear progressive consecutive point of
view. (experiences time by moving from place to place).

Sixth, the invisible pink unicorn has negative evidence to its contrary
(to NOT believe it in). It is nonsense and a ridiculous appeal to an
imaginary construct which doesn't deal with the premises of an Infinite
Creator Who explains infinite regressions.

Seventh, the invisible pink unicorn never became a Man and died for the
sins of the world to demonstrate His Self-Sacrificing Love.
Posted by: Otangelo on Nov. 17 2015,15:03

Quote (fusilier @ Nov. 17 2015,06:51)
[quote=Otangelo,Nov. 15 2015,19:26]
Quote (OgreMkV @ Nov. 15 2015,15:07)
{snip}
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? {snip}
---------------------QUOTE-------------------


I hope I'm not too late with this, but in 1918, 35 years before Prof. Behe was born, H.J. Muller proposed the idea of "interlocking complexity" as a consequence of Descent with Modification.

As other posters have already pointed out, "Complex Specified Information" is completely undefined, except as "That ineffable property which only Go ...err, sorry, ... The Disembodied Telic Entity can produce."
---------------------QUOTE-------------------


Behe's Critics' Scaffolding Falls Down

< http://reasonandscience.heavenforum.org/t1656-h....ed#4297 >

And there's another problem with the scaffolding objection. Behe defines irreducible complexity as requiring not just one part, but "several well-matched, interacting parts."


Even if you end up with an irreducibly complex system by removing parts from scaffolding, you still had to build the scaffolding. How does unguided evolution build the scaffolding by adding parts?

In that regard, adding parts to build scaffolding may be more complicated than ID critics would admit. Adding a part isn't always that simple, even if it isn't indispensible. Sometimes simply getting a functional protein-protein interaction is beyond the reach of Darwinian evolution. In 2004, Behe and Snoke published a paper in Protein Science reporting results of computer simulations and theoretical calculations. They showed that the Darwinian evolution of a simple functional bond between two proteins would be highly unlikely to occur in populations of multicellular organisms. The reason, simply put, is because too many amino acids would have to be fixed by non-adaptive mutations before gaining any functional binding interaction.
Posted by: Occam's Aftershave on Nov. 17 2015,15:09

Quote (Otangelo @ Nov. 17 2015,14:58)
The problem is with the "God concept" of the so called "invisible pink unicorn."
---------------------QUOTE-------------------


I have it on good authority the Invisible Pink Unicorn is a Supergod who created your puny God out of boredom one rainy Saturday afternoon.  

Refute that if you can.
Posted by: Occam's Aftershave on Nov. 17 2015,15:14

Quote (Otangelo @ Nov. 17 2015,15:03)
And there's another problem with the scaffolding objection. Behe defines irreducible complexity as requiring not just one part, but "several well-matched, interacting parts."
---------------------QUOTE-------------------



Behe is an idiot whose arguments based on IC were gutted years ago.



---------------------QUOTE-------------------
Even if you end up with an irreducibly complex system by removing parts from scaffolding, you still had to build the scaffolding. How does unguided evolution build the scaffolding by adding parts?
---------------------QUOTE-------------------



Like this.


Posted by: Texas Teach on Nov. 17 2015,17:49

Quote (Otangelo @ Nov. 17 2015,03:48)
We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.
---------------------QUOTE-------------------


You do realize "Ghostbusters" wasn't a documentary?
Posted by: Texas Teach on Nov. 17 2015,17:51

Quote (Richardthughes @ Nov. 16 2015,20:58)
Having fun with the copypastafarian, folks?
---------------------QUOTE-------------------


More fun than Gaulin's diary/autobiography.

But that bar's pretty low.
Posted by: Richardthughes on Nov. 17 2015,18:38

Quote (Texas Teach @ Nov. 17 2015,17:51)
Quote (Richardthughes @ Nov. 16 2015,20:58)
Having fun with the copypastafarian, folks?
---------------------QUOTE-------------------


More fun than Gaulin's diary/autobiography.

But that bar's pretty low.
---------------------QUOTE-------------------


Gary will be

attention whores, both of them.
Posted by: Otangelo on Nov. 17 2015,18:44

Quote (Texas Teach @ Nov. 17 2015,17:49)
Quote (Otangelo @ Nov. 17 2015,03:48)
We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.
---------------------QUOTE-------------------


You do realize "Ghostbusters" wasn't a documentary?
---------------------QUOTE-------------------


< http://reasonandscience.heavenforum.org/t1284-n....dualism >


Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands

< http://profezie3m.altervista.org/archivi....NDE.htm >

division of Cardiology, Hospital Rijnstate, Arnhem, Netherlands (P van Lommel MD); Tilburg, Netherlands (R van Wees PhD); Nijmegen, Netherlands (V Meyers PhD); and Capelle a/d Ijssel, Netherlands (I Elfferich PhD)

"During a night shift an ambulance brings in a 44-year-old cyanotic, comatose man into the coronary care unit. He had been found about an hour before in a meadow by passers-by. After admission, he receives artificial respiration without intubation, while heart massage and defibrillation are also applied. When we want to intubate the patient, he turns out to have dentures in his mouth. I remove these upper dentures and put them onto the 'crash car'. Meanwhile, we continue extensive CPR. After about an hour and a half the patient has sufficient heart rhythm and blood pressure, but he is still ventilated and intubated, and he is still comatose. He is transferred to the intensive care unit to continue the necessary artificial respiration. Only after more than a week do I meet again with the patient, who is by now back on the cardiac ward. I distribute his medication. The moment he sees me he says: 'Oh, that nurse knows where my dentures are'. I am very surprised. Then he elucidates: 'Yes, you were there when I was brought into hospital and you took my dentures out of my mouth and put them onto that car, it had all these bottles on it and there was this sliding drawer underneath and there you put my teeth.' I was especially amazed because I remembered this happening while the man was in deep coma and in the process of CPR. When I asked further, it appeared the man had seen himself lying in bed, that he had perceived from above how nurses and doctors had been busy with CPR. He was also able to describe correctly and in detail the small room in which he had been resuscitated as well as the appearance of those present like myself. At the time that he observed the situation he had been very much afraid that we would stop CPR and that he would die. And it is true that we had been very negative about the patient's prognosis due to his very poor medical condition when admitted. The patient tells me that he desperately and unsuccessfully tried to make it clear to us that he was still alive and that we should continue CPR. He is deeply impressed by his experience and says he is no longer afraid of death. 4 weeks later he left hospital as a healthy man."
Posted by: Richardthughes on Nov. 17 2015,19:12

Quote (Otangelo @ Nov. 17 2015,18:44)
Quote (Texas Teach @ Nov. 17 2015,17:49)
Quote (Otangelo @ Nov. 17 2015,03:48)
We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.
---------------------QUOTE-------------------


You do realize "Ghostbusters" wasn't a documentary?
---------------------QUOTE-------------------


< http://reasonandscience.heavenforum.org/t1284-n....dualism >


Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands

< http://profezie3m.altervista.org/archivi....NDE.htm >

division of Cardiology, Hospital Rijnstate, Arnhem, Netherlands (P van Lommel MD); Tilburg, Netherlands (R van Wees PhD); Nijmegen, Netherlands (V Meyers PhD); and Capelle a/d Ijssel, Netherlands (I Elfferich PhD)

"During a night shift an ambulance brings in a 44-year-old cyanotic, comatose man into the coronary care unit. He had been found about an hour before in a meadow by passers-by. After admission, he receives artificial respiration without intubation, while heart massage and defibrillation are also applied. When we want to intubate the patient, he turns out to have dentures in his mouth. I remove these upper dentures and put them onto the 'crash car'. Meanwhile, we continue extensive CPR. After about an hour and a half the patient has sufficient heart rhythm and blood pressure, but he is still ventilated and intubated, and he is still comatose. He is transferred to the intensive care unit to continue the necessary artificial respiration. Only after more than a week do I meet again with the patient, who is by now back on the cardiac ward. I distribute his medication. The moment he sees me he says: 'Oh, that nurse knows where my dentures are'. I am very surprised. Then he elucidates: 'Yes, you were there when I was brought into hospital and you took my dentures out of my mouth and put them onto that car, it had all these bottles on it and there was this sliding drawer underneath and there you put my teeth.' I was especially amazed because I remembered this happening while the man was in deep coma and in the process of CPR. When I asked further, it appeared the man had seen himself lying in bed, that he had perceived from above how nurses and doctors had been busy with CPR. He was also able to describe correctly and in detail the small room in which he had been resuscitated as well as the appearance of those present like myself. At the time that he observed the situation he had been very much afraid that we would stop CPR and that he would die. And it is true that we had been very negative about the patient's prognosis due to his very poor medical condition when admitted. The patient tells me that he desperately and unsuccessfully tried to make it clear to us that he was still alive and that we should continue CPR. He is deeply impressed by his experience and says he is no longer afraid of death. 4 weeks later he left hospital as a healthy man."
---------------------QUOTE-------------------


< http://www.scientificamerican.com/article....r-death >
Posted by: Occam's Aftershave on Nov. 17 2015,19:20

Quote (Otangelo @ Nov. 17 2015,18:44)
Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands
---------------------QUOTE-------------------


(facepalm) Now we gotta listen to this woo. You must have to pass a gullibility test in which you reject all science for speculative nonsense to be a YEC.
Posted by: Jim_Wynne on Nov. 17 2015,19:46

Quote (Occam's Aftershave @ Nov. 17 2015,19:20)
Quote (Otangelo @ Nov. 17 2015,18:44)
Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands
---------------------QUOTE-------------------


(facepalm) Now we gotta listen to this woo. You must have to pass a gullibility test in which you reject all science for speculative nonsense to be a YEC.
---------------------QUOTE-------------------


To actually believe in YEC one has to be delusional, but to espouse it one only has to be deceitful.  Of course there can be some combination of the two.
Posted by: fnxtr on Nov. 17 2015,20:03

Meh.

YHWH is a literary construct, too. Like Zeus and Odin.

Yawn.
Posted by: OgreMkV on Nov. 17 2015,21:26

To Otangelo, science is only useful when he thinks it supports his beliefs.

Just like every other creationist. Shame about that.
Posted by: The whole truth on Nov. 17 2015,22:24

Quote (Otangelo @ Nov. 17 2015,12:58)
[quote=The whole truth,Nov. 17 2015,07:11][/quote]


---------------------QUOTE-------------------
You're absolutely right and I've been telling people for years that Fifi the Pink Unicorn God and her herd of My Little Ponies (with some help from the Flying Spaghetti Monster) are the intelligent designers-creators-guiders of everything. I'm sure that you agree with me.
---------------------QUOTE-------------------



I dear you. How couldnt i agree more... LOL...

The problem is with the "God concept" of the so called "invisible pink unicorn."

< http://reasonandscience.heavenforum.org/t1881-w....ht=pink >

First, the ipu is NOT infinite (or it wouldn't be a unicorn) so it does NOT compare with an Infinite Creator.

Second, you know that unicorns (especially pink ones) are a literary
construct which DO NOT explain infinite regress (with respect to Uncaused
Cause, or Unmoved Mover).

Third, you don't have people all over the world worshipping the ipu and
claiming to have a personal relationship with this ipu. There are no
worship songs that I am aware of that are sung by congregations to
the ipu.

Fourth, we are not created in the Image of a horse with a single horn, in
that horses in general do not think, create and work with complex mathematics. Horses are not artistic.

Fifth, the ipu is temporal and moves from place to place and experience
duration (and is limited) from a linear progressive consecutive point of
view. (experiences time by moving from place to place).

Sixth, the invisible pink unicorn has negative evidence to its contrary
(to NOT believe it in). It is nonsense and a ridiculous appeal to an
imaginary construct which doesn't deal with the premises of an Infinite
Creator Who explains infinite regressions.

Seventh, the invisible pink unicorn never became a Man and died for the
sins of the world to demonstrate His Self-Sacrificing Love.
---------------------QUOTE-------------------


Blasphemer! Bigot! Truth hater! Evil purveyor and worshiper of a false God! Fool! You better pray to Fifi and the FSM and beg them to have mercy on you.
Posted by: JAM on Nov. 17 2015,23:50

[quote=Otangelo,Nov. 15 2015,21:09][/quote]
 

---------------------QUOTE-------------------
No evidence that RNA molecules ever had the broad range of catalytic activities
---------------------QUOTE-------------------



No evidence? That's a lie.

What is peptidyltransferase? I suggest you reply in two parts:

1) Meyer's lie; and
2) The truth.

 

---------------------QUOTE-------------------
an ability to catalyze every step of protein synthesis." The RNA world is thus a hypothetical system behind which there is little positive evidence,
---------------------QUOTE-------------------


Peptidyltransferase catalyzes the central stem in protein synthesis. What is it? This is a simple factual question.

 

---------------------QUOTE-------------------
… investigators have proposed many hypotheses, but evidence in favor of each of them is fragmentary at best.
---------------------QUOTE-------------------


When was that written and what is peptidyltransferase?
 

---------------------QUOTE-------------------
The full details of how the RNA world, and life, emerged may not be revealed in the near future.
---------------------QUOTE-------------------


At least we know the details for peptidyltransferase. Why does Meyer lie to his readers about it?

 

---------------------QUOTE-------------------
The best claimed evidence of an "RNA World" includes the fact that there are RNA enzymes and genomes, and that cells use RNA to convert the DNA code into proteins.
---------------------QUOTE-------------------


Lie.
 

---------------------QUOTE-------------------
However, RNA plays only a supporting role in the cell,
---------------------QUOTE-------------------


Another lie. What is peptidyltransferase?

 

---------------------QUOTE-------------------
RNA experts have created a variety of RNA molecules which can perform biochemical functions through what is commonly termed "test tube evolution."
---------------------QUOTE-------------------


What performs the essential function of peptidyltransferase?
 

---------------------QUOTE-------------------
However, "test tube evolution" is just a description for what is in reality nothing more than chemical engineering in the laboratory employing Darwinian principles; that does not imply that there is some known pathway through which these molecules could arise naturally.
---------------------QUOTE-------------------


I'm talking about the peptidyltransferase that is the center of protein synthesis in your body.
Posted by: Soapy Sam on Nov. 18 2015,03:41

Quote (Otangelo @ Nov. 17 2015,20:55)
     
Quote (Soapy Sam @ Nov. 17 2015,06:51)

---------------------QUOTE-------------------


       

---------------------QUOTE-------------------

HAHA! Oh, the irony.
---------------------QUOTE-------------------



yep......photolysis actually isnt helping your case.... [...]


---------------------QUOTE-------------------



You just respond to trigger words. 'Photolysis? Oh yeah, I've heard of that ... lemme see ... I think I've written something on that ...(copypastecopypaste)'.

Photolysis of simpler molecules can generate amino acids (at, admittedly, low yields). Therefore, the thermodynamics of the situation cannot automatically mean that all amino acids will be destroyed by uv. You want a reference? Your own reference was to your own frigging musings! So I'll reference mine in response. Sam says ...

The absence of an ozone layer is hardly a problem under clouds, rocks or the sea, is it? Indeed, holes in the ozone layer today don't result in the instant molecular disintegration of organisms under them. So you are, in short, talking shite.
Posted by: Otangelo on Nov. 18 2015,05:23

Quote (JAM @ Nov. 17 2015,23:50)
[quote=Otangelo,Nov. 15 2015,21:09][/quote]
 

---------------------QUOTE-------------------
No evidence that RNA molecules ever had the broad range of catalytic activities
---------------------QUOTE-------------------



No evidence? That's a lie.

What is peptidyltransferase? I suggest you reply in two parts:

1) Meyer's lie; and
2) The truth.

 

---------------------QUOTE-------------------
an ability to catalyze every step of protein synthesis." The RNA world is thus a hypothetical system behind which there is little positive evidence,
---------------------QUOTE-------------------


Peptidyltransferase catalyzes the central stem in protein synthesis. What is it? This is a simple factual question.

 

---------------------QUOTE-------------------
… investigators have proposed many hypotheses, but evidence in favor of each of them is fragmentary at best.
---------------------QUOTE-------------------


When was that written and what is peptidyltransferase?
 

---------------------QUOTE-------------------
The full details of how the RNA world, and life, emerged may not be revealed in the near future.
---------------------QUOTE-------------------


At least we know the details for peptidyltransferase. Why does Meyer lie to his readers about it?

 

---------------------QUOTE-------------------
The best claimed evidence of an "RNA World" includes the fact that there are RNA enzymes and genomes, and that cells use RNA to convert the DNA code into proteins.
---------------------QUOTE-------------------


Lie.
 

---------------------QUOTE-------------------
However, RNA plays only a supporting role in the cell,
---------------------QUOTE-------------------


Another lie. What is peptidyltransferase?

 

---------------------QUOTE-------------------
RNA experts have created a variety of RNA molecules which can perform biochemical functions through what is commonly termed "test tube evolution."
---------------------QUOTE-------------------


What performs the essential function of peptidyltransferase?
 

---------------------QUOTE-------------------
However, "test tube evolution" is just a description for what is in reality nothing more than chemical engineering in the laboratory employing Darwinian principles; that does not imply that there is some known pathway through which these molecules could arise naturally.
---------------------QUOTE-------------------


I'm talking about the peptidyltransferase that is the center of protein synthesis in your body.
---------------------QUOTE-------------------


[QUOTE][No evidence? That's a lie.

What is peptidyltransferase? I suggest you reply in two parts:

1) Meyer's lie; and
2) The truth./QUOTE]

peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis. Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function. Furthermore, there is a huge gap between this advanced peptyl bond formation through  peptidyltransferase , and in a prebiotic word, where this machinery were not in place.

< http://reasonandscience.heavenforum.org/t2130-p....origins >

How could the gap be closed ? Not only are prebiotic mechanisms unlikely, but the transition would required the emergence of all the complex machinery and afterwards transition from one mechanism to the other. Tamura admits that fact clearly : the ultimate route to the ribosome remains unclear.   It takes a big leap of faith to believe, that could be possible in any circumstances.

The synthesis of proteins and nucleic acids from small molecule precursors represents one of the most difficult challenges to the model of prebiological evolution. There are many different problems confronted by any proposal. Polymerization is a reaction in which water is a product. Thus it will only be favored in the absence of water. The presence of precursors in an ocean of water favors depolymerization of any molecules that might be formed. Careful experiments done in an aqueous solution with very high concentrations of amino acids demonstrate the impossibility of significant polymerization in this environment.

< http://phys.org/news....tml#jCp >

But for the hypothesis to be correct, ancient RNA catalysts would have had to copy multiple sets of RNA blueprints nearly as accurately as do modern-day enzymes. That's a hard sell; scientists calculate that it would take much longer than the age of the universe for randomly generated RNA molecules to evolve sufficiently to achieve the modern level of sophistication. Given Earth's age of 4.5 billion years, living systems run entirely by RNA could not have reproduced and evolved either fast or accurately enough to give rise to the vast biological complexity on Earth today.


The RNA world hypothesis: the worst theory of the early evolution of life

< http://www.ncbi.nlm.nih.gov/pubmed....2793875 >

(i) RNA is too complex a molecule to have arisen prebiotically;
(ii) RNA is inherently unstable;
(iii) catalysis is a relatively rare property of long RNA sequences only; and
(iv) the catalytic repertoire of RNA is too limited.
Posted by: OgreMkV on Nov. 18 2015,06:31

ever define information yet?

Or explain how a back mutation that results in exactly the same DNA strand results in less information than it had before the mutations?

No?

I'm shocked.
Posted by: fusilier on Nov. 18 2015,06:40

[quote=Otangelo,Nov. 17 2015,16:03]
Quote (fusilier @ Nov. 17 2015,06:51)
Quote (Otangelo @ Nov. 15 2015,19:26)
 
Quote (OgreMkV @ Nov. 15 2015,15:07)
{snip}
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? {snip}
---------------------QUOTE-------------------


I hope I'm not too late with this, but in 1918, 35 years before Prof. Behe was born, H.J. Muller proposed the idea of "interlocking complexity" as a consequence of Descent with Modification.

As other posters have already pointed out, "Complex Specified Information" is completely undefined, except as "That ineffable property which only Go ...err, sorry, ... The Disembodied Telic Entity can produce."
---------------------QUOTE-------------------


Behe's Critics' Scaffolding Falls Down

< http://reasonandscience.heavenforum.org/t1656-h....ed#4297 >

And there's another problem with the scaffolding objection. Behe defines irreducible complexity as requiring not just one part, but "several well-matched, interacting parts."


Even if you end up with an irreducibly complex system by removing parts from scaffolding, you still had to build the scaffolding. How does unguided evolution build the scaffolding by adding parts?

In that regard, adding parts to build scaffolding may be more complicated than ID critics would admit. Adding a part isn't always that simple, even if it isn't indispensible. Sometimes simply getting a functional protein-protein interaction is beyond the reach of Darwinian evolution. In 2004, Behe and Snoke published a paper in Protein Science reporting results of computer simulations and theoretical calculations. They showed that the Darwinian evolution of a simple functional bond between two proteins would be highly unlikely to occur in populations of multicellular organisms. The reason, simply put, is because too many amino acids would have to be fixed by non-adaptive mutations before gaining any functional binding interaction.
---------------------QUOTE-------------------


How unexpected:  the goalposts are moving, and a red-herring or two are being dragged across the posts.

Your original statement was:


---------------------QUOTE-------------------
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ?
---------------------QUOTE-------------------



I pointed out that, yes, so-called "irreducible" (Behe used the term irreducibly), complex systems had been predicted by evolutionary biologists, nearly four decades before Behe was born.  The term "interlocking complexity," in Muller's paper in Genetics as well as his 1946 (? I could be wrong on the year, sorry) Nobel acceptance speech, is explicitly Behe's notion.

So that portion of your claim is demonstrably false.

You know, you really shouldn't be citing Behe and Snokes (2004.)  Behe's original claim was that protein evolution simply could not occur, unless directed by some outside agency.  Behe and Snokes demonstrated that it can.  

"Unlikely" does not mean the same thing as "impossible."
Behe proved himself wrong.

As an aside, back in 1996, when Behe was going on book-signing tours, loudly proclaiming that NO ONE had EVER studied biochemical evolution, I was getting flyers from a publisher to use "Biochemical Evolution, 2nd Edition" in my courses.  (Since I teach Human Anatomy and Physiology, it wasn't a good fit, so I passed on the opportunity.)

Your website assertions are merely wordsmithing and flappdoodle, and otherwise not worth the ATP to refute.
Posted by: JAM on Nov. 18 2015,08:58



---------------------QUOTE-------------------
peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis.
---------------------QUOTE-------------------



Moron. I asked you what peptidyltransferase IS, not what it DOES. Maybe you should review basic English interrogative pronouns.

 

---------------------QUOTE-------------------
Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function.
---------------------QUOTE-------------------


What part of the ribosome is the peptidyltransferase? The active site of the enzyme, idiot.

Keep it simple and a single word: peptidyltransferase is a _.
Posted by: Occam's Aftershave on Nov. 18 2015,09:17

Otangelo seems to be a serial spammer and plagiarist who has posted this same drivel at dozens of C/E sites.  He's used numerous different handles; he's been banned from many sites for the mindless C&Ping.  Right now he's over at TheSkepticalZone ticking off the regulars with his preaching and refusal to defend his nonsense.

Looks like it's our turn.  :p
Posted by: EmperorZelos on Nov. 18 2015,09:25



---------------------QUOTE-------------------
A vast amount of complex and specified information encoded in a biochemical language;
---------------------QUOTE-------------------


Language already presumes intelligence because language is communcation between one intelligent being and another intelligent being. As biochemistry does none of those it is not a language of any sort. Niether is it demonstrated to be informatoin because information is produced by intelligent beings. You need to demonstrate it was produced by an intelligence to say it contains information. It contains no more informatoin than the placement of stars tells me where I am and what time of the year it is. The star has no information.



---------------------QUOTE-------------------
A computer-like system of commands and codes that processes the information.
---------------------QUOTE-------------------


Presumes the previous point which is flawed from the ground up. But even then it's just chemicals doing chemistry. Just because we can draw analogies between it and a computer to more easily understand it doesn't make it a computer or even like one.



---------------------QUOTE-------------------
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.
---------------------QUOTE-------------------


That is because they are definitionally produced by them, for things to be those things they must be shown to be the product OF an intelligence. We do however know that things like these can have a natural origin.

Patterns in nature appear for many reasons without intelligence and in evolution it's even simpler, whatever has evolutionary benifits evolves forth over time and this has been done in computer simulations where simple hydrodynamics combined with limitation of fluid and pressure results in the system evolving forth a structure that looks very much like how our arteries and the likes are in our brain and tissues in general. It simply is the efficient method to do the work with those rules and constraints.

There is no intelligence behind rivers forming the way they do, even though they curve in nice curves over times, but a product of topology and simple physics.

You got the cart before the damn horse when it came to your initial thing and even then you don't understand evolution, in evolution you expect things to get more "complex" because it simply is more efficient. Dividing up work and forming systems is more efficient to do the job that has to be done.

You know the old saying, Jack of all trades are good at nothing.
Posted by: Otangelo on Nov. 18 2015,10:05

Quote (OgreMkV @ Nov. 18 2015,06:31)
ever define information yet?

Or explain how a back mutation that results in exactly the same DNA strand results in less information than it had before the mutations?

No?

I'm shocked.
---------------------QUOTE-------------------


well, thats a easy one :

The five levels of information



< http://reasonandscience.heavenforum.org/t1311-t....rmation >

information, dividing it into five levels. Wherever information is found, it fits these five levels. These can be illustrated with a STOP sign. The first level, statistics, tells us the STOP sign is one word and has four letters. The second level, syntax, requires the information to fall within the rules of grammar such as correct spelling, word and sentence usage. The word STOP is spelled correctly. The third level, semantics, provides meaning and implications. The STOP sign means that when we walk or drive and approach the sign we are to stop moving, look for traffic and proceed when it is safe. The fourth level, pragmatics, is the application of the coded message. It is not enough to simply recognize the word STOP and understand what it means; we must actually stop when we approach the sign. The fifth level, apobetics, is the overall purpose of the message. The STOP signs are placed by our local government to provide safety and traffic control. The code in DNA completely conforms to all five of these levels of information.
Posted by: Occam's Aftershave on Nov. 18 2015,10:11

Quote (Otangelo @ Nov. 18 2015,10:05)
well, thats a easy one :

The five levels of information
---------------------QUOTE-------------------


Hey, the serial spammer and plagiarist is back!  :)

Your C&Ped vomit still doesn't define "biological information" or explain how you measure biological information to tell if it has increased or decreased.
Posted by: Otangelo on Nov. 18 2015,10:13

Quote (fusilier @ Nov. 18 2015,06:40)

---------------------QUOTE-------------------


I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?

And the evolution of proteins is still a problem for proponents of naturalism to explain.

There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.

In case of 1. you can't bring evolution into the game, since evolution depends on replication. So all you are left with, are luck and chance as mechanism to make the proteins of DNA replication

and in regard of 2. Behe made a nice analogy :

Darwins Black Box page 40:

< http://reasonandscience.heavenforum.org/t2115-t....ox#3760 >

So let us attempt to evolve a bicycle into a motorcycle by the gradual accumulation of mutations. Suppose that a factory produced bicycles, but that occasionally there was a mistake in manufacture. Let us further suppose that if the mistake led to an improvement in the bicycle, then the friends and neighbors of the lucky buyer would demand similar bikes, and the factory would retool to make the mutation a permanent feature. So, like biological mutations, successful mechanical mutations would reproduce and spread. If we are to keep our analogy relevant to biology, however, each change can only be a slight modification, duplication, or rearrangement of a preexisting component, and the change must improve the function of the bicycle. So if the factory mistakenly increased the size of a nut or decreased the diameter of a bolt, or added an extra wheel onto the front axle or left off the rear tire, or put a pedal on the handlebars or added extra spokes, and if any of these slight changes improved the bike ride, then the improvement would immediately be noticed by the buying public and the mutated bikes would, in true Darwinian fashion, dominate the market. Given these conditions, can we evolve a bicycle into a motorcycle? We can move in the right direction by making the seat more comfortable in small steps, the wheels bigger, and even (assuming our customers prefer the «biker» look) imitating the overall shape in various ways. But a motorcycle depends on a source of fuel, and a bicycle has nothing that can be slightly modified to become a gasoline tank. And what part of the bicycle could be duplicated to begin building a motor? Even if a lucky accident brought a lawnmower engine from a neighboring factory into the bicycle factory, the motor would have to be mounted on the bike and be connected in the right way to the drive chain. How could this be done step-by-step from bicycle parts? A factory that made bicycles simply could not produce a motorcycle by natural selection acting on variation—by «numerous, successive, slight modifications»—and in fact there is no example in history of a complex change in a product occurring in this manner.
Posted by: Otangelo on Nov. 18 2015,10:15

Quote (JAM @ Nov. 18 2015,08:58)
Quote (Otangelo @ Nov. 18 2015,04:23)
 

---------------------QUOTE-------------------
peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis.
---------------------QUOTE-------------------



Moron. I asked you what peptidyltransferase IS, not what it DOES. Maybe you should review basic English interrogative pronouns.

 

---------------------QUOTE-------------------
Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function.
---------------------QUOTE-------------------


What part of the ribosome is the peptidyltransferase? The active site of the enzyme, idiot.

Keep it simple and a single word: peptidyltransferase is a _.
---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis.
---------------------QUOTE-------------------



Moron. I asked you what peptidyltransferase IS, not what it DOES. Maybe you should review basic English interrogative pronouns.

 

---------------------QUOTE-------------------
Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function.
---------------------QUOTE-------------------


What part of the ribosome is the peptidyltransferase? The active site of the enzyme, idiot.

Keep it simple and a single word: peptidyltransferase is a _.
---------------------QUOTE-------------------


After Occam, you are the second poster here on my ignore list. Good bye.
Posted by: Occam's Aftershave on Nov. 18 2015,10:18

Quote (Otangelo @ Nov. 18 2015,10:13)
There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.
---------------------QUOTE-------------------



Yawn.  The same Creationist stupidity.  "Science doesn't know all the steps yet therefore GAWDDIDIT!!"



---------------------QUOTE-------------------
and in regard of 2. Behe made a nice analogy :
---------------------QUOTE-------------------



The serial spammer and plagiarizer still too dumb to get that analogies aren't evidence.
Posted by: Occam's Aftershave on Nov. 18 2015,10:20

Quote (Otangelo @ Nov. 18 2015,10:15)
After Occam, you are the second poster here on my ignore list. Good bye.
---------------------QUOTE-------------------


Gee, I suppose we should feel honored.  A serial spammer and plagiarist has decided he's too afraid to respond.

That's OK Otangelo.  We'll still keep answering your idiocy and showing what a scientifically ignorant nincompoop you are.  No charge.   :)
Posted by: Richardthughes on Nov. 18 2015,11:10

What a fucking tool.
Posted by: fusilier on Nov. 18 2015,11:39

Quote (Otangelo @ Nov. 18 2015,11:13)
Quote (fusilier @ Nov. 18 2015,06:40)

---------------------QUOTE-------------------


I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?

And the evolution of proteins is still a problem for proponents of naturalism to explain.

There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.

In case of 1. you can't bring evolution into the game, since evolution depends on replication. So all you are left with, are luck and chance as mechanism to make the proteins of DNA replication

and in regard of 2. Behe made a nice analogy :

Darwins Black Box page 40:

< http://reasonandscience.heavenforum.org/t2115-t....ox#3760 >

So let us attempt to evolve a bicycle into a motorcycle by the gradual accumulation of mutations. Suppose that a factory produced bicycles, but that occasionally there was a mistake in manufacture. Let us further suppose that if the mistake led to an improvement in the bicycle, then the friends and neighbors of the lucky buyer would demand similar bikes, and the factory would retool to make the mutation a permanent feature. So, like biological mutations, successful mechanical mutations would reproduce and spread. If we are to keep our analogy relevant to biology, however, each change can only be a slight modification, duplication, or rearrangement of a preexisting component, and the change must improve the function of the bicycle. So if the factory mistakenly increased the size of a nut or decreased the diameter of a bolt, or added an extra wheel onto the front axle or left off the rear tire, or put a pedal on the handlebars or added extra spokes, and if any of these slight changes improved the bike ride, then the improvement would immediately be noticed by the buying public and the mutated bikes would, in true Darwinian fashion, dominate the market. Given these conditions, can we evolve a bicycle into a motorcycle? We can move in the right direction by making the seat more comfortable in small steps, the wheels bigger, and even (assuming our customers prefer the «biker» look) imitating the overall shape in various ways. But a motorcycle depends on a source of fuel, and a bicycle has nothing that can be slightly modified to become a gasoline tank. And what part of the bicycle could be duplicated to begin building a motor? Even if a lucky accident brought a lawnmower engine from a neighboring factory into the bicycle factory, the motor would have to be mounted on the bike and be connected in the right way to the drive chain. How could this be done step-by-step from bicycle parts? A factory that made bicycles simply could not produce a motorcycle by natural selection acting on variation—by «numerous, successive, slight modifications»—and in fact there is no example in history of a complex change in a product occurring in this manner.
---------------------QUOTE-------------------


[quote=fusilier,Nov. 18 2015,06:40][/quote]

---------------------QUOTE-------------------

I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?
---------------------QUOTE-------------------



Muller's Genetics paper was in 1918, not 1935.  The "what" is that you loudly proclaimed  evolutionary biology did not and could not predict "irreducibly complex" structures, but that goddidit does.  You were wrong.  When corrected, you now pretend that you never did so.

That isn't merely being wrong, it's telling a lie.  

For the balance of your flapdoodle, I invite you to read several hundred papers from Jack Szostak's lab:

< http://molbio.mgh.harvard.edu/szostak....ns.html >

The late Carl Woese also demolished your claim.

OBTW, motorcycles don't reproduce.  Otherwise there's this really nice Moto Guzzi/Indian hybrid I've been thinking about.
Posted by: Otangelo on Nov. 18 2015,12:07

Quote (fusilier @ Nov. 18 2015,11:39)
Quote (Otangelo @ Nov. 18 2015,11:13)
Quote (fusilier @ Nov. 18 2015,06:40)

---------------------QUOTE-------------------


I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?

And the evolution of proteins is still a problem for proponents of naturalism to explain.

There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.

In case of 1. you can't bring evolution into the game, since evolution depends on replication. So all you are left with, are luck and chance as mechanism to make the proteins of DNA replication

and in regard of 2. Behe made a nice analogy :

Darwins Black Box page 40:

< http://reasonandscience.heavenforum.org/t2115-t....ox#3760 >

So let us attempt to evolve a bicycle into a motorcycle by the gradual accumulation of mutations. Suppose that a factory produced bicycles, but that occasionally there was a mistake in manufacture. Let us further suppose that if the mistake led to an improvement in the bicycle, then the friends and neighbors of the lucky buyer would demand similar bikes, and the factory would retool to make the mutation a permanent feature. So, like biological mutations, successful mechanical mutations would reproduce and spread. If we are to keep our analogy relevant to biology, however, each change can only be a slight modification, duplication, or rearrangement of a preexisting component, and the change must improve the function of the bicycle. So if the factory mistakenly increased the size of a nut or decreased the diameter of a bolt, or added an extra wheel onto the front axle or left off the rear tire, or put a pedal on the handlebars or added extra spokes, and if any of these slight changes improved the bike ride, then the improvement would immediately be noticed by the buying public and the mutated bikes would, in true Darwinian fashion, dominate the market. Given these conditions, can we evolve a bicycle into a motorcycle? We can move in the right direction by making the seat more comfortable in small steps, the wheels bigger, and even (assuming our customers prefer the «biker» look) imitating the overall shape in various ways. But a motorcycle depends on a source of fuel, and a bicycle has nothing that can be slightly modified to become a gasoline tank. And what part of the bicycle could be duplicated to begin building a motor? Even if a lucky accident brought a lawnmower engine from a neighboring factory into the bicycle factory, the motor would have to be mounted on the bike and be connected in the right way to the drive chain. How could this be done step-by-step from bicycle parts? A factory that made bicycles simply could not produce a motorcycle by natural selection acting on variation—by «numerous, successive, slight modifications»—and in fact there is no example in history of a complex change in a product occurring in this manner.
---------------------QUOTE-------------------


[quote=fusilier,Nov. 18 2015,06:40][/quote]  

---------------------QUOTE-------------------

I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?
---------------------QUOTE-------------------



Muller's Genetics paper was in 1918, not 1935.  The "what" is that you loudly proclaimed  evolutionary biology did not and could not predict "irreducibly complex" structures, but that goddidit does.  You were wrong.  When corrected, you now pretend that you never did so.

That isn't merely being wrong, it's telling a lie.  

For the balance of your flapdoodle, I invite you to read several hundred papers from Jack Szostak's lab:

< http://molbio.mgh.harvard.edu/szostak....ns.html >

The late Carl Woese also demolished your claim.

OBTW, motorcycles don't reproduce.  Otherwise there's this really nice Moto Guzzi/Indian hybrid I've been thinking about.
---------------------QUOTE-------------------


Well, irreducible complexity is basically the opposit of step by step , gradual evolution by mutations and natural selection. So no miracle here for Muller to come up with the concept.

When Szostak has a compelling explanation of how life came to be, a prize of 1mio dollar awaits for him, and the Nobel prize.

But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....
Posted by: Richardthughes on Nov. 18 2015,12:17

Quote (Otangelo @ Nov. 18 2015,12:07)
[snip]

But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....
---------------------QUOTE-------------------


And you've failed basic logic there - universal negatives.

Also, you clearly don't understand ID, which is a (flawed) probabilistic argument. (Improbable vs impossible)

So you're dismissed.

Next?
Posted by: Occam's Aftershave on Nov. 18 2015,12:18

Quote (Otangelo @ Nov. 18 2015,12:07)
But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....
---------------------QUOTE-------------------


Another blustering empty claim by the spamming plagiarist.  :p
Posted by: NoName on Nov. 18 2015,12:23

Quote (Otangelo @ Nov. 18 2015,13:07)
...
Well, irreducible complexity is basically the opposit of step by step , gradual evolution by mutations and natural selection. So no miracle here for Muller to come up with the concept.
---------------------QUOTE-------------------


Nonsense.
And beside the point.
You were wrong.  You lied in your response.
And you are running away from all the various counters and challenges raised against the PRATTs you've posted.


---------------------QUOTE-------------------
When Szostak has a compelling explanation of how life came to be, a prize of 1mio dollar awaits for him, and the Nobel prize.

But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....
---------------------QUOTE-------------------


When you have a compelling and detailed explanation of how life  came to be, we'll be fascinated.
"Poof" is neither rationally compelling nor detailed.
Amongst other logical flaws, all cases of creation known to us, without exception, are interactions between matter.
A 'disembodied mind', whatever else it might be, is entirely impotent.  It can have no causal impact.
Evidence to the contrary, not merely wishful thinking, is required.

Why is abiogenesis impossible?  What particular chemical reactions are not possible but occur in the transition from non-living to living?
We have concrete real examples of such transitions -- potato mosaic virus being one of  the better known.
At no point in the process, vague and indeterminate though the exact point of change may be, is  there anything going on that is not physical.  As such, there is nothing going on that is not explicable by chemistry and physics.
That's far more than you have.  Far better supported by evidence.  And logic.

Until you can demonstrate that there is some violation of chemical and physical behavior required for life to occur, you are merely asserting your own wishful thinking.
Waffling on about 'information' is irrelevant.  Provide the actual chemical and/or physical impossibilities that prevent abiogenesis.
There are none known.  You'd get quit a prize if you could provide one.
Posted by: Otangelo on Nov. 18 2015,12:54

Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


There are many reasons. I will post a small list to begin with:

< http://reasonandscience.heavenforum.org/t1279-a....ossible >

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

2. The next problem concerns the so-called handedness of the amino acids. Because of the way that carbon atoms join up with other atoms, amino acids exist in two forms—the right-handed form and the left-handed form. Just as your right hand and left hand are identical in all respects except for their handedness, so the two forms of amino acids are identical except for their handedness. In all living systems only left-handed amino acids are found. Yet Miller’s experiment produced a mixture of right-handed and left-handed amino acids in identical proportions. As only the left-handed ones are used in living systems, this mixture is useless for the evolution of living systems.

3. Another major problem for the chemical evolutionist is the origin of the information that is found in living systems. There are various claims about the amount of information that is found in the human genome, but it can be conservatively estimated as being equivalent to a few thousand books, each several hundred pages long. Where did this information come from?

4. If the many instructions that direct an animal’s or plant’s immune system had not been preprogrammed in the organism’s genetic system when it first appeared on earth, the first of thousands of potential infections would have killed the organism. This would have nullified any rare genetic improvements that might have accumulated. In other words, the large amount of genetic information governing the immune system could not have accumulated in a slow, evolutionary sense.a Obviously, for each organism to have survived, all this information must have been there from the beginning.  

5.The sugar found in the backbone of both DNA and RNA, ribose, has been particularly problematic, as the most prebiotically plausible chemical reaction schemes have typically yielded only a small amount of ribose mixed with a diverse assortment of other sugar molecules.

6. all the peptide links to form a proptein must be alpha-peptide bonds, not some mix of alpha and epsilon,beta, and gamma bonds


< http://www.newgeology.us/present....32.html >

"The first paradox is the tendency of organic matter to devolve and to give tar.  If you can avoid that, you can start to try to assemble things that are not tarry, but then you encounter the water problem, which is related to the fact that every interesting bond that you want to make is unstable, thermodynamically, with respect to water.  If you can solve that problem, you have the problem of entropy, that any of the building blocks are going to be present in a low concentration; therefore, to assemble a large number of those building blocks, you get a gene-like RNA -- 100 nucleotides long -- that fights entropy.  And the fourth problem is that even if you can solve the entropy problem, you have a paradox that RNA enzymes, which are maybe catalytically active, are more likely to be active in the sense that destroys RNA rather than creates RNA."


7.amino acids and sugars combine and destroy each other. In lab experiments the component chemicals are neatly separated from one another. How is this possible in a primitive ocean?

8. Synthesis vs destruction - For chemical bonds to form there needs to be an external source of energy. Unfortunately, the same energy that creates the bonds is much more likely to destroy them. In the famous Miller experiment (1953) that synthesized amino acids, a cold trap is used to selectively isolate the reaction products. Without this, the would be no products. This poses a challenge to simplistic early earth schemes where lightning simply strikes a primitive ocean. Where is the "trap" in such an ocean? Also, the creation of amino acids by a chemist in a laboratory is still much different from forming self-replicating life.
Posted by: Occam's Aftershave on Nov. 18 2015,12:58

Quote (Otangelo @ Nov. 18 2015,12:54)
 
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


There are many reasons. I will post a small list to begin with:
---------------------QUOTE-------------------


Unknowns to overcome but not one thing that makes abiogenesis impossible.

Same idiot blithering.  :D
Posted by: Richardthughes on Nov. 18 2015,13:04

Quote (Occam's Aftershave @ Nov. 18 2015,12:58)
Quote (Otangelo @ Nov. 18 2015,12:54)
 
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


There are many reasons. I will post a small list to begin with:
---------------------QUOTE-------------------


Unknowns to overcome but not one thing that makes abiogenesis impossible.

Same idiot blithering.  :D
---------------------QUOTE-------------------


Fails basic logic.
Posted by: EmperorZelos on Nov. 18 2015,13:14



---------------------QUOTE-------------------
But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....
---------------------QUOTE-------------------


The fact is that scientists disagree, if you think they are wrong why aren't you publishing your results in a scientific journal yourself? It'd save them a lot of work.
Posted by: Richardthughes on Nov. 18 2015,13:29

Prediction: Ignore followed by more copypasta.
Posted by: NoName on Nov. 18 2015,13:54

Quote (Otangelo @ Nov. 18 2015,13:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


There are many reasons. I will post a small list to begin with:

< http://reasonandscience.heavenforum.org/t1279-a....ossible >

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

2. The next problem concerns the so-called handedness of the amino acids. Because of the way that carbon atoms join up with other atoms, amino acids exist in two forms—the right-handed form and the left-handed form. Just as your right hand and left hand are identical in all respects except for their handedness, so the two forms of amino acids are identical except for their handedness. In all living systems only left-handed amino acids are found. Yet Miller’s experiment produced a mixture of right-handed and left-handed amino acids in identical proportions. As only the left-handed ones are used in living systems, this mixture is useless for the evolution of living systems.

3. Another major problem for the chemical evolutionist is the origin of the information that is found in living systems. There are various claims about the amount of information that is found in the human genome, but it can be conservatively estimated as being equivalent to a few thousand books, each several hundred pages long. Where did this information come from?

4. If the many instructions that direct an animal’s or plant’s immune system had not been preprogrammed in the organism’s genetic system when it first appeared on earth, the first of thousands of potential infections would have killed the organism. This would have nullified any rare genetic improvements that might have accumulated. In other words, the large amount of genetic information governing the immune system could not have accumulated in a slow, evolutionary sense.a Obviously, for each organism to have survived, all this information must have been there from the beginning.  

5.The sugar found in the backbone of both DNA and RNA, ribose, has been particularly problematic, as the most prebiotically plausible chemical reaction schemes have typically yielded only a small amount of ribose mixed with a diverse assortment of other sugar molecules.

6. all the peptide links to form a proptein must be alpha-peptide bonds, not some mix of alpha and epsilon,beta, and gamma bonds


< http://www.newgeology.us/present....32.html >

"The first paradox is the tendency of organic matter to devolve and to give tar.  If you can avoid that, you can start to try to assemble things that are not tarry, but then you encounter the water problem, which is related to the fact that every interesting bond that you want to make is unstable, thermodynamically, with respect to water.  If you can solve that problem, you have the problem of entropy, that any of the building blocks are going to be present in a low concentration; therefore, to assemble a large number of those building blocks, you get a gene-like RNA -- 100 nucleotides long -- that fights entropy.  And the fourth problem is that even if you can solve the entropy problem, you have a paradox that RNA enzymes, which are maybe catalytically active, are more likely to be active in the sense that destroys RNA rather than creates RNA."


7.amino acids and sugars combine and destroy each other. In lab experiments the component chemicals are neatly separated from one another. How is this possible in a primitive ocean?

8. Synthesis vs destruction - For chemical bonds to form there needs to be an external source of energy. Unfortunately, the same energy that creates the bonds is much more likely to destroy them. In the famous Miller experiment (1953) that synthesized amino acids, a cold trap is used to selectively isolate the reaction products. Without this, the would be no products. This poses a challenge to simplistic early earth schemes where lightning simply strikes a primitive ocean. Where is the "trap" in such an ocean? Also, the creation of amino acids by a chemist in a laboratory is still much different from forming self-replicating life.
---------------------QUOTE-------------------


None of those are adequate.
We have  life.
We have chemistry and physics.
We have no reason whatsoever to believe that chemistry and physics could not lead to the formation of life.

I note  with mild interest that you ignore the example of tobacco mosaic virus.
I note you appear to be unfamiliar with, and likely unaware of, Schrodinger's production of DNA prior to its discovery.
Surely one of the great predictions of evolutionary theory, confirmed and continuing to be useful.
Not a single prediction of 'design "theory"' has such evidentiary backing.
All 'design "theory"' does is whine about alleged problems with the genuine sciences.  It produces nothing of itself, it merely casts aspersions.  And whine, endlessly.

Your claim was not that abiogenesis was unlikely, your claim was that it was impossible.
The strongest of your, frankly ignorant, objections, can show, at most, that abiogenesis is unlikely.

Your claim, you need to support it.   Why is abiogenesis impossible?
Particularly, the  challenge you must overcome is to show that there is some aspect of life that violates the laws of chemistry and physics.  Until and unless such demonstration is provided, there is little, as in no, warrant, to suppose that chemistry and physics do not suffice.
Posted by: Otangelo on Nov. 18 2015,14:44

Quote (EmperorZelos @ Nov. 18 2015,13:14)


---------------------QUOTE-------------------
But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....
---------------------QUOTE-------------------


The fact is that scientists disagree, if you think they are wrong why aren't you publishing your results in a scientific journal yourself? It'd save them a lot of work.
---------------------QUOTE-------------------


ah no ?

Evolutionist George Wald reflected on this dilemma and wrote

"The reasonable view [during the two centuries before Louis Pasteur] was to believe in spontaneous generation; the only alternative, to believe in a single, primary act of supernatural creation. There is no third position. One has only to contemplate the magnitude of this task to concede that the spontaneous generation of a living organism is impossible.

Joseph Mastropaolo, Ph.D.

According to the most generous mathematical criteria for evolution, abiogenesis and monogenesis are impossible to unimaginable extremes.

Abiogenic Origin of Life: A Theory in Crisis
Ó 2005 Arthur V. Chadwick, Ph.D.
Professor of Geology and Biology

To give you an idea of how incomprehensible, I use the following illustration. An ameba starts out at one side of the universe and begins walking towards the other side, say, 100 trillion light years away. He travels at the rate of one meter per billion years. He carries one atom with him. When he reaches the other side, he puts the atom down and starts back. In 10186 years, the ameba will have transported the entire mass of the universe from one side to the other and back a trillion trillion trillion trillion trillion trillion times. That is my definition of impossible. And what resulted from success, if it did occur would not be a living cell or even a promising combination. Spontaneous origin of life on a prebiological earth is IMPOSSIBLE!

biologist Francis Crick acknowledged in 1981:

  "An honest man, armed with all the knowledge available to us now, could only state that in some sense, the origin of life appears at the moment to be almost a miracle, so many are the conditions which would have had to be satisfied to get it going."

Abiogenesis is not only unproven, it is mathematically impossible. No wonder both Orgel and Crick called it a miracle.

― Michael Denton, Evolution: A Theory In Crisis

“The complexity of the simplest known type of cell is so great that it is impossible to accept that such an object could have been thrown together suddenly by some kind of freakish, vastly improbable, event. Such an occurrence would be indistinguishable from a miracle.”

Some have suggested that certain clay or crystal surfaces might "select" one isomer over another and therefore, purify a mixture of like handed (optically pure) molecules. However, this argument ignores that fact that the entropy states of the two isomers are identical and are very difficult to separate. Secondly, experimental chemistry shows that it is impossible to get pure mixtures of one or the other isomer this way. Irregularities in the structure of the clay or crystal surfaces would result in the accumulation of both isomers, i.e., contaminants. Since this is so, if even one incorrect isomer gets integrated into a protein or nucleic acid, its 3-D structure would be destroyed.

The Second Law, coupled with the fact that these condensation reactions are reversible, drives the solution in the net direction of a mixture containing predominantly unbonded building blocks. According to thermodynamic calculations by Harold Blum (Time's Arrow and Evolution), in a watery solution about 1% of amino acids will exist as dipeptides (two bonded amino acids), .001% as tripeptides and less than one in 10/20 will exist in a chain of ten amino acids. Those that do bond will be quickly unbonded when a collision with water occurs unless these unlikely, reduced entropy molecules are stored and kept away from the solution in equilibrium. 41. In a primordial soup, random molecular movement would cause the building blocks of life to diffuse away from their site of origin. Just as concentrated red dye will disperse when dropped into water, the building blocks of DNA and protein will also diffuse until equilibrium is reached. At this point there would be billions of water molecules for every unbonded building block. This process, along with the rapid breakdown of nucleotides and amino acids by oxygen and UV radiation, makes it almost impossible to imagine how, in a watery environment, biochemical precursors could combine, stay combined and continue to build upon each other in the fact of the concept of chemical equilibrium.
Posted by: Otangelo on Nov. 18 2015,14:46

Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?
---------------------QUOTE-------------------


more reasons :

The hardware and software of the cell, evidence of design

< http://reasonandscience.heavenforum.org/t2221-t....-design >
Posted by: Richardthughes on Nov. 18 2015,14:59

Quote (Otangelo @ Nov. 18 2015,14:46)
Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?
---------------------QUOTE-------------------


more reasons :

The hardware and software of the cell, evidence of design

< http://reasonandscience.heavenforum.org/t2221-t....-design >
---------------------QUOTE-------------------


You don't really understand "impossible", do you?


But like a good creationist, you just ignore the bits that don't work for you and press on. I'm sure your points getting destroyed doesn't stop you raising them again in the future. Seen it all before.
Posted by: Richardthughes on Nov. 18 2015,15:02

Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?
Posted by: NoName on Nov. 18 2015,15:19

Quote (Otangelo @ Nov. 18 2015,15:46)
 
Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?
---------------------QUOTE-------------------


more reasons :

The hardware and software of the cell, evidence of design

< http://reasonandscience.heavenforum.org/t2221-t....-design >
---------------------QUOTE-------------------


Design in the usual sense of the term is an irrelevancy.  A red herring.
What is needed is evidence of manufacture.
This is starkly missing.
Many things are design but never produced.  Many things  are produced but not designed.  

All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?
Posted by: Occam's Aftershave on Nov. 18 2015,15:19

Quote (Otangelo @ Nov. 18 2015,14:46)
 
Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?
---------------------QUOTE-------------------


more reasons :
---------------------QUOTE-------------------


More C&Ped Creationist horsecrap that doesn't support your claim abiogenesis is impossible.

Do you think your lying and bearing false witness will get you into heaven?  Is that why you do it?
Posted by: Otangelo on Nov. 18 2015,15:30

Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?
---------------------QUOTE-------------------


Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.
Posted by: Otangelo on Nov. 18 2015,15:35

Quote (NoName @ Nov. 18 2015,15:19)
All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?
---------------------QUOTE-------------------


Two points here :

How exactly did God create things ? what process was involved ?

< http://reasonandscience.heavenforum.org/t1794-h....nvolved >

Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.

Argument from incredulity

< http://reasonandscience.heavenforum.org/t1724-a....ty#2738 >

Incredulity is based on human experience and on what we actually know. For example, the belief in abiogenesis can be strongly doubted, one can be skeptical of it, because it has never been observed and all proposals have lead to a dead end so far. So its more than rational to look somewhere else.  What has been observed is biogenesis, life coming from life. What we know is that the complexity in the natural world of living organisms is similar to, in fact much greater than, the complexity of intelligently created devices, such as the clock or the computer. You might implie that incredulity is an unreasonable position, but it is in fact a foundation for all critical thought. Sensible people do not believe things without evidence. Consider the opposite, credulity; there is no context in which that is not a pejorative word! Considering what atheists are willing to believe, can indeed be classed as credulous.

It is also quite proper for a person of one religion or philosophy to be skeptical of the beliefs of another one. The religion of naturalism, which is the basis of evolution, can properly be rejected by a biblical theist. The evolutionist system may be dominant in some parts of the world, but that says nothing about whether it is true. Many have looked at it and found it inadequate; they have found good reasons to be skeptical of it, especially since theism better explains very many features of the natural world.

When i say that something is unbelievable or inconceivable,  i give good reasons. If my whole argument were simply an unsupported statement of unbelief, you would have a good point; to say something is unbelievable without giving a reason is not a good argument. But the problem is that you oversimplify; you do not address the reasons for incredulity.

Incredulity is an argument of scepticism about a certain point of view, and the evolutionist and atheist are not innocent of using such an argument. Incredulity, doubt and scepticism about God and special creation, are implicit in every naturalistic explanation  about abiogenesis and many other facets of their  view points.

This kind of arguments are frequent :

 how can a perfect deity create such a messed up world? (translation: it is inconceivable that a perfect deity could create such a messed up world, therefore, since evolution is a theory of messed-up, random natural forces and actions, it must be true)
 how can (a certain part of a living organism, e.g., the human eye) be designed when it has this mistake or that problem? (translation: it is inconceivable that an intelligent divine designer could create that supposedly malfunctioning part of the living organism; therefore it must have been formed through random, unintelligent, natural forces, i.e. evolution)

All of these arguments could be accurately classed as arguments of incredulity. If no reason is given, any argument from incredulity is weak.

And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.
Posted by: Soapy Sam on Nov. 18 2015,15:51

Quote (Otangelo @ Nov. 18 2015,21:30)
Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?
---------------------QUOTE-------------------


Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.
---------------------QUOTE-------------------


Hey! Can you ignore me too please? Thanks.
Posted by: Occam's Aftershave on Nov. 18 2015,16:04

Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.
---------------------QUOTE-------------------


Why do you keep telling this same lie?  It doesn't get any better with age or retelling.
Posted by: Richardthughes on Nov. 18 2015,16:06

Quote (Otangelo @ Nov. 18 2015,15:30)
Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?
---------------------QUOTE-------------------


Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.
---------------------QUOTE-------------------


To use your very example:

True or false:

"miracle" = "almost a miracle" ??


Its very simple. YOU LIAR.

I didn't 'ignore all the quotes you provided' as I cited the one that shows you are a liar.

SO THAT'S ANOTHER LIE, THEN.
Posted by: Richardthughes on Nov. 18 2015,16:08

Quote (Occam's Aftershave @ Nov. 18 2015,16:04)
Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.
---------------------QUOTE-------------------


Why do you keep telling this same lie?  It doesn't get any better with age or retelling.
---------------------QUOTE-------------------


because YEC creationist, obviously!

Facts just won't stick. Disgusting.
Posted by: NoName on Nov. 18 2015,16:14

Quote (Otangelo @ Nov. 18 2015,16:35)
   
Quote (NoName @ Nov. 18 2015,15:19)
All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?
---------------------QUOTE-------------------


Two points here :

How exactly did God create things ? what process was involved ?
---------------------QUOTE-------------------


Who asked?
Note, too, that 'process' is also an inherently temporal term.  There can be no process if there is no time.
Further, processes are not disembodied or free-floating -- how can there be a process if there are no things (in the broadest sense of the term)?
You're worse at philosophy then you are at science.
[pointless link deleted]
 

---------------------QUOTE-------------------
Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.

Argument from incredulity...
---------------------QUOTE-------------------


Funny, in all that blather there is nothing that rescues your arguments nor shows that my claims regarding them are false.
You are simply arguing from your own prejudicial (in the technical sense of the term) rejection of theories that you cannot even present accurately.  Most, if not all, of your objections to abiogenesis are old, tired, and amount to PRATTs.

 

---------------------QUOTE-------------------
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.
---------------------QUOTE-------------------


Oddly enough, nothing you have posted supports this conclusion.  
You continue to squirm around avoiding the question.
Could it be you are not qualified to assert such a claim so boldly and absolutely?  You are not so qualified if you cannot answer the question.
Why is abiogenesis impossible?

The words that so impress you are not remarkable in any way.
The claims were not uttered nor recorded by God.  Even in  the Abrahamic religions, those words are claimed to have been recorded by Moses.  Moses' words are not self-validating.  It is circular, if not question-begging, to simply accept them on the face of things.
Particularly when, on the face of things, that is, the clear text, the beginning of Genesis is a mishmash of commonplace mythology of the Mediterranean basin, particularly the region from Egypt east and northwards to Turkey.
You are asking us to assume your conclusion.
It remains an asserted conclusion, without adequate support, and without any explanatory power whatsoever even if the existence of a god should somehow be shown.
"Poof" is not an explanation.

But all of those words that you bibliolators are so impressed by are entirely irrelevant to the claims I am attacking.
They are, at best, a cop-out.

Nothing you have posted is responsive to the issues raised.
Why is abiogenesis impossible?

New issues, since you raised the subjects:
How does creation happen when there is no time?
There is no 'beginning' without time.

Ontology has progressed since Spencer.  Nor is he particularly noted for his ontology.
You're cherry-picking as part of your furious Gish-gallop to avoid the problems of your own position.
Defend it or explicitly abandon it.
Posted by: NoName on Nov. 18 2015,16:22

Shorter response to Otangelo's drivel:

The deity of the Abrahamic religions does not and cannot solve the problem of abiogenesis.
The god (or "God" if you prefer) of Abraham, Isaac, and Jacob is not biologically alive.
Therefore, the problem remains untouched.
If abiogenesis is impossible, than god can't do it either, not being biologically alive.
If God is claimed to be biologically alive, then he rose from abiogenesis, or abiogenesis is possible and there is some prior 'process' which led to his life.
If God is not biologically alive (and he possesses none of the hallmarks of biologically living things), and he 'created' life, then we still have the problem of how.
Asserting it sans positive evidence does not solve the problem of how abiogenesis occurred.
Unless everything, literally, is alive, the problem remains how did life arise?
"Poof" is not an answer.
Posted by: Occam's Aftershave on Nov. 18 2015,16:25

Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.
---------------------QUOTE-------------------


How do you know it is impossible by all means?  Are you an omnipotent God who tested all means?

Why don't you add this to your "library".

< Researchers may have solved origin-of-life conundrum >

"The origin of life on Earth is a set of paradoxes. In order for life to have gotten started, there must have been a genetic molecule—something like DNA or RNA—capable of passing along blueprints for making proteins, the workhorse molecules of life. But modern cells can’t copy DNA and RNA without the help of proteins themselves. To make matters more vexing, none of these molecules can do their jobs without fatty lipids, which provide the membranes that cells need to hold their contents inside. And in yet another chicken-and-egg complication, protein-based enzymes (encoded by genetic molecules) are needed to synthesize lipids.

Now, researchers say they may have solved these paradoxes. Chemists report today that a pair of simple compounds, which would have been abundant on early Earth, can give rise to a network of simple reactions that produce the three major classes of biomolecules—nucleic acids, amino acids, and lipids—needed for the earliest form of life to get its start. Although the new work does not prove that this is how life started, it may eventually help explain one of the deepest mysteries in modern science.

“This is a very important paper,” says Jack Szostak, a molecular biologist and origin-of-life researcher at Massachusetts General Hospital in Boston, who was not affiliated with the current research. “It proposes for the first time a scenario by which almost all of the essential building blocks for life could be assembled in one geological setting.”

Here's the actual paper

< Common origins of RNA, protein and lipid precursors in a cyanosulfidic protometabolism >
Patel et al
Nature Chemistry, 7, 301–307 (2015)

Abstract: A minimal cell can be thought of as comprising informational, compartment-forming and metabolic subsystems. To imagine the abiotic assembly of such an overall system, however, places great demands on hypothetical prebiotic chemistry. The perceived differences and incompatibilities between these subsystems have led to the widely held assumption that one or other subsystem must have preceded the others. Here we experimentally investigate the validity of this assumption by examining the assembly of various biomolecular building blocks from prebiotically plausible intermediates and one-carbon feedstock molecules. We show that precursors of ribonucleotides, amino acids and lipids can all be derived by the reductive homologation of ​hydrogen cyanide and some of its derivatives, and thus that all the cellular subsystems could have arisen simultaneously through common chemistry. The key reaction steps are driven by ultraviolet light, use ​hydrogen sulfide as the reductant and can be accelerated by Cu(I)–Cu(II) photoredox cycling
Posted by: Otangelo on Nov. 18 2015,16:56

Quote (NoName @ Nov. 18 2015,16:22)
"Poof" is not an answer.
---------------------QUOTE-------------------


What is ?
Posted by: NoName on Nov. 18 2015,17:09

Quote (Otangelo @ Nov. 18 2015,17:56)
Quote (NoName @ Nov. 18 2015,16:22)
"Poof" is not an answer.
---------------------QUOTE-------------------


What is ?
---------------------QUOTE-------------------


Absence of a definitive answer is better answered by "we don't know yet" than by "poof".
One is susceptible to further investigation and study.  The other is the death of the mind.

As I have shown, that there are living and non-living things is the core problem of abiogenesis.
The Abrahamic god is not a sufficient answer.  Nor does recourse to 'god did it' serve as an explanation, and, in fact, either dethrones the deity or fails to address the problem.  Worse, it requires acceptance of contradictions as noted previously.

So you are left clutching your incredulity, further from an answer than science and reason.
Posted by: Otangelo on Nov. 18 2015,17:12

Quote (NoName @ Nov. 18 2015,17:09)
The Abrahamic god is not a sufficient answer.
---------------------QUOTE-------------------


It might not be to you. But it is certainly to me, and many others...

Limited causal alternatives for origins

< http://reasonandscience.heavenforum.org/t1810-l....origins >

Its not justified to claim " we don't know ", when a limited range of alternatives and options are available. In regard our our existence, there are just and exactly 3, namely:

chance
design
physical necessity.

since chance, and physical necessity won't cut the cake, the best explanation for our existence is design.


Pretend you wake up in the morning and there's a birthday cake sitting on your kitchen table, and it just happens to be your birthday. What do you think? You ask yourself, "Where did this cake come from?" There are only a couple of possibilities, theoretically. It could have just materialized out of nowhere on your kitchen table coincidentally on your birthday. It could have just "poofed" into existence. I guess that would be in the realm of theoretic possibilities. Or maybe a great, hot, wet wind blew through your neighbor's kitchen gathering up a bunch of ingredients and kind of accidentally baked a cake that landed on your table. The fact that it happened on your birthday is a coincidence. I guess that would be "possible" too. The cake could have come out of nowhere, or could have just assembled itself by chance. Or the other alternative would be that a person baked the cake for you and dropped it off in the middle of the night.

Now here's the trick. When faced with limited options you don't have the liberty not to believe something. If you reject the idea that somebody baked the cake for you, you must assert in its place that the cake either materialized out of nothing or formed itself by accident. When you reject one option you are asserting an alternate option when all the options are clear.

Do you see that? When you are faced with just a limited number of choices, if you reject one choice you've got to opt for one of those that remains. So the question is, which option makes most sense?


< http://enrichmentjournal.ag.org/201303....sts.cfm >

The Christian Geneticist Francis Collins of Human Genome Project fame said he was an agnostic in college. Yet he confesses that his “I don’t know” was more an “I don’t want to know” attitude — a “willful blindness.”11 This agnosticism eventually gave way to outright atheism — although Collins would later come to faith in Christ. He began reading C.S. Lewis’ Mere Christianity, and Collins realized his own antireligious constructs were “those of a schoolboy.”12

Because the existence of God is a massively important topic, we cannot afford not to pay attention — especially in an age of so many diversions. Philosopher Tom Morris points out that sports, TV, restaurants, concerts, cars, billiards, and a thousand other activities can divert us from the ultimate issues of life. As a result, we don’t “tune into” God. And when a crisis hits (death, hospitalization, natural disaster), we are not really in the best condition to process and make accurate judgments about those deep questions.13 The person who says, “I do not know if God exists,” may have chosen to live by diversions and distractions and thus to ignore God. This is not an innocent ignorance; this ignorance is the result of our neglecting our duty.

So the theist, atheist, and militant (ornery) agnostic all bear a burden of proof; the theist does not have a heavier burden since all claim to know something. Furthermore, even the alleged ordinary agnostic still is not off the hook. For one thing, one cannot remain neutral all his life; he will make commitments or hold beliefs all along the way that reflect either an atheistic or theistic worldview. He is either going to be a practical atheist or practical theist (or a mixture of the two) in some fashion throughout his life. But he can’t straddle the fence for long. Also, the ordinary agnostic may say, “I do not know,” but this often means “I do not care” — the view of an “apatheist.” Refusing to seek out whether God exists or not; refusing to humble oneself to seek whatever light about God is available; living a life of distractions rather than thoughtfully reflecting about one’s meaning, purpose, or destiny leaves one culpable in his ignorance, not innocent.
Posted by: Occam's Aftershave on Nov. 18 2015,17:17

Quote (Otangelo @ Nov. 18 2015,17:12)
It might not be to you. But it is certainly to me, and many others...
---------------------QUOTE-------------------


If you're content to stay pitifully ignorant about the natural world and accept "POOF!  GAWDDIDIT" for everything then more power to you.  Just don't expect anyone with an IQ higher than room temperature (Celsius) to agree with you.  And certainly don't expect to change anyone's mind by C&Ping the bog-standard Creationist lies and misinformation.
Posted by: NoName on Nov. 18 2015,17:25

As I said, the death of the mind.

That pretty much makes you a zombie.

You can't justify your claims, you can't defend them, you accept atemporal  processes and atemporal causation, both manifestly internally contradictory.

As has been obvious from the start, you are making prejudicial assertions in service of your agenda and your incredulity.

That this is satisfactory to you is shameful.
Posted by: Occam's Aftershave on Nov. 18 2015,17:27

Quote (Otangelo @ Nov. 18 2015,17:12)
Its not justified to claim " we don't know ", when a limited range of alternatives and options are available. In regard our our existence, there are just and exactly 3, namely:

chance
design
physical necessity.

since chance, and physical necessity won't cut the cake, the best explanation for our existence is design.
---------------------QUOTE-------------------


But the combination of chance and physical necessity in the form of evolution does the job quite nicely.

Sorry, no need for your Magic Designing Poofter.
Posted by: NoName on Nov. 18 2015,17:46

It is perhaps worth noting that design is only required in the face of physical necessity.
Without limitations, material limits or restrictions, i.e., physical necessity, design is superfluous.
The Abrahamic god, claimed to be omniscient and omnipotent, need not design.  The very notion is outside the scope of consideration of any such being.
Thus, we have good grounds for rejecting your claims of signs of divine or non-natural design -- they must be spurious.
If there are such signs, they undercut the claims made for the nature of god.
Posted by: OgreMkV on Nov. 18 2015,17:59

What is the information VALUE from this string of DNA


---------------------QUOTE-------------------
ATG GTG GAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTGAAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC GGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGC
ACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAGTCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCTCAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTCAAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCTGAG AAC TTC AGG TGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACAGT
TTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTT
TCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGA
AATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTT
GCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTT
AATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTA
TCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAAC
AGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
---------------------QUOTE-------------------



Now calculate the information VALUE of this string


---------------------QUOTE-------------------
ATG GTG GAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
GAG AAC TTC AGG GTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
---------------------QUOTE-------------------



1) Show your work?
2) How does the mutation in bold change the information VALUE of the string?
3) Why is this change impossible?

BTW: I will not accept C&P posts. Do the math, show your work, derive your conclusions from the math. Or, like every other creationist, admit that you can't.

P.S. I should add that if you ignore me too, then there's basically no one else on this site. You'll basically be spamming a thread that no one will ever read and you won't listen to any responses.
Posted by: Otangelo on Nov. 18 2015,18:33

Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly
---------------------QUOTE-------------------


please cite me where i make that admittance.
Posted by: Otangelo on Nov. 18 2015,18:34

Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?
---------------------QUOTE-------------------


i am bad on math. sorry
Posted by: NoName on Nov. 18 2015,18:44

Quote (Otangelo @ Nov. 18 2015,19:33)
 
Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly
---------------------QUOTE-------------------


please cite me where i make that admittance.
---------------------QUOTE-------------------


It's implied by your remarks regarding Genesis 1:1, above.  The first post on this page.
Either god created time, which commits you to atemporal causes and atemporal processes, or god did not create the five Spencerian ontological categories you are so impressed by.

But again, this is beside the point.
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

We can return to the more recently raised issues of your ontological confusions and absurdities after we've cleared that up.
Posted by: Dr.GH on Nov. 18 2015,18:53

Quote (Otangelo @ Nov. 18 2015,10:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


There are many reasons. I will post a small list to begin with:

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.
---------------------QUOTE-------------------


Miller was using the atmospheres of the other Solar System planets known by spectrographic analysis. This was his professor Harold Urey's hypothesis. Charles Darwin's idea was that the origin of life was in a reducing environment because the decomposition products of tissues were reduced. He was incorrect, Urey was correct.

You clearly have no experience in chemistry.

The early earth had a reduced atmosphere. We know this in several ways. The most significant is geological data.

Matthew A. Pasek, Jelte P. Harnmeijer, Roger Buick, Maheen Gull, and Zachary Atlas
2013 "Evidence for reactive reduced phosphorus species in the early Archean ocean" PNAS 2013 ; published ahead of print June 3, 2013, doi:10.1073/pnas.1303904110

Colin Goldblatt, Timothy M. Lenton and Andrew J. Watson
2006 "Bistability of atmospheric oxygen and the Great Oxidation" Nature 443, 683-686 (12 October 2006) | doi:10.1038/nature05169

Manfred Schidlowski, Peter W. U. Appel, Rudolf Eichmann and Christian E. Junge
1979 "Carbon isotope geochemistry of the 3.7 × 109-yr-old Isua sediments, West Greenland: implications for the Archaean carbon and oxygen cycles" Geochim. Cosmochim. Acta 43, 189-199

Zahnle, Kevin, Laura Schaefer and Bruce Fegley
2010 “Earth's Earliest Atmospheres” Cold Spring Harbor Perspectives in Biology

Ozone with a reducing atmosphere;

Noll KS, Roush TL, Cruikshank DP, Johnson RE, Pendleton YJ.
1997 “Detection of ozone on Saturn's satellites Rhea and Dione. “ Nature 1997 Jul 3;388(6637):45-7

Additionally, UV shielding would only be needed in continental terrains;

Sagan, Carl, Christopher Chyba
1997  “The Early Faint Sun Paradox: Organic Shielding of Ultraviolet-Labile Greenhouse Gases” Science v. 276 (5316): 1217-1221

E. T. Wolf and O. B. Toon
2010 “Fractal Organic Hazes Provided an Ultraviolet Shield for Early Earth” Science 4 June 328: 1266-1268 [DOI: 10.1126/science.1183260]

Watanabe, Y., Martini, J.E.J., Ohmoto, H.
2000 “Geochemical evidence for terrestrial ecosystems 2.6 billion years ago.” letters, Nature, 408, 574-578 (2000).  (terrestrial bio by 2.6 to 2.7 Ga implies sufficient O2 for an biogenic Ozone UV shield)

But, an even better UV shield is ice. And, Ice is an excellent location for several key chemical steps;

Cleaves, H. James, Stanley L. Miller
1998 “Oceanic protection of prebiotic organic compounds from UV radiation” PNAS-USA v. 95, issue 13: 7260-7263

Bada, Jeffrey. L., C. Bigham, Stanley L. Miller
1994 “Impact melting of frozen oceans on the early Earth: Implications for the origin of life” PNAS-USA v.91: 1248-1250

BERNSTEIN, MP, JP DWORKIN, SA SANDFORD, GW COOPER &
LJ ALLAMANDOLA
2002 "Racemic amino acids from the ultraviolet photolysis of interstellar ice analogues"  Nature 416, 401 - 403 (2002)

Attwater, J., Wochner, A., & Holliger, P.
2013 "In-ice evolution of RNA polymerase ribozyme activity" Nature chemistry, 5(12), 1011-1018.

Bernstein, M. P. et al.  
1999 "UV irradiation of polycyclic aromatic hydrocarbons in ices: Production of alcohols, quinones, and ethers" Science 283, 1135–1138

Blank, J.G., Gregory H. Miller, Michael J. Ahrens, Randall E. Winans
2001 “Experimental shock chemistry of aqueous amino acid solutions and the cometary delivery of prebiotic compounds” Origins of Life and Evolution of the Biosphere 31(1-2):
15-51,

GM MUÑOZ CARO, UJ MEIERHENRICH, WA SCHUTTE, B BARBIER, A ARCONES SEGOVIA, H ROSENBAUER, WHP THIEMANN, A BRACK & JM GREENBERG
2002 "Amino acids from ultraviolet irradiation of interstellar ice analogues"  Nature 416, 403 - 406 (2002)

Miyakawa S, Cleaves HJ, Miller SL.
2002 "The cold origin of life: B. Implications based on pyrimidines and purines produced from frozen ammonium cyanide solutions" Orig Life Evol Biosph. 2002 Jun;32(3):209-18

Cleaves HJ, Nelson KE, Miller SL.
2006 "The prebiotic synthesis of pyrimidines in frozen solution" Naturwissenschaften. 2006 Mar 22

And, the final nail in this particular creationist fraud is that abiotic amino acid synthesis can happen in the presence of oxygen;

Cleaves, H. James, John H. Chalmers, Antonio Lazcano, Stanley L. Miller, Jeffrey L. Bada
2008 “A Reassessment of Prebiotic Organic Synthesis in Neutral Planetary Atmospheres” Orig Life Evol Biosph (2008) 38:105–115

So, to review; the Miller/Urey hypothesis was confirmed; the UV "problem" was not a problem.
Posted by: Occam's Aftershave on Nov. 18 2015,18:55

Quote (Otangelo @ Nov. 18 2015,18:34)
 
Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?
---------------------QUOTE-------------------


i am bad on math. sorry
---------------------QUOTE-------------------


You pretty much suck at science too but that's not stopping you.
Posted by: Otangelo on Nov. 18 2015,20:04

Quote (NoName @ Nov. 18 2015,18:44)
Quote (Otangelo @ Nov. 18 2015,19:33)
 
Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly
---------------------QUOTE-------------------


please cite me where i make that admittance.
---------------------QUOTE-------------------


It's implied by your remarks regarding Genesis 1:1, above.  The first post on this page.
Either god created time, which commits you to atemporal causes and atemporal processes, or god did not create the five Spencerian ontological categories you are so impressed by.

But again, this is beside the point.
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

We can return to the more recently raised issues of your ontological confusions and absurdities after we've cleared that up.
---------------------QUOTE-------------------


What i said, does not imply that God created outside of time. That is impossible.

< http://www.leaderu.com/offices....on.html >

the cause of the Big Bang operated at to, that is, simultaneously (or coincidentally{1}) with the Big Bang. Philosophical discussions of causal directionality routinely treat simultaneous causation, the question being how to distinguish A as the cause and B as the effect when these occur together at the same time [Dummett and Flew (1954); Mackie (1966); Suchting (1968-69); Brier (1974), pp. 91-98; Brand (1979)].{2} Even on a mundane level, we regularly experience simultaneous causation;

Non of the alternatives make sense to me :

5 Easy Steps to refute Atheism

< http://reasonandscience.heavenforum.org/t1877-5....sm#3144 >
Posted by: OgreMkV on Nov. 18 2015,20:07

Quote (Otangelo @ Nov. 18 2015,18:34)
Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?
---------------------QUOTE-------------------


i am bad on math. sorry
---------------------QUOTE-------------------


So you have no way of knowing that they are lying to you?

But you trust them. Why?
Posted by: Otangelo on Nov. 18 2015,20:11

Quote (Dr.GH @ Nov. 18 2015,18:53)
Quote (Otangelo @ Nov. 18 2015,10:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


There are many reasons. I will post a small list to begin with:

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.
---------------------QUOTE-------------------


Miller was using the atmospheres of the other Solar System planets known by spectrographic analysis. This was his professor Harold Urey's hypothesis. Charles Darwin's idea was that the origin of life was in a reducing environment because the decomposition products of tissues were reduced. He was incorrect, Urey was correct.

You clearly have no experience in chemistry.



Matthew A. Pasek, Jelte P. Harnmeijer, Roger Buick, Maheen Gull, and Zachary Atlas
2013 "Evidence for reactive reduced phosphorus species in the early Archean ocean" PNAS 2013 ; published ahead of print June 3, 2013, doi:10.1073/pnas.1303904110

Colin Goldblatt, Timothy M. Lenton and Andrew J. Watson
2006 "Bistability of atmospheric oxygen and the Great Oxidation" Nature 443, 683-686 (12 October 2006) | doi:10.1038/nature05169

Manfred Schidlowski, Peter W. U. Appel, Rudolf Eichmann and Christian E. Junge
1979 "Carbon isotope geochemistry of the 3.7 × 109-yr-old Isua sediments, West Greenland: implications for the Archaean carbon and oxygen cycles" Geochim. Cosmochim. Acta 43, 189-199

Zahnle, Kevin, Laura Schaefer and Bruce Fegley
2010 “Earth's Earliest Atmospheres” Cold Spring Harbor Perspectives in Biology

Ozone with a reducing atmosphere;

Noll KS, Roush TL, Cruikshank DP, Johnson RE, Pendleton YJ.
1997 “Detection of ozone on Saturn's satellites Rhea and Dione. “ Nature 1997 Jul 3;388(6637):45-7

Additionally, UV shielding would only be needed in continental terrains;

Sagan, Carl, Christopher Chyba
1997  “The Early Faint Sun Paradox: Organic Shielding of Ultraviolet-Labile Greenhouse Gases” Science v. 276 (5316): 1217-1221

E. T. Wolf and O. B. Toon
2010 “Fractal Organic Hazes Provided an Ultraviolet Shield for Early Earth” Science 4 June 328: 1266-1268 [DOI: 10.1126/science.1183260]

Watanabe, Y., Martini, J.E.J., Ohmoto, H.
2000 “Geochemical evidence for terrestrial ecosystems 2.6 billion years ago.” letters, Nature, 408, 574-578 (2000).  (terrestrial bio by 2.6 to 2.7 Ga implies sufficient O2 for an biogenic Ozone UV shield)

But, an even better UV shield is ice. And, Ice is an excellent location for several key chemical steps;

Cleaves, H. James, Stanley L. Miller
1998 “Oceanic protection of prebiotic organic compounds from UV radiation” PNAS-USA v. 95, issue 13: 7260-7263

Bada, Jeffrey. L., C. Bigham, Stanley L. Miller
1994 “Impact melting of frozen oceans on the early Earth: Implications for the origin of life” PNAS-USA v.91: 1248-1250

BERNSTEIN, MP, JP DWORKIN, SA SANDFORD, GW COOPER &
LJ ALLAMANDOLA
2002 "Racemic amino acids from the ultraviolet photolysis of interstellar ice analogues"  Nature 416, 401 - 403 (2002)

Attwater, J., Wochner, A., & Holliger, P.
2013 "In-ice evolution of RNA polymerase ribozyme activity" Nature chemistry, 5(12), 1011-1018.

Bernstein, M. P. et al.  
1999 "UV irradiation of polycyclic aromatic hydrocarbons in ices: Production of alcohols, quinones, and ethers" Science 283, 1135–1138

Blank, J.G., Gregory H. Miller, Michael J. Ahrens, Randall E. Winans
2001 “Experimental shock chemistry of aqueous amino acid solutions and the cometary delivery of prebiotic compounds” Origins of Life and Evolution of the Biosphere 31(1-2):
15-51,

GM MUÑOZ CARO, UJ MEIERHENRICH, WA SCHUTTE, B BARBIER, A ARCONES SEGOVIA, H ROSENBAUER, WHP THIEMANN, A BRACK & JM GREENBERG
2002 "Amino acids from ultraviolet irradiation of interstellar ice analogues"  Nature 416, 403 - 406 (2002)

Miyakawa S, Cleaves HJ, Miller SL.
2002 "The cold origin of life: B. Implications based on pyrimidines and purines produced from frozen ammonium cyanide solutions" Orig Life Evol Biosph. 2002 Jun;32(3):209-18

Cleaves HJ, Nelson KE, Miller SL.
2006 "The prebiotic synthesis of pyrimidines in frozen solution" Naturwissenschaften. 2006 Mar 22

And, the final nail in this particular creationist fraud is that abiotic amino acid synthesis can happen in the presence of oxygen;

Cleaves, H. James, John H. Chalmers, Antonio Lazcano, Stanley L. Miller, Jeffrey L. Bada
2008 “A Reassessment of Prebiotic Organic Synthesis in Neutral Planetary Atmospheres” Orig Life Evol Biosph (2008) 38:105–115

So, to review; the Miller/Urey hypothesis was confirmed; the UV "problem" was not a problem.
---------------------QUOTE-------------------




---------------------QUOTE-------------------
The early earth had a reduced atmosphere. We know this in several ways. The most significant is geological data.
---------------------QUOTE-------------------



I don't think so.

< http://reasonandscience.heavenforum.org/t1556-t....osphere >

< http://rstb.royalsocietypublishing.org/content....31.long >

Even at ca 3.2 Ga, thick and widespread kerogenous shales are consistent with aerobic photoautrophic marine plankton, and U–Pb data from ca 3.8 Ga metasediments suggest that this metabolism could have arisen by the start of the geological record. Hence, the hypothesis that oxygenic photosynthesis evolved well before the atmosphere became permanently oxygenated seems well supported.

Michael Denton:

   "Ominously, for believers in the traditional organic soup scenario, there is no clear geochemical evidence to exclude the possibility that oxygen was present in the Earth's atmosphere soon after the formation of its crust."

Zircons have been identified that carry signatures identifying them with the Hadean – and zircons are remarkably stable once formed. Using zircons dated to almost 4.4 Ga, the researchers have analysed their redox state (a measure of the degree of oxygenation of the mineral). This gives a handle on the type of gases that would have been outgassed by the magmas, and so, according to these models of Earth history, the type of atmosphere that would have been formed.

  It is important to realise what was predicted by prevailing theories: the redox state of the magmas with which the zircons were associated was expected to be strongly reducing. This prediction is a necessary part of the Earth having a reducing atmosphere in the Hadean. The research findings did not confirm the prediction.
Harry Clemmey and Nick Badham, “Oxygen in the Precambrian Atmosphere: An Evaluation of the Geological Evidence,” Geology, 10, no. 3, (March 1982): 141.
Posted by: Occam's Aftershave on Nov. 18 2015,20:16

Quote (Otangelo @ Nov. 18 2015,20:04)
Non of the alternatives make sense to me :
---------------------QUOTE-------------------


Scientifically determined reality doesn't depend on some ignorant YEC's inability to comprehend it.
Posted by: Otangelo on Nov. 18 2015,20:20

Quote (NoName @ Nov. 18 2015,18:44)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


ah, want more proof. Here we go....

DNA is irreducible complex

< http://reasonandscience.heavenforum.org/t2093-d....complex >

Individual bases : take away the sugar in the DNA backbone = no function
Take away the phosphate in the backbone = no function
Take away the nucleic acid bases = no function
Evolution is not a driving force at this stage, since replication of the cell depends on DNA.
So the individual DNA molecules are irreducible complex
DNA in general ( the double helix )
Unless the two types, purines, and pyrimidines are present, and so the individual four bases = no function, and no hability of information storage
The enzymes and proteins for assembly and synthesis of the DNA structure must also be present, otherwise, no DNA double helix......

Origin of the DNA deoxyribonucleic acid  double helix

< http://reasonandscience.heavenforum.org/t2028-o....e-helix >

Self-organizing biochemical cycles 1

< https://www.ncbi.nlm.nih.gov/pmc....MC18793 >

How were ribonucleotides first formed on the primitive earth? This is a very difficult problem. Stanley Miller's synthesis of the amino acids by sparking a reducing atmosphere (2) was the paradigm for prebiotic synthesis for many years, so at first, it was natural to suppose that similar methods would meet with equal success in the nucleotide field. However, nucleotides are intrinsically more complicated than amino acids, and it is by no means obvious that they can be obtained in a few simple steps under prebiotic conditions. A remarkable synthesis of adenine (3) and more or less plausible syntheses of the pyrimidine nucleoside bases (4) have been reported, but the synthesis of ribose and the regiospecific combination of the bases, ribose, and phosphate to give β-nucleotides remain problematical.

1) < https://www.ncbi.nlm.nih.gov/pmc....MC18793 >
Posted by: Richardthughes on Nov. 18 2015,20:22

Yeah, you don't understand "proof", either.
Posted by: Occam's Aftershave on Nov. 18 2015,20:28

Quote (Otangelo @ Nov. 18 2015,20:20)
ah, want more proof. Here we go....

DNA is irreducible complex
---------------------QUOTE-------------------


You've already been shown how IC structures can evolve through natural processes.  Either you're really stupid or really dishonest, or both.
Posted by: OgreMkV on Nov. 18 2015,20:28

Isn't it fascinating how he links to his own ramblings and to peer-reviewed research he's never read as if he is making some kind of point.

It's almost cute.

Did you ever actually read that Nature article I asked you about (that YOU posted)? The one that actually has a completely different conclusion than the one that was given to you... I mean, that you developed.
Posted by: Occam's Aftershave on Nov. 18 2015,20:33

Quote (OgreMkV @ Nov. 18 2015,20:28)
Isn't it fascinating how he links to his own ramblings and to peer-reviewed research he's never read as if he is making some kind of point.

It's almost cute.

Did you ever actually read that Nature article I asked you about (that YOU posted)? The one that actually has a completely different conclusion than the one that was given to you... I mean, that you developed.
---------------------QUOTE-------------------


He's also copied to his "library" a number of papers from Science and Nature in their entirety, in direct violation of their clearly spelled out copyright policy.

I wonder if we should drop a dime on him?   :p
Posted by: Dr.GH on Nov. 18 2015,21:39

Quote (Otangelo @ Nov. 18 2015,18:11)
< http://rstb.royalsocietypublishing.org/content....31.long >

Even at ca 3.2 Ga, thick and widespread kerogenous shales are consistent with aerobic photoautrophic marine plankton, and U–Pb data from ca 3.8 Ga metasediments suggest that this metabolism could have arisen by the start of the geological record. Hence, the hypothesis that oxygenic photosynthesis evolved well before the atmosphere became permanently oxygenated seems well supported.
---------------------QUOTE-------------------


I realize that you have no understanding of what you claim to have read.

In this case, "When did oxygenic photosynthesis evolve?" by Roger Buick, is entirely consistent with the materials I have posted. Buick's interest was in the onset of photosynthetic oxygen, not the origin of life. And, as he concluded,

---------------------QUOTE-------------------
Thus, these lines of evidence all imply that oxygenic photosynthesis evolved well before abundant molecular oxygen appeared in the environment. In this case, hypothesis (i) in which atmospheric oxygenation is retarded for many hundreds of millions of years after the advent of oxygenic photosynthesis due to the necessity of first filling all near-surface oxygen sinks, is most probably correct.
---------------------QUOTE-------------------



Why were there oxygen sinks that took hundreds of millions of years to convert? Because they were strongly reduced.
Posted by: Otangelo on Nov. 18 2015,22:07

Quote (Dr.GH @ Nov. 18 2015,21:39)
Quote (Otangelo @ Nov. 18 2015,18:11)
< http://rstb.royalsocietypublishing.org/content....31.long >

Even at ca 3.2 Ga, thick and widespread kerogenous shales are consistent with aerobic photoautrophic marine plankton, and U–Pb data from ca 3.8 Ga metasediments suggest that this metabolism could have arisen by the start of the geological record. Hence, the hypothesis that oxygenic photosynthesis evolved well before the atmosphere became permanently oxygenated seems well supported.
---------------------QUOTE-------------------


I realize that you have no understanding of what you claim to have read.

In this case, "When did oxygenic photosynthesis evolve?" by Roger Buick, is entirely consistent with the materials I have posted. Buick's interest was in the onset of photosynthetic oxygen, not the origin of life. And, as he concluded,  

---------------------QUOTE-------------------
Thus, these lines of evidence all imply that oxygenic photosynthesis evolved well before abundant molecular oxygen appeared in the environment. In this case, hypothesis (i) in which atmospheric oxygenation is retarded for many hundreds of millions of years after the advent of oxygenic photosynthesis due to the necessity of first filling all near-surface oxygen sinks, is most probably correct.
---------------------QUOTE-------------------



Why were there oxygen sinks that took hundreds of millions of years to convert? Because they were strongly reduced.
---------------------QUOTE-------------------


you are correct. After i posted it, i realised your observation, and wanted to delete the post. I dont know how imho at this forum
Posted by: JAM on Nov. 18 2015,23:53

Quote (Otangelo @ Nov. 18 2015,13:46)

Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?
---------------------QUOTE-------------------


more reasons :

The hardware and software of the cell, evidence of design

< http://reasonandscience.heavenforum.org/t2221-t....-design >
---------------------QUOTE-------------------



Speaking of hardware, peptidyltransferase is a _.

All that blather and you don't have a clue as to this highly relevant fact.
Posted by: JAM on Nov. 19 2015,00:27

Quote (Otangelo @ Nov. 18 2015,16:12)
 
Quote (NoName @ Nov. 18 2015,17:09)
The Abrahamic god is not a sufficient answer.
---------------------QUOTE-------------------


It might not be to you. But it is certainly to me, and many others...
---------------------QUOTE-------------------


You wouldn't be here spewing your shallow copypasta if it were.
Posted by: EmperorZelos on Nov. 19 2015,06:10



---------------------QUOTE-------------------
According to the most generous mathematical criteria for evolution, abiogenesis and monogenesis are impossible to unimaginable extremes.
---------------------QUOTE-------------------



Yeah no, if you talk to a mathematician you might want to rephrase shit because I spot instantly your flaw. You assume a lot of things that is simply not true to create your mathematical model which is why your conclusion is so flawed.

I notice however that you did not gave areason why you are NOT publishing your work in peer review, why is that?
Posted by: NoName on Nov. 19 2015,06:42

Quote (Otangelo @ Nov. 18 2015,21:04)
Quote (NoName @ Nov. 18 2015,18:44)
 
Quote (Otangelo @ Nov. 18 2015,19:33)
   
Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly
---------------------QUOTE-------------------


please cite me where i make that admittance.
---------------------QUOTE-------------------


It's implied by your remarks regarding Genesis 1:1, above.  The first post on this page.
Either god created time, which commits you to atemporal causes and atemporal processes, or god did not create the five Spencerian ontological categories you are so impressed by.

But again, this is beside the point.
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

We can return to the more recently raised issues of your ontological confusions and absurdities after we've cleared that up.
---------------------QUOTE-------------------


What i said, does not imply that God created outside of time. That is impossible.

< http://www.leaderu.com/offices....on.html >

the cause of the Big Bang operated at to, that is, simultaneously (or coincidentally{1}) with the Big Bang. Philosophical discussions of causal directionality routinely treat simultaneous causation, the question being how to distinguish A as the cause and B as the effect when these occur together at the same time [Dummett and Flew (1954); Mackie (1966); Suchting (1968-69); Brier (1974), pp. 91-98; Brand (1979)].{2} Even on a mundane level, we regularly experience simultaneous causation;

Non of the alternatives make sense to me :

5 Easy Steps to refute Atheism

< http://reasonandscience.heavenforum.org/t1877-5....sm#3144 >
---------------------QUOTE-------------------


What does or does not make sense to you is of little relevance.

What matters here are not the contents of your repeated attempts to shift the grounds of the argument but rather two key points:  that are, in fact, continually shifting your argument and that you appear to be doing so to avoid grappling with the manifold flaws of your initial arguments as noted by the various commentators here.

Yet again:
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

Atheism is an irrelevancy.  There are theistic and atheistic evolutionists.
There are, in at least generous readings of the terms, theistic and atheistic creationists.

What matters is that you've made absolute claims and have failed entirely to defend or support them.

Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.
Posted by: NoName on Nov. 19 2015,06:49

Quote (Otangelo @ Nov. 18 2015,21:20)
Quote (NoName @ Nov. 18 2015,18:44)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


ah, want more proof. Here we go....

DNA is irreducible complex

< http://reasonandscience.heavenforum.org/t2093-d....complex >

Individual bases : take away the sugar in the DNA backbone = no function
Take away the phosphate in the backbone = no function
Take away the nucleic acid bases = no function
Evolution is not a driving force at this stage, since replication of the cell depends on DNA.
So the individual DNA molecules are irreducible complex
DNA in general ( the double helix )
Unless the two types, purines, and pyrimidines are present, and so the individual four bases = no function, and no hability of information storage
The enzymes and proteins for assembly and synthesis of the DNA structure must also be present, otherwise, no DNA double helix......

Origin of the DNA deoxyribonucleic acid  double helix

< http://reasonandscience.heavenforum.org/t2028-o....e-helix >

Self-organizing biochemical cycles 1

< https://www.ncbi.nlm.nih.gov/pmc........MC18793 >

How were ribonucleotides first formed on the primitive earth? This is a very difficult problem. Stanley Miller's synthesis of the amino acids by sparking a reducing atmosphere (2) was the paradigm for prebiotic synthesis for many years, so at first, it was natural to suppose that similar methods would meet with equal success in the nucleotide field. However, nucleotides are intrinsically more complicated than amino acids, and it is by no means obvious that they can be obtained in a few simple steps under prebiotic conditions. A remarkable synthesis of adenine (3) and more or less plausible syntheses of the pyrimidine nucleoside bases (4) have been reported, but the synthesis of ribose and the regiospecific combination of the bases, ribose, and phosphate to give β-nucleotides remain problematical.

1) < https://www.ncbi.nlm.nih.gov/pmc........MC18793 >
---------------------QUOTE-------------------


That's a particularly ridiculous set of assertions from someone who has yet to address the issue I originally raised early in this thread.
DNA is not a 'self-replicating' molecule in and of itself.
It requires a substantial set of complex chemical subsystems with which it interacts.
Take away any of those and it fails to perform as you so simplistically assert that it does.
If you are allowed to ignore the machinery and reduce complex cases to prejudicial overly-simplified sketches, and get away with it, the so am I.  So are we.

Behe's ridiculous 'irreducibly complex' notions have been obliterated, here and elsewhere.
It is an argument from ignorance and incredulity.
'Irreducibly complex' things can evolve.
Consider the arch.
Or perhaps more to the point, and again to raise an evidentiary example you refuse to address, consider the tobacco mosaic virus.

Irreducible complexity is a snare and a delusion.

BTW, nowhere is it granted that abiogenesis nor replication must begin with cells as we know them nor DNA.
You are so out of touch with the last 25, if not 50, years of research as to be unqualified to be making the absolute dicta you are so fond of.

Once again I will suggest you acquaint yourself with Erwin Schrodinger's little masterpiece from the 30's.
Posted by: NoName on Nov. 19 2015,06:50

Quote (Occam's Aftershave @ Nov. 18 2015,21:33)
Quote (OgreMkV @ Nov. 18 2015,20:28)
Isn't it fascinating how he links to his own ramblings and to peer-reviewed research he's never read as if he is making some kind of point.

It's almost cute.

Did you ever actually read that Nature article I asked you about (that YOU posted)? The one that actually has a completely different conclusion than the one that was given to you... I mean, that you developed.
---------------------QUOTE-------------------


He's also copied to his "library" a number of papers from Science and Nature in their entirety, in direct violation of their clearly spelled out copyright policy.

I wonder if we should drop a dime on him?   :p
---------------------QUOTE-------------------


Apparently his morality is as cherry-picked as his standards for argumentation and evidence.

A salad-bar Christian.  What a surprise.
Posted by: The whole truth on Nov. 19 2015,07:04

Quote (Otangelo @ Nov. 18 2015,18:20)
Quote (NoName @ Nov. 18 2015,18:44)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


ah, want more proof. Here we go....

DNA is irreducible complex

< http://reasonandscience.heavenforum.org/t2093-d....complex >

Individual bases : take away the sugar in the DNA backbone = no function
Take away the phosphate in the backbone = no function
Take away the nucleic acid bases = no function
Evolution is not a driving force at this stage, since replication of the cell depends on DNA.
So the individual DNA molecules are irreducible complex
DNA in general ( the double helix )
Unless the two types, purines, and pyrimidines are present, and so the individual four bases = no function, and no hability of information storage
The enzymes and proteins for assembly and synthesis of the DNA structure must also be present, otherwise, no DNA double helix......

Origin of the DNA deoxyribonucleic acid  double helix

< http://reasonandscience.heavenforum.org/t2028-o....e-helix >

Self-organizing biochemical cycles 1

< https://www.ncbi.nlm.nih.gov/pmc........MC18793 >

How were ribonucleotides first formed on the primitive earth? This is a very difficult problem. Stanley Miller's synthesis of the amino acids by sparking a reducing atmosphere (2) was the paradigm for prebiotic synthesis for many years, so at first, it was natural to suppose that similar methods would meet with equal success in the nucleotide field. However, nucleotides are intrinsically more complicated than amino acids, and it is by no means obvious that they can be obtained in a few simple steps under prebiotic conditions. A remarkable synthesis of adenine (3) and more or less plausible syntheses of the pyrimidine nucleoside bases (4) have been reported, but the synthesis of ribose and the regiospecific combination of the bases, ribose, and phosphate to give β-nucleotides remain problematical.

1) < https://www.ncbi.nlm.nih.gov/pmc........MC18793 >
---------------------QUOTE-------------------


The words "Take away" caught my attention. I don't see how taking away a part of something to show that something then becomes non-functional or less functional is evidence against evolution and for 'intelligent design' by a chosen, so-called 'God'. For example, if my legs were taken away I would not be as functional as I am with legs, but that would not support 'intelligent design' of me and/or my legs and it absolutely, positively would not support the alleged existence and actions of any so-called 'God'.  

You could assert that legs aren't a necessary part of a 'biological system', but here are some things that you should think about: What if the DNA, proteins, enzymes, 'code', 'information', or whatever contributes to producing legs in every spider on Earth could be taken away at the same time? If that could be done, every spider on Earth would be non-functional and quickly dead (extinct), but that wouldn't provide any support for claims of non-evolution, and 'intelligent design' (aka creation by an imaginary sky daddy), of spider legs. It would only show that the animals we call spiders, that have what it takes to produce legs, aren't 'functional' without legs.

P.S. If my legs were taken away and if I were still 'functional' at all it would be due to modern medical care/technology, not due to an imaginary 'God'.
Posted by: NoName on Nov. 19 2015,07:22

Otangelo, please take note of this argument, which shows rather well that the theism/atheism debate is orthogonal to the debate over whether or not abiogenesis is possible
Quote (NoName @ Nov. 18 2015,17:22)
Shorter response to Otangelo's drivel:

The deity of the Abrahamic religions does not and cannot solve the problem of abiogenesis.
The god (or "God" if you prefer) of Abraham, Isaac, and Jacob is not biologically alive.
Therefore, the problem remains untouched.
If abiogenesis is impossible, than god can't do it either, not being biologically alive.
If God is claimed to be biologically alive, then he rose from abiogenesis, or abiogenesis is possible and there is some prior 'process' which led to his life.
If God is not biologically alive (and he possesses none of the hallmarks of biologically living things), and he 'created' life, then we still have the problem of how.
Asserting it sans positive evidence does not solve the problem of how abiogenesis occurred.
Unless everything, literally, is alive, the problem remains how did life arise?
"Poof" is not an answer.
---------------------QUOTE-------------------



I will  add that "poof" is not an answer because it is not a mechanism of any sort.  It has no explanatory power, and, as such, does not address the question of how life occurred.
Just as 'Larry did it' does not answer the question of how Moe was killed.
Posted by: The whole truth on Nov. 19 2015,07:32

Otangelo preached:

"In genesis it says God spoke and things came into existence."

So? In Horton Hears a Who! it says that Horton Hears a Who. Does that mean that Horton is real and that Horton actually hears a Who?

"God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ."

Otangelo, here's a different version of your sermon:

Gumby is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean Gumby does not understand or can't. Mystery to us is not mystery to Gumby, but we do know that Gumby is not limited to His spiritual realm, as he shown with his becoming of flesh in Pokey.

It makes as much sense as your version.
Posted by: NoName on Nov. 19 2015,08:08

Quote (Otangelo @ Nov. 18 2015,16:35)
...
In genesis it says God spoke and things came into existence.
---------------------QUOTE-------------------


So?  In Gone With the Wind it says Scarlett O'Hara wore a dress made of curtains.  Does this warrant belief that Scarlett O'Hara existed in the natural world?  That she crafted a dress out of curtains?
If not, why accept the claims in genesis, the first entry in that  massive, and massively edited as well as internally contradictory, anthology called 'The Bible'?
 

---------------------QUOTE-------------------
God is a potent cause with power ( energy )
---------------------QUOTE-------------------


How do you know?  Cause is material, God typically is taken to be immaterial.  Cause is natural, God is typically taken to be 'outside nature', whatever that means.
The only eternal immaterial 'things' we know of have no causal power.  Integers, the laws of logic, etc.
 

---------------------QUOTE-------------------
and his spoken word indicates information.
---------------------QUOTE-------------------


That's tautological.  Any 'spoken word' indicates 'information'.  It is also highly problematic, for none, absolutely none, of the conditions taken to be necessary for all, absolutely all, occurrences of the spoken word, obtain in the case of some immaterial entity 'speaking' some material entity into existence.
 

---------------------QUOTE-------------------
Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't.
---------------------QUOTE-------------------


Nor does it mean that we can know that he does.
Worse, if he does and we don't, it is logically impermissible for us to have recourse to his alleged but unevidenced understanding as any part of an explanation.  That's not how explanation works.
 

---------------------QUOTE-------------------
Mystery to us is not mystery to God,
---------------------QUOTE-------------------


How do you know?  What justifies the truth claim uttered here?
 

---------------------QUOTE-------------------
  but we do know that God is not limited to His spiritual realm,
---------------------QUOTE-------------------


How do we know this?  Your subsequent remark does not do the job.  What justifies this truth claim?  Quite literally everything we know about cause places it firmly in the non-spiritual realm, i.e., nature.


---------------------QUOTE-------------------
  as he shown with his becoming of flesh in Jesus Christ.
---------------------QUOTE-------------------


Unsubstantiated.  Existing documentation, such as it is, is unsupported and internally contradictory.
Rejected as spurious until and unless you can justify the truth claim.
Posted by: EmperorZelos on Nov. 19 2015,08:16

Easy steps to refute ahteism....wrong on step one. Talk about failure.
Posted by: Otangelo on Nov. 19 2015,09:29

Quote (EmperorZelos @ Nov. 19 2015,06:10)
I notice however that you did not gave areason why you are NOT publishing your work in peer review, why is that?
---------------------QUOTE-------------------


Why should i ? the case is totally obvious to any person of average intelligence and even shallow understanding of the requirements for life to start, your demand is futile.

What i will describe below, applies to the origin of life as well.

Chlorophyll biosynthesis is a complex pathway with 17 highly specific steps, of which eight last steps are used by specific enzymes uniquely in this pathway.

Even if we find in the sequence space the right steps to make the enzymes required to permit the synthesis of the products of these intermediate steps, so what ? the intermediate products would have no function, and no survival advantage of the organism would be provided. Natural selection could not operate to favor a system with anything less than all seventeen enzymes being present, functioning and processing all intermediate products to get the final product. What evolutionary process could possibly produce complex sophisticated enzymes that generate nothing useful until the whole process is complete? And even if everything were in place correctly, and chlorophyll were synthesized correctly, so what ? Unless chlorophyll AND all other proteins and protein complexes were fully in place, fully evolved and functional, correctly interlocked and working in a interdependent manner, photosynthesis would not happen. But even if photosynthesis would happen, so what ? Why would the organism chose such a extremely complex mechanism, if it was surviving just fine previously ? Furthermore, you do not just need the right enzymes. For the assembly of a biological system of multiple parts, following steps must be explained : the origin of the genome information to produce all subunits and assembly cofactors. Parts availability, synchronization, manufacturing and assembly coordination through genetic information, and interface compatibility. The individual parts must precisely fit together. All these steps are better explained through a super intelligent and powerful designer, rather than mindless natural processes by chance, or / and evolution, since we observe all the time minds capabilities producing machines and factories, producing machines and end products.

everything *has* to be in place at once or else an organism has no survival advantage. The thing is, there’s no driver for any of the pieces to evolve individually because single parts confer no advantage in and of themselves. The necessity for the parts of the system to be in place all at once is simply evidence of creation. Photosynthesis missing one piece (like chlorophylls) is like a car missing just one piece of the drive train (such as a differential); it’s not that it doesn’t function as well – it doesn’t function at all!
Posted by: Otangelo on Nov. 19 2015,09:34

Quote (NoName @ Nov. 19 2015,06:42)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


I'll give you another example.

Topoisomerase II enzymes, amazing evidence of design

Complete and equal transmission of DNA to daughter cells is  crucial during mitosis. During cell division, each daughter cell inherits one copy of every chromosome. The metaphase-to-anaphase transition is the critical point in the cell cycle where the cell commits to separation of sister chromatids . Once spindle attachment is complete, cohesion must be eliminated to enable the physical separation of sister chromatids. This requires cleavage of the protein complex cohesin by separase and, in some instances, completion of chromosome decatenation. Catenation is the process by which two circular DNA strands are linked together like chain links. This occurs after DNA replication, where two single strands are catenated and can still replicate but cannot separate into the two daughter cells.

II Topoisomerase enzymes  is a ubiquitous enzyme that is essential for the survival of all eukaryotic organisms and plays critical roles in virtually every aspect of DNA metabolism. It performs the amazing feat of breaking a DNA double helix, passing another helix through the gap, and resealing the double helix behind it.  They are essential in the separation of entangled daughter strands during replication. This function is believed to be performed by topoisomerase II in eukaryotes and by topoisomerase IV in prokaryotes. Failure to separate these strands leads to cell death. As genetic material DNA is wonderful, but as a macromolecule it is unruly, voluminous and fragile. Without the action of DNA replicases, topoisomerases, helicases, translocases and recombinases, the genome would collapse into a topologically entangled random coil that would be useless to the cell.  The topoisomerase is thought to be a highly dynamic structure, with several gates for entry of DNA into the two DNA-sized holes. Loss of topoisomerase activity in metaphase leads to delayed exit and extensive anaphase chromosome bridging, often resulting in cytokinesis failure, although maintenance of limited catenation until anaphase may be important for sister chromatid structural organization 9 Accurate transmission of chromosomes requires that the sister DNA molecules created during DNA replication are disentangled and then pulled to opposite poles of the cell before division. Defects in chromosome segregation produce cells that are aneuploid (containing an abnormal number of chromosomes)-a situation that can have dire consequences.

Like many other enzymes, topoisomerase II are essential for cell function, and had to be present in the first living cell to exercise their function right in the beginning, when life began.

Within each chromosome, two dimensions of organization are at play: condensation along the axes ensures the entire chromatid, end-to-end, is kept together 8 , while the tight association of sister chromatids until anaphase, termed sister chromatid cohesion (SCC), ensures that each daughter cell receives only one copy . Two mechanisms are known to play a role in SCC: DNA catenation, which physically interlocks (catenates) DNA across the sister chromatids ; and protein linkages through the cohesin complex, which physically tether the sister chromatids to one another.

Topoisomerase II forms a covalent linkage to both strands of the DNA helix at the same time, making a transient double-strand break in the helix. These enzymes are activated by sites on chromosomes where two double helices cross over each other such as those generated by supercoiling in front of a replication fork

Once a topoisomerase II molecule binds to such a crossing site, the protein uses ATP hydrolysis to perform the following set of reactions efficiently:

(1) it breaks one double helix reversibly to create a DNA “gate”;
(2) it causes the second, nearby double helix to pass through this opening; and
(3) it then reseals the break and dissociates from the DNA. At crossover points generated by supercoiling, passage of the double helix through the gate occurs in the direction that will reduce supercoiling. In this way, type II topoisomerases can relieve the overwinding tension generated in front of a replication fork. Their reaction mechanism also allows type II DNA topoisomerases to efficiently separate two interlocked DNA circles. Topoisomerase II also prevents the severe DNA tangling problems that would otherwise arise during DNA replication. The enormous usefulness of topoisomerase II for untangling chromosomes can readily be appreciated by anyone who has struggled to remove a tangle from a fishing line without the aid of scissors.


These molecular machines are far beyond what unguided processes involving chance and necessity can produce. Indeed, machinery of the complexity and sophistication of Topoisomerase enzymes are, based on our experience, usually atributed to intelligent agents.

Type IIA topoisomerases consist of several key motifs: an

N-terminal GHKL ATPase domain

Toprim domain

central DNA-binding core

C-terminal domain

Each of these key motifs are essential for the proper function of the enzyme. No part can be reduced, and neither is it possible any of the subparts to emerge by natural means. Not only had the enzyme to emerge prior to the first cell being formed, and so could not be the result of evolution, but the sub parts by themself, and the enzyme by itself even fully formed,  would have no use, unless the DNA double helix molecules were already existing as well, and so the whole process of cell division, mitosis, and catenation, which happens through DNA replication. The enzyme is however essential for life, so if Topo II is removed, life could not exist. So we have here one of inumerous essential seemingly tiny and aparently unimportant parts, which by closer looking reveal to be life essential. This provides another big question mark in regard of naturalistic explanations, provides on the other part ones more a powerful argument for design.

< http://reasonandscience.heavenforum.org/t2111-t....gn#3754 >
Posted by: Richardthughes on Nov. 19 2015,09:35

That doesn't explain why it is impossible.
Posted by: Occam's Aftershave on Nov. 19 2015,09:36

Quote (Otangelo @ Nov. 19 2015,09:29)
 
Quote (EmperorZelos @ Nov. 19 2015,06:10)
I notice however that you did not gave areason why you are NOT publishing your work in peer review, why is that?
---------------------QUOTE-------------------


Why should i ? the case is totally obvious to any person of average intelligence and even shallow understanding of the requirements for life to start, your demand is futile.
---------------------QUOTE-------------------


Well, that settles it then.  "Design" is obvious to a scientifically illiterate YEC internet blowhard so no scientific evidence is necessary.

I bet you think the Sun orbits a flat, stationary Earth too, right?  After all that's what your "Bible science textbook"  teaches.   :D
Posted by: Otangelo on Nov. 19 2015,09:37

Quote (NoName @ Nov. 19 2015,06:49)
Quote (Otangelo @ Nov. 18 2015,21:20)
Quote (NoName @ Nov. 18 2015,18:44)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


ah, want more proof. Here we go....

DNA is irreducible complex

< http://reasonandscience.heavenforum.org/t2093-d....complex >

Individual bases : take away the sugar in the DNA backbone = no function
Take away the phosphate in the backbone = no function
Take away the nucleic acid bases = no function
Evolution is not a driving force at this stage, since replication of the cell depends on DNA.
So the individual DNA molecules are irreducible complex
DNA in general ( the double helix )
Unless the two types, purines, and pyrimidines are present, and so the individual four bases = no function, and no hability of information storage
The enzymes and proteins for assembly and synthesis of the DNA structure must also be present, otherwise, no DNA double helix......

Origin of the DNA deoxyribonucleic acid  double helix

< http://reasonandscience.heavenforum.org/t2028-o....e-helix >

Self-organizing biochemical cycles 1

< https://www.ncbi.nlm.nih.gov/pmc........MC18793 >

How were ribonucleotides first formed on the primitive earth? This is a very difficult problem. Stanley Miller's synthesis of the amino acids by sparking a reducing atmosphere (2) was the paradigm for prebiotic synthesis for many years, so at first, it was natural to suppose that similar methods would meet with equal success in the nucleotide field. However, nucleotides are intrinsically more complicated than amino acids, and it is by no means obvious that they can be obtained in a few simple steps under prebiotic conditions. A remarkable synthesis of adenine (3) and more or less plausible syntheses of the pyrimidine nucleoside bases (4) have been reported, but the synthesis of ribose and the regiospecific combination of the bases, ribose, and phosphate to give β-nucleotides remain problematical.

1) < https://www.ncbi.nlm.nih.gov/pmc........MC18793 >
---------------------QUOTE-------------------


That's a particularly ridiculous set of assertions from someone who has yet to address the issue I originally raised early in this thread.
DNA is not a 'self-replicating' molecule in and of itself.
It requires a substantial set of complex chemical subsystems with which it interacts.
Take away any of those and it fails to perform as you so simplistically assert that it does.
If you are allowed to ignore the machinery and reduce complex cases to prejudicial overly-simplified sketches, and get away with it, the so am I.  So are we.

Behe's ridiculous 'irreducibly complex' notions have been obliterated, here and elsewhere.
It is an argument from ignorance and incredulity.
'Irreducibly complex' things can evolve.
Consider the arch.
Or perhaps more to the point, and again to raise an evidentiary example you refuse to address, consider the tobacco mosaic virus.

Irreducible complexity is a snare and a delusion.

BTW, nowhere is it granted that abiogenesis nor replication must begin with cells as we know them nor DNA.
You are so out of touch with the last 25, if not 50, years of research as to be unqualified to be making the absolute dicta you are so fond of.

Once again I will suggest you acquaint yourself with Erwin Schrodinger's little masterpiece from the 30's.
---------------------QUOTE-------------------


You have  simply  ignored everything, and NOT addressed anything of what i said. Nice red herring imho ... congrats.

So, my assertion stands. DNA cannot arise by natural mechanisms alone. The molecule is IC.

Big fail so far to refute my claim.
Posted by: Occam's Aftershave on Nov. 19 2015,09:40

Quote (Otangelo @ Nov. 19 2015,09:34)
These molecular machines are far beyond what unguided processes involving chance and necessity can produce.
---------------------QUOTE-------------------


So you keep asserting but can't provide a single piece of evidence to back up.

Are you omnipotent?  How do you know what unguided evolutionary processes can and cannot do?
Posted by: Otangelo on Nov. 19 2015,09:40

Quote (NoName @ Nov. 19 2015,07:22)
I will  add that "poof" is not an answer because it is not a mechanism of any sort.
---------------------QUOTE-------------------


I agree.

Did i make that argument ? No.

So stop misrepresenting my claims and arguments.

And if you want to make a compelling case for naturalism, you need to provide positive explanations why you think natural mechanisms are enough to explain the origin and existence of the universe, and all in it.
Posted by: Otangelo on Nov. 19 2015,09:42

Quote (The whole truth @ Nov. 19 2015,07:32)
It makes as much sense as your version.
---------------------QUOTE-------------------


Ahm . Well. Hummm. You are right. I changed my mind.

0 x 0 = everything.

:O
Posted by: Occam's Aftershave on Nov. 19 2015,09:43

Quote (Otangelo @ Nov. 19 2015,09:37)
You have  simply  ignored everything, and NOT addressed anything of what i said. Nice red herring imho ... congrats.

So, my assertion stands. DNA cannot arise by natural mechanisms alone. The molecule is IC.

Big fail so far to refute my claim.
---------------------QUOTE-------------------


We've addressed all your C&Ped plagiarized idiocy.  It's a scientific fact IC structures can evolve so claiming "DNA is IC" doesn't support your IDiot claims.
Posted by: rossum on Nov. 19 2015,10:00

Quote (Otangelo @ Nov. 19 2015,09:37)
The molecule is IC.
---------------------QUOTE-------------------


Being IC is no bar to arising naturally through natural mechanisms.  Have a look at Behe and Snoke (2004) "Simulating evolution by gene duplication of protein features that require multiple amino acid residues" -- yes, it is that Behe.  Professor Behe testified under oath that this 2004 paper showed that simple IC systems could evolve in around 20,000 years.  Lenski (2003) also shows the same thing, that IC systems can evolve.  Behe was correct in that they do not evolve by direct routes, but there are alternative, indirect, routes which can be followed to reach an IC system.

Your ID sources are lying to you.
Posted by: Otangelo on Nov. 19 2015,10:28

Quote (rossum @ Nov. 19 2015,10:00)
Quote (Otangelo @ Nov. 19 2015,09:37)
The molecule is IC.
---------------------QUOTE-------------------


Being IC is no bar to arising naturally through natural mechanisms.  Have a look at Behe and Snoke (2004) "Simulating evolution by gene duplication of protein features that require multiple amino acid residues" -- yes, it is that Behe.  Professor Behe testified under oath that this 2004 paper showed that simple IC systems could evolve in around 20,000 years.  Lenski (2003) also shows the same thing, that IC systems can evolve.  Behe was correct in that they do not evolve by direct routes, but there are alternative, indirect, routes which can be followed to reach an IC system.

Your ID sources are lying to you.
---------------------QUOTE-------------------


Rossum

feel free to address my post no.69.
Posted by: The whole truth on Nov. 19 2015,11:08

Quote (Otangelo @ Nov. 19 2015,07:34)
Quote (NoName @ Nov. 19 2015,06:42)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


I'll give you another example.

Topoisomerase II enzymes, amazing evidence of design

Complete and equal transmission of DNA to daughter cells is  crucial during mitosis. During cell division, each daughter cell inherits one copy of every chromosome. The metaphase-to-anaphase transition is the critical point in the cell cycle where the cell commits to separation of sister chromatids . Once spindle attachment is complete, cohesion must be eliminated to enable the physical separation of sister chromatids. This requires cleavage of the protein complex cohesin by separase and, in some instances, completion of chromosome decatenation. Catenation is the process by which two circular DNA strands are linked together like chain links. This occurs after DNA replication, where two single strands are catenated and can still replicate but cannot separate into the two daughter cells.

II Topoisomerase enzymes  is a ubiquitous enzyme that is essential for the survival of all eukaryotic organisms and plays critical roles in virtually every aspect of DNA metabolism. It performs the amazing feat of breaking a DNA double helix, passing another helix through the gap, and resealing the double helix behind it.  They are essential in the separation of entangled daughter strands during replication. This function is believed to be performed by topoisomerase II in eukaryotes and by topoisomerase IV in prokaryotes. Failure to separate these strands leads to cell death. As genetic material DNA is wonderful, but as a macromolecule it is unruly, voluminous and fragile. Without the action of DNA replicases, topoisomerases, helicases, translocases and recombinases, the genome would collapse into a topologically entangled random coil that would be useless to the cell.  The topoisomerase is thought to be a highly dynamic structure, with several gates for entry of DNA into the two DNA-sized holes. Loss of topoisomerase activity in metaphase leads to delayed exit and extensive anaphase chromosome bridging, often resulting in cytokinesis failure, although maintenance of limited catenation until anaphase may be important for sister chromatid structural organization 9 Accurate transmission of chromosomes requires that the sister DNA molecules created during DNA replication are disentangled and then pulled to opposite poles of the cell before division. Defects in chromosome segregation produce cells that are aneuploid (containing an abnormal number of chromosomes)-a situation that can have dire consequences.

Like many other enzymes, topoisomerase II are essential for cell function, and had to be present in the first living cell to exercise their function right in the beginning, when life began.

Within each chromosome, two dimensions of organization are at play: condensation along the axes ensures the entire chromatid, end-to-end, is kept together 8 , while the tight association of sister chromatids until anaphase, termed sister chromatid cohesion (SCC), ensures that each daughter cell receives only one copy . Two mechanisms are known to play a role in SCC: DNA catenation, which physically interlocks (catenates) DNA across the sister chromatids ; and protein linkages through the cohesin complex, which physically tether the sister chromatids to one another.

Topoisomerase II forms a covalent linkage to both strands of the DNA helix at the same time, making a transient double-strand break in the helix. These enzymes are activated by sites on chromosomes where two double helices cross over each other such as those generated by supercoiling in front of a replication fork

Once a topoisomerase II molecule binds to such a crossing site, the protein uses ATP hydrolysis to perform the following set of reactions efficiently:

(1) it breaks one double helix reversibly to create a DNA “gate”;
(2) it causes the second, nearby double helix to pass through this opening; and
(3) it then reseals the break and dissociates from the DNA. At crossover points generated by supercoiling, passage of the double helix through the gate occurs in the direction that will reduce supercoiling. In this way, type II topoisomerases can relieve the overwinding tension generated in front of a replication fork. Their reaction mechanism also allows type II DNA topoisomerases to efficiently separate two interlocked DNA circles. Topoisomerase II also prevents the severe DNA tangling problems that would otherwise arise during DNA replication. The enormous usefulness of topoisomerase II for untangling chromosomes can readily be appreciated by anyone who has struggled to remove a tangle from a fishing line without the aid of scissors.


These molecular machines are far beyond what unguided processes involving chance and necessity can produce. Indeed, machinery of the complexity and sophistication of Topoisomerase enzymes are, based on our experience, usually atributed to intelligent agents.

Type IIA topoisomerases consist of several key motifs: an

N-terminal GHKL ATPase domain

Toprim domain

central DNA-binding core

C-terminal domain

Each of these key motifs are essential for the proper function of the enzyme. No part can be reduced, and neither is it possible any of the subparts to emerge by natural means. Not only had the enzyme to emerge prior to the first cell being formed, and so could not be the result of evolution, but the sub parts by themself, and the enzyme by itself even fully formed,  would have no use, unless the DNA double helix molecules were already existing as well, and so the whole process of cell division, mitosis, and catenation, which happens through DNA replication. The enzyme is however essential for life, so if Topo II is removed, life could not exist. So we have here one of inumerous essential seemingly tiny and aparently unimportant parts, which by closer looking reveal to be life essential. This provides another big question mark in regard of naturalistic explanations, provides on the other part ones more a powerful argument for design.

< http://reasonandscience.heavenforum.org/t2111-t....gn#3754 >
---------------------QUOTE-------------------


Why are you pretending that scientific evidence matters to you? Could there ever be any scientific evidence that would convince you to discard your religious beliefs?

If it were discovered that there is a 'creator' but that it wasn't/isn't your chosen, so called 'God' and is nothing like your chosen, so-called 'God', would you discard your religious beliefs?
Posted by: Otangelo on Nov. 19 2015,11:17

Quote (The whole truth @ Nov. 19 2015,11:08)
If it were discovered that there is a 'creator' but that it wasn't/isn't your chosen, so called 'God' and is nothing like your chosen, so-called 'God', would you discard your religious beliefs?
---------------------QUOTE-------------------


I would want to know that different God.

What would convince you that design explains best our existence ?
Posted by: EmperorZelos on Nov. 19 2015,11:19



---------------------QUOTE-------------------
Why should i ? the case is totally obvious to any person of average intelligence and even shallow understanding of the requirements for life to start, your demand is futile.
---------------------QUOTE-------------------


You'd save the scientific community lots of work because they apperently disagree with you vastely on just about every point. If you can produce real evidence they would stop wasting time.
Posted by: EmperorZelos on Nov. 19 2015,11:20



---------------------QUOTE-------------------
What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


Well how about a list?

1: You stop arguement from ignorance
2: You publish your findings in actual scientific peer reviewed journals that are reputable
3: You learn what words and things actually means so you can apply it properly
4: You stop putting the  cart before the horse

A good start
Posted by: NoName on Nov. 19 2015,12:01

Quote (Otangelo @ Nov. 19 2015,10:40)
Quote (NoName @ Nov. 19 2015,07:22)
I will  add that "poof" is not an answer because it is not a mechanism of any sort.
---------------------QUOTE-------------------


I agree.

Did i make that argument ? No.

So stop misrepresenting my claims and arguments.

And if you want to make a compelling case for naturalism, you need to provide positive explanations why you think natural mechanisms are enough to explain the origin and existence of the universe, and all in it.
---------------------QUOTE-------------------


How is your argument anything other than "poof"?
How does 'God did it' a mechanism?

So, I challenge your assertion that I am misrepresenting your argument.  As it stands, I see no other argument being made.

As to 'a compelling case for naturalism', not my job.  You are attempting to make a case for the existence of, indeed, the necessity of, an alternative explanation.
I'm  challenging that, because no satisfactory case for any explanation, any explanatory mechanism, other than naturalism has ever been made.
As such, it is at the very least,  the default position.

If you want me to abandon it, you need to do much better than "I don't accept it".  I, on the other hand, do not.
That's how burden of proof works.
Neither I nor the other participants on this thread showed up at your doorstep, literally or figuratively, and began asserting that your position was wrong.
You, on the other hand, showed up here and began insisting that our position is wrong.
I, and others, have pointed out that your arguments are unsupportable.
You have failed to meet the challenges raised.

So stop misrepresenting what's going on here.
Posted by: Otangelo on Nov. 19 2015,12:08

Quote (EmperorZelos @ Nov. 19 2015,11:19)


---------------------QUOTE-------------------
Why should i ? the case is totally obvious to any person of average intelligence and even shallow understanding of the requirements for life to start, your demand is futile.
---------------------QUOTE-------------------


You'd save the scientific community lots of work because they apperently disagree with you vastely on just about every point. If you can produce real evidence they would stop wasting time.
---------------------QUOTE-------------------


They disagree based on what evidence, exactly ?
Posted by: NoName on Nov. 19 2015,12:09

Quote (Otangelo @ Nov. 19 2015,10:37)
Quote (NoName @ Nov. 19 2015,06:49)
Quote (Otangelo @ Nov. 18 2015,21:20)
 
Quote (NoName @ Nov. 18 2015,18:44)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


ah, want more proof. Here we go....

DNA is irreducible complex

< http://reasonandscience.heavenforum.org/t2093-d....complex >

Individual bases : take away the sugar in the DNA backbone = no function
Take away the phosphate in the backbone = no function
Take away the nucleic acid bases = no function
Evolution is not a driving force at this stage, since replication of the cell depends on DNA.
So the individual DNA molecules are irreducible complex
DNA in general ( the double helix )
Unless the two types, purines, and pyrimidines are present, and so the individual four bases = no function, and no hability of information storage
The enzymes and proteins for assembly and synthesis of the DNA structure must also be present, otherwise, no DNA double helix......

Origin of the DNA deoxyribonucleic acid  double helix

< http://reasonandscience.heavenforum.org/t2028-o....e-helix >

Self-organizing biochemical cycles 1

< https://www.ncbi.nlm.nih.gov/pmc........MC18793 >

How were ribonucleotides first formed on the primitive earth? This is a very difficult problem. Stanley Miller's synthesis of the amino acids by sparking a reducing atmosphere (2) was the paradigm for prebiotic synthesis for many years, so at first, it was natural to suppose that similar methods would meet with equal success in the nucleotide field. However, nucleotides are intrinsically more complicated than amino acids, and it is by no means obvious that they can be obtained in a few simple steps under prebiotic conditions. A remarkable synthesis of adenine (3) and more or less plausible syntheses of the pyrimidine nucleoside bases (4) have been reported, but the synthesis of ribose and the regiospecific combination of the bases, ribose, and phosphate to give β-nucleotides remain problematical.

1) < https://www.ncbi.nlm.nih.gov/pmc........MC18793 >
---------------------QUOTE-------------------


That's a particularly ridiculous set of assertions from someone who has yet to address the issue I originally raised early in this thread.
DNA is not a 'self-replicating' molecule in and of itself.
It requires a substantial set of complex chemical subsystems with which it interacts.
Take away any of those and it fails to perform as you so simplistically assert that it does.
If you are allowed to ignore the machinery and reduce complex cases to prejudicial overly-simplified sketches, and get away with it, the so am I.  So are we.

Behe's ridiculous 'irreducibly complex' notions have been obliterated, here and elsewhere.
It is an argument from ignorance and incredulity.
'Irreducibly complex' things can evolve.
Consider the arch.
Or perhaps more to the point, and again to raise an evidentiary example you refuse to address, consider the tobacco mosaic virus.

Irreducible complexity is a snare and a delusion.

BTW, nowhere is it granted that abiogenesis nor replication must begin with cells as we know them nor DNA.
You are so out of touch with the last 25, if not 50, years of research as to be unqualified to be making the absolute dicta you are so fond of.

Once again I will suggest you acquaint yourself with Erwin Schrodinger's little masterpiece from the 30's.
---------------------QUOTE-------------------


You have  simply  ignored everything, and NOT addressed anything of what i said. Nice red herring imho ... congrats.

So, my assertion stands. DNA cannot arise by natural mechanisms alone. The molecule is IC.

Big fail so far to refute my claim.
---------------------QUOTE-------------------


Your claim is an unsupported, and unsupportable, assertion.
That 'irreducible complexity' is real and applies is your argument.
You have provided no grounds to accept it.
It has been rejected by knowledgeable individuals, including, when push comes to shove, the originator of the notion, Behe himself.  See the testimony at Dover.

Until and unless you can demonstrate the actual factual occurrence of something not just wildly impossible, but ruled out by the laws of chemistry and physics,  your arguments fail.

Your points have, in fact, all been addressed.
I have  also pointed out that your points are irrelevant to the matters at hand.
You are shifting the goalposts and Gish galloping in a furious attempt to shift the burden of proof.

Your claim has been refuted.
You have merely asserted that  DNA cannot arise by natural mechanisms.
You have not identified a single aspect of DNA that requires non-chemical or non-physical acts of any sort.
The laws of chemistry and physics suffice, for no reason to question their sufficiency has survived scrutiny.
Including all of your copy/pasta.

Wrestle with the tobacco mosaic virus  example.  It is a marvelous little example that shows how a non-living crystal can become alive and then once again become a non-living crystal, over and over and over again.
The one who is avoiding matters, who is ignoring what is said, is you.  And yet you are the one here who is making positive, and absolute, claims.  You are demonstrably unqualified to make those claims because you clearly do not understand the fields in question.
Your assertions are merely that.  That which is asserted without evidence or reason can be rejected without evidence or reason.
We have, however, presented reams of evidence and reason, all of which you have ignored.

Shameful.
Posted by: Otangelo on Nov. 19 2015,12:09

Quote (EmperorZelos @ Nov. 19 2015,11:20)


---------------------QUOTE-------------------
What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


Well how about a list?

1: You stop arguement from ignorance
2: You publish your findings in actual scientific peer reviewed journals that are reputable
3: You learn what words and things actually means so you can apply it properly
4: You stop putting the  cart before the horse

A good start
---------------------QUOTE-------------------


Hey, its not about ME.

Again : what evidence do you expect to encounter in nature to infer design as the best explanation ?
Posted by: NoName on Nov. 19 2015,12:12

Quote (Otangelo @ Nov. 19 2015,12:17)
Quote (The whole truth @ Nov. 19 2015,11:08)
If it were discovered that there is a 'creator' but that it wasn't/isn't your chosen, so called 'God' and is nothing like your chosen, so-called 'God', would you discard your religious beliefs?
---------------------QUOTE-------------------


I would want to know that different God.

What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


Already addressed, and, to no one's surprise, ignored by you.

Design is a red herring.  What is needed is not evidence of design.
What is needed is sign of manufacture.

Designs are not self-implementing.
Many designs exist for things not built.
Many things are built for which there are not designs.

No argument to design can establish manufacture, and that is what is required.
Design is not a mechanism for producing anything other than designs.
You need more than that.
Posted by: Richardthughes on Nov. 19 2015,12:12

Quote (Occam's Aftershave @ Nov. 18 2015,20:33)
Quote (OgreMkV @ Nov. 18 2015,20:28)
Isn't it fascinating how he links to his own ramblings and to peer-reviewed research he's never read as if he is making some kind of point.

It's almost cute.

Did you ever actually read that Nature article I asked you about (that YOU posted)? The one that actually has a completely different conclusion than the one that was given to you... I mean, that you developed.
---------------------QUOTE-------------------


He's also copied to his "library" a number of papers from Science and Nature in their entirety, in direct violation of their clearly spelled out copyright policy.

I wonder if we should drop a dime on him?   :p
---------------------QUOTE-------------------


LIAR AND A THIEF. Well done, Otangelo. The designer must be proud.  :D
Posted by: NoName on Nov. 19 2015,12:17

Quote (NoName @ Nov. 18 2015,17:22)
...
The deity of the Abrahamic religions does not and cannot solve the problem of abiogenesis.
The god (or "God" if you prefer) of Abraham, Isaac, and Jacob is not biologically alive.
Therefore, the problem remains untouched.
If abiogenesis is impossible, than god can't do it either, not being biologically alive.
If God is claimed to be biologically alive, then he rose from abiogenesis, or abiogenesis is possible and there is some prior 'process' which led to his life.
If God is not biologically alive (and he possesses none of the hallmarks of biologically living things), and he 'created' life, then we still have the problem of how.
Asserting it sans positive evidence does not solve the problem of how abiogenesis occurred.
Unless everything, literally, is alive, the problem remains how did life arise?
"Poof" is not an answer.
---------------------QUOTE-------------------


Otangelo, kindly address this argument.

It seems to me to be sufficient to dismiss any and all of your claims that abiogenesis is impossible.
Given that we have living things and we have non-living things, abiogenesis must have occurred.
You have no answer to the all-important question of 'how'.
It may be that naturalism does not have one either.
Naturalism, however, continues the search.
You stop at 'poof'.
That accomplishes nothing.
Creationism is, at its very best, a dead end.  The death of the mind.
Posted by: Occam's Aftershave on Nov. 19 2015,12:17

Quote (Otangelo @ Nov. 19 2015,12:09)
Hey, its not about ME.

Again : what evidence do you expect to encounter in nature to infer design as the best explanation ?
---------------------QUOTE-------------------


The physical mechanisms used for manufacture, including how the raw materials were gathered and manipulated.

A timeline of when the manufacturing was done.

Location(s) of where the manufacturing was done.

The number of Designers.

Whether the Designers were cooperating or working at cross-purposes.

A method to determine the capabilities and limitations of the hypothesized Designer(s).

The motivation of the Designer(s)

A positive identification of the Designer(s).
Posted by: Otangelo on Nov. 19 2015,12:19

Quote (NoName @ Nov. 19 2015,12:01)
How is your argument anything other than "poof"?
How does 'God did it' a mechanism?

So, I challenge your assertion that I am misrepresenting your argument.  As it stands, I see no other argument being made.

As to 'a compelling case for naturalism', not my job.  You are attempting to make a case for the existence of, indeed, the necessity of, an alternative explanation.
I'm  challenging that, because no satisfactory case for any explanation, any explanatory mechanism, other than naturalism has ever been made.
As such, it is at the very least,  the default position.

If you want me to abandon it, you need to do much better than "I don't accept it".  I, on the other hand, do not.
That's how burden of proof works.
Neither I nor the other participants on this thread showed up at your doorstep, literally or figuratively, and began asserting that your position was wrong.
You, on the other hand, showed up here and began insisting that our position is wrong.
I, and others, have pointed out that your arguments are unsupportable.
You have failed to meet the challenges raised.

So stop misrepresenting what's going on here.
---------------------QUOTE-------------------




---------------------QUOTE-------------------
How is your argument anything other than "poof"?
How does 'God did it' a mechanism?
---------------------QUOTE-------------------



< http://reasonandscience.heavenforum.org/t1794-h....=create >

The causal power is intelligence. Conscious activity. The deliberate choice of a rational agent. Indeed, we have abundant experience in the present of intelligent agents generating specified information. Our experience of the causal powers of intelligent agents -- of "conscious activity" as "a cause now in operation"-- provides a basis for making inferences about the best explanation of the origin of all creation. It offers an alternative causal explanation involving a mental, rather than a necessarily or exclusively material, cause for the origin of  reality.
Posted by: NoName on Nov. 19 2015,12:20

Quote (Otangelo @ Nov. 19 2015,13:09)
Quote (EmperorZelos @ Nov. 19 2015,11:20)


---------------------QUOTE-------------------
What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


Well how about a list?

1: You stop arguement from ignorance
2: You publish your findings in actual scientific peer reviewed journals that are reputable
3: You learn what words and things actually means so you can apply it properly
4: You stop putting the  cart before the horse

A good start
---------------------QUOTE-------------------


Hey, its not about ME.

Again : what evidence do you expect to encounter in nature to infer design as the best explanation ?
---------------------QUOTE-------------------


Design is not a mechanism.
Manufacture is a mechanism.

Evidence of design is not evidence of manufacture.
Nor is manufacture evidence of design.
As repeatedly noted.

How are made things distinguished from 'natural' things in the real world?
Not by evidence of design.  By evidence of manufacture.
There is no evidence of non-natural manufacture of anything.
Posted by: Occam's Aftershave on Nov. 19 2015,12:21

Quote (Otangelo @ Nov. 19 2015,12:19)
The causal power is intelligence. Conscious activity. The deliberate choice of a rational agent.
---------------------QUOTE-------------------


Intelligence alone can't physically manipulate matter.  You need a physical mechanism.
Posted by: Otangelo on Nov. 19 2015,12:22

Quote (NoName @ Nov. 19 2015,12:17)
Given that we have living things and we have non-living things, abiogenesis must have occurred.
---------------------QUOTE-------------------


Nice strawman. We have exactly TWO possibilites of causes that can explain our origins. naturalism, and creationism. So IF a creator is the causal agent, abiogenesis is not. So there is no reaso to claim a MUST.
Posted by: Otangelo on Nov. 19 2015,12:24

Quote (NoName @ Nov. 19 2015,12:20)
Quote (Otangelo @ Nov. 19 2015,13:09)
Quote (EmperorZelos @ Nov. 19 2015,11:20)
 

---------------------QUOTE-------------------
What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


Well how about a list?

1: You stop arguement from ignorance
2: You publish your findings in actual scientific peer reviewed journals that are reputable
3: You learn what words and things actually means so you can apply it properly
4: You stop putting the  cart before the horse

A good start
---------------------QUOTE-------------------


Hey, its not about ME.

Again : what evidence do you expect to encounter in nature to infer design as the best explanation ?
---------------------QUOTE-------------------


Design is not a mechanism.
Manufacture is a mechanism.

Evidence of design is not evidence of manufacture.
Nor is manufacture evidence of design.
As repeatedly noted.

How are made things distinguished from 'natural' things in the real world?
Not by evidence of design.  By evidence of manufacture.
There is no evidence of non-natural manufacture of anything.
---------------------QUOTE-------------------


Design is the prerequisite. through a mental process you create, design, invent, imagine, project given artifact. And through power you materialize that project. My profession is machine designer, and i know EXACTLY how that works.
Posted by: Dr.GH on Nov. 19 2015,12:26

Quote (Otangelo @ Nov. 18 2015,10:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?
---------------------QUOTE-------------------


There are many reasons. I will post a small list to begin with:

2. The next problem concerns the so-called handedness of the amino acids. Because of the way that carbon atoms join up with other atoms, amino acids exist in two forms—the right-handed form and the left-handed form. Just as your right hand and left hand are identical in all respects except for their handedness, so the two forms of amino acids are identical except for their handedness. In all living systems only left-handed amino acids are found. Yet Miller’s experiment produced a mixture of right-handed and left-handed amino acids in identical proportions. As only the left-handed ones are used in living systems, this mixture is useless for the evolution of living systems.
---------------------QUOTE-------------------


I can cut and paste too!

From my blog article, < "A short outline of the origin of life" >

Chirility

Pasteur discovered that most amino acids came in two forms which can be identified by how they refract light. We label theses L- (for levo or left) and D- (for dextro, or right). The interesting thing is that life on Earth uses the L form of amino acids, and hardly ever uses the D- form. A solution of just one form is called "chiral" and a mix of forms about 50/50 is called racimic. The kinds (L or D) are called enantomers.

The nucleic acid bases are organized along a sugar backbone. I mentioned earlier that these sugars are also found in L- and D- forms, only in this case life on Earth only uses the D- form.

Creationists like to present this as a profound mystery that is supposed to "prove" that they are correct. I want to mention a neat instance where both left and right amino acids are used in a living thing. It is very rare, but it does happen. Next time a creationist claims to be an "expert" and that amino acid chirality "proves" something supernatural, you can gob-smack-em. The protein is called Gramicidin A and it has 8 L-amino acids, 6 D-amino acids, and one glycine which is an amino acid that is neither L- or D- in its structure. I have found that even many biologists will bet an "adult beverage" that all proteins are exclusive L- amino acids.

Before we go forward another couple of basic chemical facts need to be added to the discussion. First, L- amino acids will randomly convert to D- amino acids over time, and D- forms will convert to L- forms. This is called "racemization" because eventually you will end up with equal amounts of L- and D- amino acids. The rate that this occurs at varies with the amino acid, and its surroundings. The fastest conversion happens to amino acid molecules all by themselves in hot water. Under cold, dry conditions when the amino acids are attached to one another, or better yet, if they are also attached to a mineral, racemization can be very slow. Very, very slow.

This means that if there is even a tiny advantage one way or the other, the favored form will become the dominant form. The advantage comes from a surprising direction: outer space.

Cronin, J. R. & Pizzarello, S.,
1999. Amino acid enantomer excesses in meteorites: Origin and significance. Advances in Space Research 23(2): 293-299.

Service, RF,
1999. Does life's handedness come from within? Science 286: 1282-1283.

Antonio Chrysostomou, T. M. Gledhill,1 François Ménard, J. H. Hough, Motohide
Tamura and Jeremy Bailey
2000 "Polarimetry of young stellar objects -III. Circular polarimetry of OMC-1" Monthly Notices of the Royal Astronomical Society Volume 312 Issue 1 Page 103 - February

Michael H. Engel and Bartholomew Nagy,
1982 "Distribution and Enantiomeric Composition of Amino Acids in the Murchison Meteorite", Nature , 296, April 29, , p. 838.

Jeremy Bailey, Antonio Chrysostomou, J. H. Hough, T. M. Gledhill, Alan McCall, Stuart Clark, François Ménard, and Motohide Tamura
1998 Circular Polarization in Star- Formation Regions: Implications for Biomolecular Homochirality Science 1998 July 31; 281: 672-674. (in Reports)

Chyba, Christopher F.
1997 Origins of life: A left-handed Solar System? Nature 389, 234- 235 (18 Sep 1997)

Engel, M. H., S. A. Macko
1997 Isotopic evidence for extraterrestrial non- racemic amino acids in the Murchison meteorite. Nature 389, 265 - 268 (18 Sep) Letters to Nature

That should do for that. The next question is can the advantage of L- amino acids be conserved in the formation of more complex molecules called "peptides?" Yep.

Schmidt, J. G., Nielsen, P. E. & Orgel, L. E. 1997 Enantiomeric cross-inhibition in the synthesis of oligonucleotides on a nonchiral template. J. Am. Chem. Soc. 119, 1494-1495

Saghatelion A, Yokobayashi Y, Soltani K,
Ghadiri MR,
2001"A chiroselective peptide replicator",
Nature 409: 797-51, Feb

Singleton, D A,& Vo, L K,
2002 “Enantioselective Synthsis without Discrete Optically Active Additives” J. Am. Chem. Soc. 124, 10010-10011

Yao Shao, Ghosh I, Zutshi R, Chmielewski J.
1998 Selective amplification by auto- and cross-catalysis in a replicating peptide system. Nature. Dec 3;396(6710):447-50.

And there seems to be other L- selction advantages as well. For example:

Hazen, R.M., T.R. Filley, and G.A. Goodfriend.
2001. Selective adsorption of L- and D-amino acids on calcite: Implications for biochemical homochirality. Proceedings of the National Academy of Sciences 98(May 8):5487.

So chirality doesn't seem to be a big problem. This is far different from the way creationists present this. They cite a few out of date reports and then falsely claim that chiral life is impossible by natural means.


Posted by: Otangelo on Nov. 19 2015,12:27

Quote (NoName @ Nov. 19 2015,12:12)
What is needed is sign of manufacture.
---------------------QUOTE-------------------


So you adopt a double standard. In order to believe that non intelligent mechanisms caused everything into being, you do not require empirical proof. But in regard of a creator , you require a sign of manufacture. Well, my friend, as far as i checked, a time machine has not yet been invented......
Posted by: Occam's Aftershave on Nov. 19 2015,12:27

Quote (Otangelo @ Nov. 19 2015,12:24)
Design is the prerequisite. through a mental process you create, design, invent, imagine, project given artifact. And through power you materialize that project. My profession is machine designer, and i know EXACTLY how that works.
---------------------QUOTE-------------------


Then you're an idiot or you know mental designs don't turn into physical objects unless they're manufactured somehow.

How did DNA and life get manufactured?
Posted by: Occam's Aftershave on Nov. 19 2015,12:29

Quote (Otangelo @ Nov. 19 2015,12:27)
 
Quote (NoName @ Nov. 19 2015,12:12)
What is needed is sign of manufacture.
---------------------QUOTE-------------------


So you adopt a double standard. In order to believe that non intelligent mechanisms caused everything into being, you do not require empirical proof. But in regard of a creator , you require a sign of manufacture. Well, my friend, as far as i checked, a time machine has not yet been invented......
---------------------QUOTE-------------------


We have empirical evidence of the non-intelligent mechanisms still at work today.

What physical mechanisms did your Designer employ?
Posted by: Otangelo on Nov. 19 2015,12:30

Quote (Dr.GH @ Nov. 19 2015,12:26)
Creationists like to present this as a profound mystery that is supposed to "prove" that they are correct.
---------------------QUOTE-------------------


Sorry, but not only creationists have recognized this problem.



Homochirality

< http://reasonandscience.heavenforum.org/t1309-h....irality >

< http://labquimica.files.wordpress.com/2011....dad.pdf >
The origin of the homochirality of amino acids is still an unsolved issue. There must have been a definite process to ensure that the sequence-based mechanism functioned in the RNA world. Future experiments will provide insights regarding the basis using which this mystery can be solved.


< http://microbewiki.kenyon.edu/index.p....l_World >
Enantiomers are molecules that are mirror-images of each other. Today, amino acids and sugars exist in only one enantiomeric form in most biological systems on earth. This homochirality remains one of the greatest unsolved mysteries to scientists.


< http://www.cnrs.fr/Cnrspre....a11.htm >
However, the question of the origin of biological homochirality remains as yet unanswered.


< http://origins.harvard.edu/event....irality >
left and right-handed molecules of a compound will form in equal amounts (a racemic mixture) when we synthesize them in the laboratory in the absence of some type of directing template.


< http://www.teknoscienze.com/Article....17Qucvk >

Several mechanisms have been proposed for elucidating the origins of the chirality of organic compounds, such as circularly polarized light (CPL) (3) and quartz (4); however, a suitable amplification process for chirality is required to reach single-handedness of biological compounds (biological homochirality)
Posted by: Occam's Aftershave on Nov. 19 2015,12:39

Quote (Otangelo @ Nov. 19 2015,12:30)
 
Quote (Dr.GH @ Nov. 19 2015,12:26)
Creationists like to present this as a profound mystery that is supposed to "prove" that they are correct.
---------------------QUOTE-------------------


Sorry, but not only creationists have recognized this problem.

< http://origins.harvard.edu/event......irality >
left and right-handed molecules of a compound will form in equal amounts (a racemic mixture) when we synthesize them in the laboratory in the absence of some type of directing template.
---------------------QUOTE-------------------


LOL!  Gotta love the idiot Creationist who shoots himself in the foot.  This is the whole abstract for the Harvard research he just quoted above

"The property of chirality has fascinated scientists and laymen alike since Pasteur’s first painstaking separation of the enantiomorphic crystals of a tartrate salt over 150 years ago. Chiral molecules – nonsuperimposable forms that are mirror images of one another, as are left and right hands – in living organisms in Nature exist almost exclusively as single enantiomers, as exemplified by D-sugars and L-amino acids. Single chirality is critical for molecular recognition and replication processes and would thus seem to be a a signature of life. Yet left and right-handed molecules of a compound will form in equal amounts (a racemic mixture) when we synthesize them in the laboratory in the absence of some type of directing template. Our work has led to the development of several plausible mechanisms for how one enantiomer might have come to dominate over the other in the prebiotic world, highlighting mechanisms for enantioenrichment by either chemical or physical processes"

Own goal for Otangelo!  :D
Posted by: EmperorZelos on Nov. 19 2015,12:43

Quote (Otangelo @ Nov. 19 2015,12:08)
Quote (EmperorZelos @ Nov. 19 2015,11:19)
 

---------------------QUOTE-------------------
Why should i ? the case is totally obvious to any person of average intelligence and even shallow understanding of the requirements for life to start, your demand is futile.
---------------------QUOTE-------------------


You'd save the scientific community lots of work because they apperently disagree with you vastely on just about every point. If you can produce real evidence they would stop wasting time.
---------------------QUOTE-------------------


They disagree based on what evidence, exactly ?
---------------------QUOTE-------------------


2 lists of peer reviewed scientific research into evolution and abiogensesis

< http://www.talkorigins.org/faqs....fs.html >
< http://www.talkorigins.org/faqs....erences >

Now cite 1 single peer reviewed one that says that design must have occured at anytime anywhere from a reputable journal.
Posted by: EmperorZelos on Nov. 19 2015,12:47

Quote (Otangelo @ Nov. 19 2015,12:30)
Quote (Dr.GH @ Nov. 19 2015,12:26)
Creationists like to present this as a profound mystery that is supposed to "prove" that they are correct.
---------------------QUOTE-------------------


Sorry, but not only creationists have recognized this problem.



Homochirality

< http://reasonandscience.heavenforum.org/t1309-h....irality >

< http://labquimica.files.wordpress.com/2011.......dad.pdf >
The origin of the homochirality of amino acids is still an unsolved issue. There must have been a definite process to ensure that the sequence-based mechanism functioned in the RNA world. Future experiments will provide insights regarding the basis using which this mystery can be solved.


< http://microbewiki.kenyon.edu/index.p....l_World >
Enantiomers are molecules that are mirror-images of each other. Today, amino acids and sugars exist in only one enantiomeric form in most biological systems on earth. This homochirality remains one of the greatest unsolved mysteries to scientists.


< http://www.cnrs.fr/Cnrspre....a11.htm >
However, the question of the origin of biological homochirality remains as yet unanswered.


< http://origins.harvard.edu/event......irality >
left and right-handed molecules of a compound will form in equal amounts (a racemic mixture) when we synthesize them in the laboratory in the absence of some type of directing template.


[URL=http://www.teknoscienze.com/Articles/Chimica-Oggi-Chemistry-Today-Asymmetric-autocatalysis-Pathway-to-the-biological-homochiral

ity.aspx#.UqvM17Qucvk]http://www.teknoscienze.com/Article....17Qucvk[/URL]

Several mechanisms have been proposed for elucidating the origins of the chirality of organic compounds, such as circularly polarized light (CPL) (3) and quartz (4); however, a suitable amplification process for chirality is required to reach single-handedness of biological compounds (biological homochirality)
---------------------QUOTE-------------------


I'll point out that "not solved" does not mean "therefore creator and designed", that is fallacious reasoning. It simply means it is not solved.
Posted by: Dr.GH on Nov. 19 2015,12:50

There are additional articles related to chiral AAs and nucleotides, of course. Some also over lap with the formation of ribose as well;

Vázquez-Mayagoitia Á, Horton SR, Sumpter BG, Šponer J, Šponer JE, Fuentes-Cabrera M.
2011 "On the stabilization of ribose by silicate minerals" Astrobiology. 2011 Mar;11(2):115-21. doi: 10.1089/ast.2010.0508.

Springsteen G, Joyce GF.
2004 "Selective derivatization and sequestration of ribose from a prebiotic mix" J Am Chem Soc. 2004 Aug 11;126(31):9578-83

Matthew W. Powner, Béatrice Gerland & John D. Sutherland,
2006 "Synthesis of activated pyrimidine ribonucleotides in prebiotically plausible conditions" Nature 459, 239-242 (14 May 2009)

Ronald Breslow, Zhan-Ling Cheng
2009 "On the origin of terrestrial homochirality for nucleosides and amino acids" PNAS June 9, 2009 vol. 106 no. 23 9144-9146
Posted by: Dr.GH on Nov. 19 2015,12:54

Quote (Occam's Aftershave @ Nov. 19 2015,10:39)
LOL!  Gotta love the idiot Creationist who shoots himself in the foot.  
---------------------QUOTE-------------------


Otangelo cannot actually understand anything that he posts, or anything we reply.

My guess is that he just used Goggle and picked the first articles he sees with some words from our posts, and the word "problem" or "unknown."

The CNRS-Max Planck Institute of Stuttgart press release from 2000 referred to an idea, magnetochiral anisotropy, that didn't work out well.

One interesting paper I had not read before was;

Tamura, Koji
“Origin of amino acid homochirality: Relationship with the RNA world and origin of tRNA aminoacylation” BioSystems 92 (2008) 91–98


The other citations Chewtoy offered were either contradicting his assertions, or irrelevant.


Posted by: Richardthughes on Nov. 19 2015,13:11

Quote (Dr.GH @ Nov. 19 2015,12:54)
Quote (Occam's Aftershave @ Nov. 19 2015,10:39)
LOL!  Gotta love the idiot Creationist who shoots himself in the foot.  
---------------------QUOTE-------------------


Otangelo cannot actually understand anything that he posts, or anything we reply.

My guess is that he just used Goggle and picked the first articles he sees with some words from our posts, and the word "problem" or "unknown."
---------------------QUOTE-------------------


Or Denyse O'Learying as it's known.
Posted by: NoName on Nov. 19 2015,13:13

Quote (Otangelo @ Nov. 19 2015,13:19)
 
Quote (NoName @ Nov. 19 2015,12:01)
How is your argument anything other than "poof"?
How does 'God did it' a mechanism?

So, I challenge your assertion that I am misrepresenting your argument.  As it stands, I see no other argument being made.

As to 'a compelling case for naturalism', not my job.  You are attempting to make a case for the existence of, indeed, the necessity of, an alternative explanation.
I'm  challenging that, because no satisfactory case for any explanation, any explanatory mechanism, other than naturalism has ever been made.
As such, it is at the very least,  the default position.

If you want me to abandon it, you need to do much better than "I don't accept it".  I, on the other hand, do not.
That's how burden of proof works.
Neither I nor the other participants on this thread showed up at your doorstep, literally or figuratively, and began asserting that your position was wrong.
You, on the other hand, showed up here and began insisting that our position is wrong.
I, and others, have pointed out that your arguments are unsupportable.
You have failed to meet the challenges raised.

So stop misrepresenting what's going on here.
---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
How is your argument anything other than "poof"?
How does 'God did it' a mechanism?
---------------------QUOTE-------------------



[URL=http://reasonandscience.heavenforum.org/t1794-how-exactly-did-god-create-the-universe-and-the-world-what-process-was-involved?high



light=create]http://reasonandscience.heavenforum.org/t1794-h....=create[/URL]

The causal power is intelligence.
---------------------QUOTE-------------------


Intelligence is not a cause as such.  Intelligence is a broad descriptive term for a variety of acts, poorly specified (at best).  Insofar as we are talking consciousness, it can provide motivation, but it is not a cause.
 

---------------------QUOTE-------------------
Conscious activity. The deliberate choice of a rational agent.
---------------------QUOTE-------------------


In and of themselves, these lack causal efficacy.
Consider the case of the quadriplegic, who lacks all motor ability from the neck down.
He can still engage in conscious activity.  He can still make deliberate choices.
He cannot act.  He has no causal efficacy by virtue of his intelligence nor by virtue of his consciousness.
 

---------------------QUOTE-------------------
Indeed, we have abundant experience in the present of intelligent agents generating specified information.
---------------------QUOTE-------------------


'Specified information' is either redundant or meaningless.
In it usual usage (by the ID crowd), I reject it as meaningless, for it is strictly ad hoc, post hoc, unquantifiable, and useless.  It has no explanatory power.  Worse, it has no discriminatory power -- you have to know something is 'specified information' before you can decide that it counts as specified information.  It is the Texas Sharpshooter fallacy in the extreme.
 

---------------------QUOTE-------------------
Our experience of the causal powers of intelligent agents -- of "conscious activity" as "a cause now in operation"

---------------------QUOTE-------------------


You confuse  'cause' and 'motivation'.  They are distinct and different.  Precision of terminology matters, very very much.
In particular, I hold that 'cause' is material agency.  In all cases we can identify clearly, cause is matter interacting with matter.
 

---------------------QUOTE-------------------
-- provides a basis for making inferences about the best explanation of the origin of all creation.
---------------------QUOTE-------------------


Unsupported assertion that amounts to begging the question.
All intelligence we know, without exception, is bodily, it is embodied.
We only know intelligence through interaction with matter.
Therefore, all we can infer about 'best explanation' is that matter is involved in both cause and  effect.
Thus, we can infer that no disembodied intelligence exists, or if it does exist, it is indistinguishable from an unconscious being or a totally paralyzed person.


---------------------QUOTE-------------------
It offers an alternative causal explanation involving a mental, rather than a necessarily or exclusively material, cause for the origin of  reality.
---------------------QUOTE-------------------


No, it does not, because it cherry-picks the evidence out of the phenomena presented.
Consult M. Merleau-Ponty for one amongst countless discourses on the bodily grounding of intelligent being.

You are assuming your conclusion.
You need to establish the truth of your grounds before they become shared grounds for discussion.
I reject them, for the evidentiary reasons presented.
You've presented no evidence or reason  to accept either disembodied intelligence nor disembodied or non-material cause.
Posted by: NoName on Nov. 19 2015,13:17

Quote (Otangelo @ Nov. 19 2015,13:22)
Quote (NoName @ Nov. 19 2015,12:17)
Given that we have living things and we have non-living things, abiogenesis must have occurred.
---------------------QUOTE-------------------


Nice strawman. We have exactly TWO possibilites of causes that can explain our origins. naturalism, and creationism. So IF a creator is the causal agent, abiogenesis is not. So there is no reaso to claim a MUST.
---------------------QUOTE-------------------


NO.  You are assuming your conclusion.
I am arguing that we do not, in fact, have two possibilities.
We have only one -- naturalism.
No other "possibility" has ever been shown to be actually possible.
I reject the claim.

Further, as I have laid out, and as you persist in not addressing, we have the problem of how non-living matter becomes alive, regardless of whether we take recourse to a creator or not.
Either the creator is biologically alive, in which case the problem merely recedes one level, or the creator somehow caused non-living matter to become alive.
In both cases, we have the problem of how it was done.
"Poof" is not an explanation.
You keep insisting you are not arguing for 'poof'.  I keep pointing out that aside from question-begging and assuming your conclusions as premises in your argument, it is all your argument comes down to.
We still lack a mechanism.
Absent a mechanism, we haven't answered the 'how'.
Posted by: NoName on Nov. 19 2015,13:22

Quote (Otangelo @ Nov. 19 2015,13:24)
Quote (NoName @ Nov. 19 2015,12:20)
Quote (Otangelo @ Nov. 19 2015,13:09)
 
Quote (EmperorZelos @ Nov. 19 2015,11:20)
 

---------------------QUOTE-------------------
What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


Well how about a list?

1: You stop arguement from ignorance
2: You publish your findings in actual scientific peer reviewed journals that are reputable
3: You learn what words and things actually means so you can apply it properly
4: You stop putting the  cart before the horse

A good start
---------------------QUOTE-------------------


Hey, its not about ME.

Again : what evidence do you expect to encounter in nature to infer design as the best explanation ?
---------------------QUOTE-------------------


Design is not a mechanism.
Manufacture is a mechanism.

Evidence of design is not evidence of manufacture.
Nor is manufacture evidence of design.
As repeatedly noted.

How are made things distinguished from 'natural' things in the real world?
Not by evidence of design.  By evidence of manufacture.
There is no evidence of non-natural manufacture of anything.
---------------------QUOTE-------------------


Design is the prerequisite. through a mental process you create, design, invent, imagine, project given artifact. And through power you materialize that project. My profession is machine designer, and i know EXACTLY how that works.
---------------------QUOTE-------------------


Only if you are not omnipotent.
No omnipotent  being need  ever design, for no omnipotent being need take refractory materials or processes into account.

Further, you are not addressing my argument.
Design is no guarantee of manufacture.
Manufacture is no guarantee of design.
We have massive amounts of evidence that this is true and no evidence at all that it is not.
From wheels to software, things that are not designed are made and from DaVinci's helicopters to software things are designed that are never made.

Argument from design is a cheap fraud.
It is an even bigger fraud when it is actually argument to design.
There is a great deal of equivocation in design talk.  
But regardless, design is not manufacture.
Design doesn't matter, for it tells us nothing much.  Except, of course, that if design is there, then the designer must not be omnipotent.  That's a strong sense of 'must'.
Design is not necessary for omnipotent beings, by definition.
Posted by: Dr.GH on Nov. 19 2015,13:25

Quote (Richardthughes @ Nov. 19 2015,11:11)
Or Denyse O'Learying as it's known.
---------------------QUOTE-------------------


:D
Posted by: NoName on Nov. 19 2015,13:28

Quote (Otangelo @ Nov. 19 2015,13:27)
Quote (NoName @ Nov. 19 2015,12:12)
What is needed is sign of manufacture.
---------------------QUOTE-------------------


So you adopt a double standard. In order to believe that non intelligent mechanisms caused everything into being, you do not require empirical proof. But in regard of a creator , you require a sign of manufacture. Well, my friend, as far as i checked, a time machine has not yet been invented......
---------------------QUOTE-------------------


That is starkly dishonest and you should know it.

My reasons for adopting the stance I adopt are strictly based on evidence.
I see nothing but natural explanations or the absence of an explanation.
I never see an explanation that is not natural.
I have all the empirical proof I needs.

I also have all the logical proof I need.  The natural world is eternal.  It has existed for all time.  A priori true, and totally unaffected by the possibility that there was a 'big bang'.
Recent cosmology suggests that the big bang may not mark a point-source origin of time nor of the universe as such.

I require a mechanism.
You have not provided one.
You have not supported the suggestion, let alone assertion, that there is one.

I have the evidence, empirical and logical.
You have prejudices.
Demonstrably.

And just by the way, I am not your friend.  I have standards and you do not meet them.  Your behavior has been demonstrably dishonest, consists largely of action and argument in bad faith, and your position is, in multiple ways, shameful.
Posted by: Dr.GH on Nov. 19 2015,13:36

More from my "Short outline,"

I want to mention a neat instance where both left and right amino acids are used in a living thing. It is very rare, but it does happen. Next time a creationist claims to be an "expert" and that amino acid chirality "proves" something supernatural, you can gob-smack-em. The protein is called Gramicidin A and it has 8 L-amino acids, 6 D-amino acids, and one glycine which is an amino acid that is neither L- or D- in its structure. I have found that even many biologists will bet an "adult beverage" that all proteins are exclusive L- amino acids.

Before we go forward another couple of basic chemical facts need to be added to the discussion. First, L- amino acids will randomly convert to D- amino acids over time, and D- forms will convert to L- forms. This is called "racemization" because eventually you will end up with equal amounts of L- and D- amino acids. The rate that this occurs at varies with the amino acid, and its surroundings. The fastest conversion happens to amino acid molecules all by themselves in hot water. Under cold, dry conditions when the amino acids are attached to one another, or better yet, if they are also attached to a mineral, racemization can be very slow. Very, very slow.

This means that if there is even a tiny advantage one way or the other, the favored form will become the dominant form.

There are larger arguments for a racemic origin of life.

Edward Trifonov (2004) confirmed two ideas, that the earliest amino acids were those easiest to form abiotically, that codons and aa's organized contemporaneously to form short ogliomers (what he didn't cite was the notion that oligomers can form spontaneously, are "selected" merely by being stable, and that RNAs (or Lacanzo and Miller's PNAs) imprint and replicate "successful" short peptides.) Trifonov wrote, "The amino-acid chronology itself is a quintessence of natural simplicity and opportunism: use first those amino acids that are available. When done with all codons, take from those amino acids that have too many."

The fact is that there are a growing list of short proteins with D- aa's, (most of the ones I know of are bacterial membrane components but there are also examples from yeasts to humans). Add to this, most bacteria have evolved enzymes that convert L-aa's to D-aa's for the same Miller/prebiotic amino acids. Again even we humans have enzymes to use D-aa's.


Trifonov, Edward N. 2004 "The Triplet Code From First Principles" Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 22, Issue Number 1,

Babbitt PC, Mrachko GT, Hasson MS, Huisman GW, Kolter R, Ringe D, Petsko GA, Kenyon GL, Gerlt JA.
1995 "A functionally diverse enzyme superfamily that abstracts the alpha protons of carboxylic acids." Science. 1995 Feb 24;267(5201):1159-61.

Nathalie Chamond, Maira Goytia, Nicolas Coatnoan, Jean-Christophe Barale, Alain Cosson, Wim M. Degrave and Paola Minoprio
2005 "Trypanosoma cruzi proline racemases are involved in parasite differentiation and infectivity." Molecular Microbiology Volume 58 Issue 1 Page 46 - October 2005

Alexander Jilek, Christa Mollay, Christa Tippelt, Jacques Grassi, Giuseppina Mignogna, Johannes Müllegger, Veronika Sander, Christine Fehrer, Donatella Barra and Günther Kreil
2005 "Biosynthesis of a D-amino acid in peptide linkage by an enzyme from frog skin secretions" Published online before print March 9, 2005, PNAS | March 22, 2005 | vol. 102 | no. 12 | 4235-4239

Yamashita, Tatsuyuki, Ashiuchi, Makoto, Ohnishi, Kouhei, Kato, Shin'ichiro, Nagata, Shinji & Misono, Haruo
2004 "Molecular identification of monomeric aspartate racemase from Bifidobacterium bifidum." European Journal of Biochemistry 271 (23-24), 4798-4803.

Ian G. Fotheringham, Stefan A. Bledig, and Paul P. Taylor
1998 "Characterization of the Genes Encoding D-Amino Acid Transaminase and Glutamate Racemase, Two D-Glutamate Biosynthetic Enzymes of Bacillus sphaericus ATCC 10208" Journal of Bacteriology, August 1998, p. 4319-4323, Vol. 180, No. 16

K. Y. Hwang, C.-S. Cho, S. S. Kim, K. Baek, S.-H. Kim, Y. G. Yu and Y. Cho
1999 "Crystallization and preliminary X-ray analysis of glutamate racemase from Aquifex pyrophilus, a hyperthermophilic bacterium" Acta Cryst. (1999). D55, 927-928
Posted by: The whole truth on Nov. 19 2015,13:40

Quote (Otangelo @ Nov. 19 2015,09:17)
Quote (The whole truth @ Nov. 19 2015,11:08)
If it were discovered that there is a 'creator' but that it wasn't/isn't your chosen, so called 'God' and is nothing like your chosen, so-called 'God', would you discard your religious beliefs?
---------------------QUOTE-------------------


I would want to know that different God.

What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


I said a 'creator'. A 'creator' isn't necessarily a 'God'. And you didn't answer my questions. I didn't ask you if you'd want to get to know "that different God".

"What would convince you that design explains best our existence ?"

Why don't you be honest and say/ask what you actually believe and stop playing stupid, dishonest games with the "design" crap? The question that would be honest from you would be like this: What would convince you that the God I believe in, i.e. the Abrahamic, Christian God, specially created man in his image as it says in the Bible?

And to that question I would answer: Nothing would or could convince me of that.
Posted by: Dr.GH on Nov. 19 2015,13:40

Quote (NoName @ Nov. 19 2015,11:28)
I have the evidence, empirical and logical.
You have prejudices.
Demonstrably.

And just by the way, I am not your friend.  I have standards and you do not meet them.
---------------------QUOTE-------------------


:D :) :D :) :D


Posted by: Otangelo on Nov. 19 2015,14:16

Quote (EmperorZelos @ Nov. 19 2015,12:43)
Quote (Otangelo @ Nov. 19 2015,12:08)
 
Quote (EmperorZelos @ Nov. 19 2015,11:19)
 

---------------------QUOTE-------------------
Why should i ? the case is totally obvious to any person of average intelligence and even shallow understanding of the requirements for life to start, your demand is futile.
---------------------QUOTE-------------------


You'd save the scientific community lots of work because they apperently disagree with you vastely on just about every point. If you can produce real evidence they would stop wasting time.
---------------------QUOTE-------------------


They disagree based on what evidence, exactly ?
---------------------QUOTE-------------------


2 lists of peer reviewed scientific research into evolution and abiogensesis

< http://www.talkorigins.org/faqs.......fs.html >
< http://www.talkorigins.org/faqs.......erences >

Now cite 1 single peer reviewed one that says that design must have occured at anytime anywhere from a reputable journal.
---------------------QUOTE-------------------


Peer review: a flawed process at the heart of science and journals

< http://reasonandscience.heavenforum.org/t1290-p....ht=peer >

In desperation to maintain the "No god needed" ideology, the faith is supported and filled in by the "No god needed" crowd with unproven hypothesis and theories with fancy language laced with qualifiers such as "possible", "might" and maybe, among others, and it's EXPECTED to be ACCEPTED as gospel. Science says this or that, via "peer reviewed sources", or websites that are held as unquestionable authority, like talkorigins, or authorities, like Dawkins, Krauss, Hitchen, et al. You actually think that's any different than "The bible says, or God says" this or that? Your faith is just as strong, if not stronger, than the faith of the believer, and based on those peer reviewed sources or websites that propose evolution, you base and express your values and principles. No different than the bible believing Christian. That is faith. That is a religion. Just because you either can't see it or are too proud to admit it, it's fact. Atheists try to prove what they don't believe with the enthusiasm of a believer. How much sense makes that ?

Hundreds of open access journals accept fake science paper

< http://www.theguardian.com/higher-....e-paper >

Of the 106 journals that did conduct peer review, 70% accepted the paper.Public Library of Science, PLOS ONE, was the only journal that called attention to the paper's potential ethical problems and consequently rejected it within 2 weeks.

Meanwhile, 45% of Directory of Open Access Journals (DOAJ) publishers that completed the review process, accepted the paper, a statistic that DOAJ founder Lars Bjørnshauge, a library scientist at Lund University in Sweden, finds "hard to believe".

The hoax raises concerns about poor quality control and the 'gold' open access model. It also calls attention to the growing number of low-quality open access publishers, especially in the developing world. In his investigation, Bohannon came across 29 publishers which seemed to have derelict websites and disguised geographical locations.
Posted by: Otangelo on Nov. 19 2015,14:17

Quote (EmperorZelos @ Nov. 19 2015,12:47)
Quote (Otangelo @ Nov. 19 2015,12:30)
Quote (Dr.GH @ Nov. 19 2015,12:26)
Creationists like to present this as a profound mystery that is supposed to "prove" that they are correct.
---------------------QUOTE-------------------


Sorry, but not only creationists have recognized this problem.



Homochirality

< http://reasonandscience.heavenforum.org/t1309-h....irality >

< http://labquimica.files.wordpress.com/2011.......dad.pdf >
The origin of the homochirality of amino acids is still an unsolved issue. There must have been a definite process to ensure that the sequence-based mechanism functioned in the RNA world. Future experiments will provide insights regarding the basis using which this mystery can be solved.


< http://microbewiki.kenyon.edu/index.p....l_World >
Enantiomers are molecules that are mirror-images of each other. Today, amino acids and sugars exist in only one enantiomeric form in most biological systems on earth. This homochirality remains one of the greatest unsolved mysteries to scientists.


< http://www.cnrs.fr/Cnrspre....a11.htm >
However, the question of the origin of biological homochirality remains as yet unanswered.


< http://origins.harvard.edu/event......irality >
left and right-handed molecules of a compound will form in equal amounts (a racemic mixture) when we synthesize them in the laboratory in the absence of some type of directing template.


[URL=http://www.teknoscienze.com/Articles/Chimica-Oggi-Chemistry-Today-Asymmetric-autocatalysis-Pathway-to-the-biological-homochiral


ity.aspx#.UqvM17Qucvk]http://www.teknoscienze.com/Article....17Qucvk[/URL]

Several mechanisms have been proposed for elucidating the origins of the chirality of organic compounds, such as circularly polarized light (CPL) (3) and quartz (4); however, a suitable amplification process for chirality is required to reach single-handedness of biological compounds (biological homochirality)
---------------------QUOTE-------------------


I'll point out that "not solved" does not mean "therefore creator and designed", that is fallacious reasoning. It simply means it is not solved.
---------------------QUOTE-------------------


neither does it mean " therefore naturalism "....
Posted by: Otangelo on Nov. 19 2015,14:21

Quote (NoName @ Nov. 19 2015,13:13)
You are assuming your conclusion.
You need to establish the truth of your grounds before they become shared grounds for discussion.
I reject them, for the evidentiary reasons presented.
You've presented no evidence or reason  to accept either disembodied intelligence nor disembodied or non-material cause.
---------------------QUOTE-------------------


< http://reasonandscience.heavenforum.org/t1642-c....-part-1 >


A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

But let me tell you about chance. Chance doesn't exist, it's nothing...it's nothing. Chance is a word used to explain something else. But chance isn't anything. It's not a force. Chance doesn't make anything happen. Chance doesn't exist. It's only a way to explain something else. Chance didn't make you meet that person, you were going there when she was going there, that's why you met her. Chance didn't have anything to do with it because chance doesn't exist. It's nothing. But in modern evolution its been transformed into a force of causal power. It's been elevated from being nothing to being everything. Chance makes things happen. Chance is the myth that serves to undergird the chaos view of reality.

I mean, this is so fraught with problems from a rational or philosophical viewpoint you hardly know where to begin. How do you get the initial matter upon which chance operates? Where does that come? You would have to say, "Well, chance made it appear." You know what? This sounds so ridiculous and yet this is the undergirding philosophy behind evolution. It is completely incoherent and irrational. But the new evolutionary paradigm is chance. And it's the opposite of logic.

You see, when you abandon logic and logic says, "Oh, there's a universe. Hum...somebody made it." What else would logic say? "There's a building, somebody made it. There's a piano, somebody made it. There's a universe, more complex than a building, infinitely more complex than a piano, somebody...somebody who is very, very powerful and very, very intelligent made it."

You say, "No, no, chance made it." Listen, folks, that's rational suicide, that's not logical.
Posted by: Otangelo on Nov. 19 2015,14:23

Quote (NoName @ Nov. 19 2015,13:17)
No other "possibility" has ever been shown to be actually possible.
I reject the claim.
---------------------QUOTE-------------------


And it has been shown that life can come from non-life ? LOL....
Posted by: NoName on Nov. 19 2015,14:24

Quote (Otangelo @ Nov. 19 2015,15:17)
Quote (EmperorZelos @ Nov. 19 2015,12:47)
Quote (Otangelo @ Nov. 19 2015,12:30)
 
Quote (Dr.GH @ Nov. 19 2015,12:26)
Creationists like to present this as a profound mystery that is supposed to "prove" that they are correct.
---------------------QUOTE-------------------


Sorry, but not only creationists have recognized this problem.



Homochirality

< http://reasonandscience.heavenforum.org/t1309-h....irality >

< http://labquimica.files.wordpress.com/2011.......dad.pdf >
The origin of the homochirality of amino acids is still an unsolved issue. There must have been a definite process to ensure that the sequence-based mechanism functioned in the RNA world. Future experiments will provide insights regarding the basis using which this mystery can be solved.


< http://microbewiki.kenyon.edu/index.p....l_World >
Enantiomers are molecules that are mirror-images of each other. Today, amino acids and sugars exist in only one enantiomeric form in most biological systems on earth. This homochirality remains one of the greatest unsolved mysteries to scientists.


< http://www.cnrs.fr/Cnrspre....a11.htm >
However, the question of the origin of biological homochirality remains as yet unanswered.


< http://origins.harvard.edu/event......irality >
left and right-handed molecules of a compound will form in equal amounts (a racemic mixture) when we synthesize them in the laboratory in the absence of some type of directing template.


[URL=http://www.teknoscienze.com/Articles/Chimica-Oggi-Chemistry-Today-Asymmetric-autocatalysis-Pathway-to-the-biological-homochiral



ity.aspx#.UqvM17Qucvk]http://www.teknoscienze.com/Article....17Qucvk[/URL]

Several mechanisms have been proposed for elucidating the origins of the chirality of organic compounds, such as circularly polarized light (CPL) (3) and quartz (4); however, a suitable amplification process for chirality is required to reach single-handedness of biological compounds (biological homochirality)
---------------------QUOTE-------------------


I'll point out that "not solved" does not mean "therefore creator and designed", that is fallacious reasoning. It simply means it is not solved.
---------------------QUOTE-------------------


neither does it mean " therefore naturalism "....
---------------------QUOTE-------------------


Given the success of naturalism, and the vast and unquestioned amount of evidence for it, it really does.
Naturalism is the default position.
Any challenge must be strong and well-supported.  Which is to say, justified by more than arguments from incredulity and prejudicial assertions.
At a minimum, non-naturalist claims to explanatory force must produce at least one success.
So far, they have not.
There are no non-natural explanations.  Or, were I motivated to be judicious, there are no successful non-natural explanations.
In large measure, this is because the concept of the non-natural is always confused, internally contradictory, unsupported by evidence or otherwise flawed.
You have not surmounted the barrier, you've not even approached it.  You have nothing to offer that has any actual explanatory power at all.

It is not surprising that you reject peer review.
What matters is not that peer review yield perfect results.
What matters is that any challenger to it must be able to do, in actuality, not just 'in principle', at least as well.
No contender to date has managed.
Posted by: Otangelo on Nov. 19 2015,14:26

Quote (NoName @ Nov. 19 2015,13:22)
Quote (Otangelo @ Nov. 19 2015,13:24)
Quote (NoName @ Nov. 19 2015,12:20)
 
Quote (Otangelo @ Nov. 19 2015,13:09)
 
Quote (EmperorZelos @ Nov. 19 2015,11:20)
   

---------------------QUOTE-------------------
What would convince you that design explains best our existence ?
---------------------QUOTE-------------------


Well how about a list?

1: You stop arguement from ignorance
2: You publish your findings in actual scientific peer reviewed journals that are reputable
3: You learn what words and things actually means so you can apply it properly
4: You stop putting the  cart before the horse

A good start
---------------------QUOTE-------------------


Hey, its not about ME.

Again : what evidence do you expect to encounter in nature to infer design as the best explanation ?
---------------------QUOTE-------------------


Design is not a mechanism.
Manufacture is a mechanism.

Evidence of design is not evidence of manufacture.
Nor is manufacture evidence of design.
As repeatedly noted.

How are made things distinguished from 'natural' things in the real world?
Not by evidence of design.  By evidence of manufacture.
There is no evidence of non-natural manufacture of anything.
---------------------QUOTE-------------------


Design is the prerequisite. through a mental process you create, design, invent, imagine, project given artifact. And through power you materialize that project. My profession is machine designer, and i know EXACTLY how that works.
---------------------QUOTE-------------------


Only if you are not omnipotent.
No omnipotent  being need  ever design, for no omnipotent being need take refractory materials or processes into account.

Further, you are not addressing my argument.
Design is no guarantee of manufacture.
Manufacture is no guarantee of design.
We have massive amounts of evidence that this is true and no evidence at all that it is not.
From wheels to software, things that are not designed are made and from DaVinci's helicopters to software things are designed that are never made.

Argument from design is a cheap fraud.
It is an even bigger fraud when it is actually argument to design.
There is a great deal of equivocation in design talk.  
But regardless, design is not manufacture.
Design doesn't matter, for it tells us nothing much.  Except, of course, that if design is there, then the designer must not be omnipotent.  That's a strong sense of 'must'.
Design is not necessary for omnipotent beings, by definition.
---------------------QUOTE-------------------


We have evidence from daily experience that we can design AND manufacture things.

We see all the time intelligence producing complex machines, and information based systems.

We have NEVER seen unguided, non conscientious, random , non-intelligent forces do the same.  

The term omnipotent must be defined. God cannot create a square circle, or do any other illogical things......
Posted by: Otangelo on Nov. 19 2015,14:28

Quote (NoName @ Nov. 19 2015,13:28)
Quote (Otangelo @ Nov. 19 2015,13:27)
Quote (NoName @ Nov. 19 2015,12:12)
What is needed is sign of manufacture.
---------------------QUOTE-------------------


So you adopt a double standard. In order to believe that non intelligent mechanisms caused everything into being, you do not require empirical proof. But in regard of a creator , you require a sign of manufacture. Well, my friend, as far as i checked, a time machine has not yet been invented......
---------------------QUOTE-------------------


That is starkly dishonest and you should know it.

My reasons for adopting the stance I adopt are strictly based on evidence.
I see nothing but natural explanations or the absence of an explanation.
I never see an explanation that is not natural.
I have all the empirical proof I needs.

I also have all the logical proof I need.  The natural world is eternal.  It has existed for all time.  A priori true, and totally unaffected by the possibility that there was a 'big bang'.
Recent cosmology suggests that the big bang may not mark a point-source origin of time nor of the universe as such.

I require a mechanism.
You have not provided one.
You have not supported the suggestion, let alone assertion, that there is one.

I have the evidence, empirical and logical.
You have prejudices.
Demonstrably.

And just by the way, I am not your friend.  I have standards and you do not meet them.  Your behavior has been demonstrably dishonest, consists largely of action and argument in bad faith, and your position is, in multiple ways, shameful.
---------------------QUOTE-------------------


You can post as many  rants as  you want.

Again:

What type of biological system could not be formed by “numerous successive, slight modifications?” Well, for starters, a system that is irreducibly complex.

By irreducibly complex I mean a single system composed of several well-matched interacting parts that contribute to the basic function, wherein the removal of any one of the [core] parts causes the system to effectively cease functioning.


But today, there are many such cases observed in nature.

High information content machine-like irreducibly complex and interdependent structures,  of which photosynthesis, the eye, the human body, nitrogenase, the ribosome, the cell, rubisco, photosystem II, the oxygen evolving complex etc. are prime examples, are commonly found in nature.
Since Evolution is unable to  provide a advantage of adaptation in each evolutionary step, and is unable to select it,  1) Darwinism’s prediction is falsified; 2) Design’s prediction is confirmed.

Premise One: Despite a thorough search, no material causes have been discovered that demonstrate the power to produce large amounts of specified information, irreducible and interdependent biological systems.
Premise Two: Intelligent causes have demonstrated the power to produce large amounts of specified information, irreducible and interdependent systems of all sorts.
Conclusion: Intelligent design constitutes the best, most causally adequate, explanation for the information and irreducible complexity in the cell, and interdependence of proteins, organelles, and bodyparts, and even of animals and plants, aka moths and flowers, for example.
Posted by: Otangelo on Nov. 19 2015,14:33

Quote (The whole truth @ Nov. 19 2015,13:40)
And to that question I would answer: Nothing would or could convince me of that.
---------------------QUOTE-------------------


and your reason of being here is what exacly ? Are you eventually entertaining the illusion that your fairy tale world view will convince a theist ? LOL....

a tip : stop behaving like a fool, trying to argue about what you do not believe, with the enthusiast of a believer.
Posted by: Richardthughes on Nov. 19 2015,14:33

Quote (Otangelo @ Nov. 19 2015,14:33)
Quote (The whole truth @ Nov. 19 2015,13:40)
And to that question I would answer: Nothing would or could convince me of that.
---------------------QUOTE-------------------


and your reason of being here is what exacly ? Are you eventually entertaining the illusion that your fairy tale world view will convince a theist ? LOL....

a tip : stop behaving like a fool, trying to argue about what you do not believe, with the enthusiast of a believer.
---------------------QUOTE-------------------


TIP: tell the truth, stop stealing.
Posted by: Otangelo on Nov. 19 2015,14:39

Quote (NoName @ Nov. 19 2015,14:24)
Given the success of naturalism, and the vast and unquestioned amount of evidence for it, it really does.
---------------------QUOTE-------------------


You are kidding, right ??

The Big Bang : a mess of a theory, which has just two things right. The beginning of the universe, and its expansion.
Black matter ? no evidence
Fine tuning of the universe ? no good answer
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter.
Origin of life: no evidence
Biodiversity : no evidence that macro evolution above species ever happened. Plenty of reasons to reject the claims.....
Fossils : plenty of evidence they are young...
and sudden appearance of major phyla in the cambrian refute the ToE.
Posted by: NoName on Nov. 19 2015,14:44

Quote (Otangelo @ Nov. 19 2015,15:21)
 
Quote (NoName @ Nov. 19 2015,13:13)
You are assuming your conclusion.
You need to establish the truth of your grounds before they become shared grounds for discussion.
I reject them, for the evidentiary reasons presented.
You've presented no evidence or reason  to accept either disembodied intelligence nor disembodied or non-material cause.
---------------------QUOTE-------------------


< http://reasonandscience.heavenforum.org/t1642-c....-part-1 >


A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.
---------------------QUOTE-------------------


This again?
At the very least, your description of Spencer and his work is wildly prejudicial.  It is unlikely that he would accept your description as it stands.
One problem is that it was not in his role as scientist that he declared (*not* 'discovered') that all of reality can be categorized according to his  five categories.
It is also highly prejudicical to describe the categorization  in terms of containment, which you do when you say "...exists in...".
This becomes even more problematic when we see, as we must, that these categories are not mutually exclusive.  All matter and energy, for example, are temporal, thus 'partake' of time.
Spencer is not the last word in ontology, which is what this is.  He's not even particularly known for his work in ontology.
 

---------------------QUOTE-------------------
Now think about that. Time, force, action, space and matter. That is a logical sequence.
---------------------QUOTE-------------------


Only if you are going to treat them as equal in rank and mutually exclusive.  That hasn't been 'standard practice' in ontology or metaphysics since well before Kant.  And probably since well before Aristotle.
Worse, it is just silly -- what arrangement of those terms can not be described as a 'logical progression'?


---------------------QUOTE-------------------
And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.
---------------------QUOTE-------------------


Your standards for what can be said about everything exists are far too narrow.
And just for laughs, you keep saying 'everything that exists' -- where, then, shall we place god in this categorization?  Or does god not exist?
 

---------------------QUOTE-------------------
Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.
---------------------QUOTE-------------------


You have an extraordinarily impoverished imagination if you think the situation is this clear or this limited.
 

---------------------QUOTE-------------------
But let me tell you about chance. Chance doesn't exist, it's nothing...it's nothing. Chance is a word used to explain something else. But chance isn't anything. It's not a force. Chance doesn't make anything happen. Chance doesn't exist. It's only a way to explain something else. Chance didn't make you meet that person, you were going there when she was going there, that's why you met her. Chance didn't have anything to do with it because chance doesn't exist. It's nothing. But in modern evolution its been transformed into a force of causal power. It's been elevated from being nothing to being everything. Chance makes things happen. Chance is the myth that serves to undergird the chaos view of reality.

I mean, this is so fraught with problems from a rational or philosophical viewpoint you hardly know where to begin.
---------------------QUOTE-------------------


Well, you might not.
Good thing we have better thinkers around.
But again, this is all a red herring designed to lead us to your prejudicially selected conclusions.
It is hardly worth deconstructing, so I shan't.
But more to the point, it is not responsive to any of the open issues you should be addressing.  It is, instead, the opening volley of yet another extended digression designed to distract us from your failure to support anything on which you have previously been challenged.


---------------------QUOTE-------------------
How do you get the initial matter upon which chance operates? Where does that come? You would have to say, "Well, chance made it appear."
---------------------QUOTE-------------------


Really?
Your ignorance is as appalling as your limited imagination.
   

---------------------QUOTE-------------------
You know what? This sounds so ridiculous and yet this is the undergirding philosophy behind evolution.
---------------------QUOTE-------------------


Nonsense.
You are demonstrably unqualified to utter that judgement.
The undergirding philosophy behind evolution is not 'chance'.  That you not only think it is, you think you can authoritatively pronounce it so, without citation nor evidence, is proof of your lack of qualification to pronounce on science, chance, or evolution.
 

---------------------QUOTE-------------------
It is completely incoherent and irrational. But the new evolutionary paradigm is chance. And it's the opposite of logic.
---------------------QUOTE-------------------


Big talk.
Prove it, don't assert it.
Stop changing the subject, which this is, yet again.
Stand by a point and defend it or abandon it.

 

---------------------QUOTE-------------------
You see, when you abandon logic and logic says, "Oh, there's a universe. Hum...somebody made it." What else would logic say?
---------------------QUOTE-------------------


How would you know?  Evidence suggest it's a miracle you can consistently spell 'logic'.  You certainly make no correct use of it.  Witness your prattling in this thread.
 

---------------------QUOTE-------------------
"There's a building, somebody made it. There's a piano, somebody made it. There's a universe, more complex than a building, infinitely more complex than a piano, somebody...somebody who is very, very powerful and very, very intelligent made it."
---------------------QUOTE-------------------


Category error.
The universe is not a thing amongst things.
The universe is the set of all things.
As Russell and Whitehead, amongst others, have shown rather conclusively, theorizing about sets is dangerous and  filled with counter-intuitive results.
You appeal not to logic but intuition, simple-minded naive intuition guided by a set of prejudicial preselected cultural  constructs.

 

---------------------QUOTE-------------------
You say, "No, no, chance made it." Listen, folks, that's rational suicide, that's not logical.
---------------------QUOTE-------------------


And yet again we see that you have no clue what you are going on about.

The nicest rejoinder is simply 'citation needed'.
You are arguing, badly, against a poorly constructed strawman.
Shameful.
But exactly what we have come to expect from you.
Posted by: Richardthughes on Nov. 19 2015,14:46



---------------------QUOTE-------------------
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter
---------------------QUOTE-------------------



< https://www.cfa.harvard.edu/~agoodm....ays.pdf >
Posted by: Otangelo on Nov. 19 2015,14:46

Quote (NoName @ Nov. 19 2015,14:44)
The nicest rejoinder is simply 'citation needed'.
You are arguing, badly, against a poorly constructed strawman.
Shameful.
But exactly what we have come to expect from you.
---------------------QUOTE-------------------


Well, when you have rational and compelling answers of these issues through naturalism, let me know.... LOL....
Posted by: NoName on Nov. 19 2015,14:58

Quote (Otangelo @ Nov. 19 2015,15:28)
What type of biological system could not be formed by “numerous successive, slight modifications?” Well, for starters, a system that is irreducibly complex.
---------------------QUOTE-------------------


Already refuted by others.  Repeatedly.

 

---------------------QUOTE-------------------
By irreducibly complex I mean a single system composed of several well-matched interacting parts that contribute to the basic function, wherein the removal of any one of the [core] parts causes the system to effectively cease functioning.
---------------------QUOTE-------------------



So?  You have been shown examples of exactly this occurring and you have been given references to many more.
But you are also cheating.  It may well be the case that  removal of a part destroys the current function.  But that is not necessarily the same as rendering it without function.  Nor are bits without function necessarily a problem.  Do you understand gene duplication?  Do you understand  that the duplicate can change and lose  function, and yet persist in the genome?  Do you understand that the non-functional version may then lose element(s) and regress to a previous function, or gain elements and either a new function or a new pathway to an old function?
That's all it takes, and it's been demonstrated to occur.
 

---------------------QUOTE-------------------
But today, there are many such cases observed in nature.
---------------------QUOTE-------------------


We know, far better than you.
 

---------------------QUOTE-------------------
High information content machine-like irreducibly complex and interdependent structures,  of which photosynthesis, the eye, the human body, nitrogenase, the ribosome, the cell, rubisco, photosystem II, the oxygen evolving complex etc. are prime examples, are commonly found in nature.
---------------------QUOTE-------------------


And none of them violate the laws of chemistry and physics, so none of them require non-natural explanations.
We have natural explanations for many things.
We have no successful explanations that are non-natural.
Therefore, we either know a natural explanation or have solid grounds for expecting one to be forthcoming.

 

---------------------QUOTE-------------------
Since Evolution is unable to  provide a advantage of adaptation in each evolutionary step, and is unable to select it,  1) Darwinism’s prediction is falsified; 2) Design’s prediction is confirmed.
---------------------QUOTE-------------------


False.

 

---------------------QUOTE-------------------
Premise One: Despite a thorough search, no material causes have been discovered that demonstrate the power to produce large amounts of specified information, irreducible and interdependent biological systems.
---------------------QUOTE-------------------


Irrelevant.
Worse, based on undefined and prejudicial (and generally equivocal) terms.
Rejected as underspecified and likely to be false as written
 

---------------------QUOTE-------------------
Premise Two: Intelligent causes have demonstrated the power to produce large amounts of specified information, irreducible and interdependent systems of all sorts.
---------------------QUOTE-------------------


Same flaws as 'premise' 1.
Rejected.


---------------------QUOTE-------------------
Conclusion: Intelligent design constitutes the best, most causally adequate, explanation for the information and irreducible complexity in the cell, and interdependence of proteins, organelles, and bodyparts, and even of animals and plants, aka moths and flowers, for example.
---------------------QUOTE-------------------


Does not follow.
Even granting your two premises.

ID has no explanatory power.
Design is not a mechanism for production.
Production, even with the appearance of design, is not a guarantee of design.
Design is not a guarantor of a designer. Snowflakes come to mind, as does hoarfrost.  
Or the visual beauty of the Mandelbrot set.
Or the mathematical beauty of the Mandelbrot and Julia sets.
In fact, the Mandelbrot set is a good counter-example.  It is highly complex, highly specified, and yet entirely natural.  It is an artifact of the rigorous laws of mathematics.  And it does not require a designer.
Posted by: Otangelo on Nov. 19 2015,15:05

Quote (NoName @ Nov. 19 2015,14:58)
ID has no explanatory power.
---------------------QUOTE-------------------


Ok then. I guess we have nothing to tell us furthermore. Good bye.
Posted by: Dr.GH on Nov. 19 2015,15:07

Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?


Posted by: NoName on Nov. 19 2015,15:08

Quote (Otangelo @ Nov. 19 2015,15:39)
Quote (NoName @ Nov. 19 2015,14:24)
Given the success of naturalism, and the vast and unquestioned amount of evidence for it, it really does.
---------------------QUOTE-------------------


You are kidding, right ??

The Big Bang : a mess of a theory, which has just two things right. The beginning of the universe, and its expansion.
Black matter ? no evidence
Fine tuning of the universe ? no good answer
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter.
Origin of life: no evidence
Biodiversity : no evidence that macro evolution above species ever happened. Plenty of reasons to reject the claims.....
Fossils : plenty of evidence they are young...
and sudden appearance of major phyla in the cambrian refute the ToE.
---------------------QUOTE-------------------


You really are out of touch with science aren't you?

The Big Bang -- not a single theory, many of its variants have substantial experimental verification, highly suggestive of new investigative pathways.
That it may be less than perfect matters not.  It is good enough but more importantly it is getting better.  It is already  far better than Genesis and it's "poof" theory, as uttered by bronze  age shepherds when they weren't buggering their sheep.
Black matter -- suggestive evidence rising out of solid theoretical work.  Not yet confirmed but equally not yet ruled out.  I'll trust the cosmologists and physicists generally over your uneducated and agenda-driven assertions.
Fine tuning -- based on a host of fallacies, not least of which is the unspoken assumptions that fundamental constants are not tightly coupled and that fundamental  constants can, in fact, be different from what they are, and finally that it is possible that they could be tweaked or set by some entity or process.  All of these are wildly speculative and the outcome, notions of 'fine tuning', are thus highly questionable.
These are odd claims given the thorough trashing you thought you had posted with respect to chance.
Star formation (and planetary formation) -- observed.  Solid  evidence of planetary condensation from an orbiting  gas cloud was reported just this week.  We've got pictures.  You've got eyes closed, fingers in ears, and  an agenda-driven resolution to never take new evidence on board.
Shameful.
Biodiversity.  DNA suffices as a response.  There are no reasons to  accept the notion that evolution does not suffice to account for biodiversity.  Solid evidence of complex interrelationships between entities in a given, non-constant, ecosystem.
Plenty of solid evidence that fossils range from (relative) young to quite old.
You're trotting out more and more PRATTs as if we would simply take your word for them.
More desperate attempts to distract from your complete inability to defend strong and absolute claims you made and on which you have been challenged.
Shameful
Posted by: OgreMkV on Nov. 19 2015,15:09

Quote (Otangelo @ Nov. 19 2015,14:39)
Quote (NoName @ Nov. 19 2015,14:24)
Given the success of naturalism, and the vast and unquestioned amount of evidence for it, it really does.
---------------------QUOTE-------------------


You are kidding, right ??

The Big Bang : a mess of a theory, which has just two things right. The beginning of the universe, and its expansion.
Black matter ? no evidence
Fine tuning of the universe ? no good answer
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter.
Origin of life: no evidence
Biodiversity : no evidence that macro evolution above species ever happened. Plenty of reasons to reject the claims.....
Fossils : plenty of evidence they are young...
and sudden appearance of major phyla in the cambrian refute the ToE.
---------------------QUOTE-------------------


Your understanding of even basic science, like gravity, is flawed. Your understanding of advanced science is non-existent.

Therefore. You are meaningless.

That shows by you having been banned from progressively smaller and smaller forums until you end up here where all we do is laugh at people who have no idea what's going on. I mean, we have one guy here who thinks that ice isn't water and that frequency = wavelength.

We know you can't answer questions.
We know you can't handle the basic science of a 5th grader.
We know you don't understand the material you post.

You have become totally irrelevant. Even among creationists.
Posted by: Occam's Aftershave on Nov. 19 2015,15:09

Quote (Otangelo @ Nov. 19 2015,14:26)
We have evidence from daily experience that we can design AND manufacture things.

We see all the time intelligence producing complex machines, and information based systems.

We have NEVER seen unguided, non conscientious, random , non-intelligent forces do the same.  

---------------------QUOTE-------------------


Well yes, we have.  They're called < evolutionary algorithms >.  Engineers use them all the time to solve difficult technical problems.

Looks like you're as ignorant about engineering techniques as you are math and science.
Posted by: NoName on Nov. 19 2015,15:12

Quote (Otangelo @ Nov. 19 2015,15:46)
Quote (NoName @ Nov. 19 2015,14:44)
The nicest rejoinder is simply 'citation needed'.
You are arguing, badly, against a poorly constructed strawman.
Shameful.
But exactly what we have come to expect from you.
---------------------QUOTE-------------------


Well, when you have rational and compelling answers of these issues through naturalism, let me know.... LOL....
---------------------QUOTE-------------------


This does not address the charge that you are arguing against a strawman version of  science that you have made up simply to dismiss.  Thus, citations are needed to show that the view(s) you are rejecting are actually held.

Insofar as you adequately present problems, e already have answers for most of them.
We have no reason to suppose we won't get the rest.
Meanwhile, creationism has no explanations.
All it has is "poof", which has no explanatory power at all.

And you still have not answered the question:

Why is abiogenesis impossible?
Your claim.  Defend it or explicitly abandon it.
Posted by: NoName on Nov. 19 2015,15:14

Quote (Otangelo @ Nov. 19 2015,16:05)
Quote (NoName @ Nov. 19 2015,14:58)
ID has no explanatory power.
---------------------QUOTE-------------------


Ok then. I guess we have nothing to tell us furthermore. Good bye.
---------------------QUOTE-------------------


You, and presumably your tapeworm, have never had anything to tell us.
You've brought not one single new argument to the table.
All you have are  PRATTs -- that's Points Refuted A Thousand Times.

And, as Dr. GH has noted, you are  clearly both ignorant and  willing to remain that way, even in the face of the information provided.

Don't let the door hit you in the brains on your way out.
Posted by: NoName on Nov. 19 2015,15:15

Quote (OgreMkV @ Nov. 19 2015,16:09)
Quote (Otangelo @ Nov. 19 2015,14:39)
Quote (NoName @ Nov. 19 2015,14:24)
Given the success of naturalism, and the vast and unquestioned amount of evidence for it, it really does.
---------------------QUOTE-------------------


You are kidding, right ??

The Big Bang : a mess of a theory, which has just two things right. The beginning of the universe, and its expansion.
Black matter ? no evidence
Fine tuning of the universe ? no good answer
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter.
Origin of life: no evidence
Biodiversity : no evidence that macro evolution above species ever happened. Plenty of reasons to reject the claims.....
Fossils : plenty of evidence they are young...
and sudden appearance of major phyla in the cambrian refute the ToE.
---------------------QUOTE-------------------


Your understanding of even basic science, like gravity, is flawed. Your understanding of advanced science is non-existent.

Therefore. You are meaningless.

That shows by you having been banned from progressively smaller and smaller forums until you end up here where all we do is laugh at people who have no idea what's going on. I mean, we have one guy here who thinks that ice isn't water and that frequency = wavelength.

We know you can't answer questions.
We know you can't handle the basic science of a 5th grader.
We know you don't understand the material you post.

You have become totally irrelevant. Even among creationists.
---------------------QUOTE-------------------


Precisely.
Posted by: Occam's Aftershave on Nov. 19 2015,15:16

Quote (Otangelo @ Nov. 19 2015,14:39)
Fossils : plenty of evidence they are young...
and sudden appearance of major phyla in the cambrian refute the ToE.
---------------------QUOTE-------------------


Another golden idiot moment:  claiming that the fossils are all less than 6000 years old and arguing that 500 million year old Cambrian fossils support his "design" IDiocy.

BANG!  Otangelo blows another hole in his foot!  :D
Posted by: JohnW on Nov. 19 2015,15:50

Quote (Richardthughes @ Nov. 19 2015,12:46)


---------------------QUOTE-------------------
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter
---------------------QUOTE-------------------



< https://www.cfa.harvard.edu/~agoodm....ays.pdf >
---------------------QUOTE-------------------


Hang on a minute.  Is Otardelo claiming that stars are solid?
Posted by: stevestory on Nov. 19 2015,15:54



---------------------QUOTE-------------------
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter.
---------------------QUOTE-------------------



well that's the stupidest thing i'll read all week.
Posted by: Occam's Aftershave on Nov. 19 2015,15:55

Quote (stevestory @ Nov. 19 2015,15:54)
 

---------------------QUOTE-------------------
star formation : clumping of gas. A fairy tale story 200 years old. It was never observed that gas clumps into solid matter.
---------------------QUOTE-------------------



well that's the stupidest thing i'll read all week.
---------------------QUOTE-------------------


C'mon, Otangelo still has three more days.  Don't sell him short.  :)
Posted by: stevestory on Nov. 19 2015,16:55

I'm not reading much of him. Gas doesn't clump together? Too dumb to be very entertaining.
Posted by: Otangelo on Nov. 19 2015,17:12

Quote (Dr.GH @ Nov. 19 2015,15:07)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.
---------------------QUOTE-------------------


No kidding.....

I think i do have interest in the truth. I am not interested in self delusion. And i am unimpressed with your credentials. What is relevant to me, are the facts on the table.

“To a person that doesn’t feel obliged to restrict his search to unintelligent causes, the straightforward conclusion is that many of these systems were designed. They were designed not by the laws of nature, not by chance and necessity; rather, they were planned. The designer knew what the systems would look like when they were completed, then took steps to bring the systems about. Life on earth at its most fundamental level, in its most critical components, is the product of intelligent activity” (Behe, 1996, p. 193).

Gibson (1993) also concludes that it is credible to believe in special creation by an intelligent Creator. He does not mean to imply that every aspect of biblical creationism is supported by science because there are some aspects of nature that remain unexplained. However, there is no alternative theory that explains all the data.

What the apostle Paul said two thousand years, ago, is still actual today :

18 The wrath of God is being revealed from heaven against all the godlessness and wickedness of people, who suppress the truth by their wickedness, 19 since what may be known about God is plain to them, because God has made it plain to them. 20 For since the creation of the world God’s invisible qualities—his eternal power and divine nature—have been clearly seen, being understood from what has been made, so that people are without excuse.

21 For although they knew God, they neither glorified him as God nor gave thanks to him, but their thinking became futile and their foolish hearts were darkened. 22 Although they claimed to be wise, they became fools
Posted by: NoName on Nov. 19 2015,17:22

Quote (Otangelo @ Nov. 19 2015,18:12)
Quote (Dr.GH @ Nov. 19 2015,15:07)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.
---------------------QUOTE-------------------


No kidding.....

I think i do have interest in the truth. I am not interested in self delusion. And i am unimpressed with your credentials. What is relevant to me, are the facts on the table.
...
---------------------QUOTE-------------------


You contradict yourself.
To the surprise of no one here.

You probably can't even see it, you deluded fool.

As a side note, let me point out that at no point in this thread has Dr. GH acted as if his credentials were significant.  You, on the other hand, have rather clumsily attempted multiple arguments from authority.  At no point have you even attempted to show that those sources were authoritative.
Spencer, Behe, Genesis.  Who cares.  Demonstrably wrong, each.  And the demonstrations have been made in this thread.
Posted by: Occam's Aftershave on Nov. 19 2015,17:25

Quote (Otangelo @ Nov. 19 2015,17:12)
I think i do have interest in the truth. I am not interested in self delusion. And i am unimpressed with your credentials. What is relevant to me, are the facts on the table.
---------------------QUOTE-------------------


In response to scientific questions about all the IDiot nonsense he's been C&Ping Otangelo starts quoting Bible verses.

See, I told you not to sell him short.  :D  :D  :D
Posted by: Otangelo on Nov. 19 2015,17:41

Quote (Dr.GH @ Nov. 19 2015,15:07)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?
---------------------QUOTE-------------------


Doctor G

i wonder what you have to say about this.

Chlorophyll biosynthesis is a complex pathway with 17 highly specific steps, of which eight last steps are used by specific enzymes uniquely in this pathway.

Even if we find in the sequence space the right steps to make the enzymes required to permit the synthesis of the products of these intermediate steps, so what ? the intermediate products would have no function, and no survival advantage of the organism would be provided. Natural selection could not operate to favor a system with anything less than all seventeen enzymes being present, functioning and processing all intermediate products to get the final product. What evolutionary process could possibly produce complex sophisticated enzymes that generate nothing useful until the whole process is complete? And even if everything were in place correctly, and chlorophyll were synthesized correctly, so what ? Unless chlorophyll AND all other proteins and protein complexes were fully in place, fully evolved and functional, correctly interlocked and working in a interdependent manner, photosynthesis would not happen. But even if photosynthesis would happen, so what ? Why would the organism chose such a extremely complex mechanism, if it was surviving just fine previously ? Furthermore, you do not just need the right enzymes. For the assembly of a biological system of multiple parts, following steps must be explained : the origin of the genome information to produce all subunits and assembly cofactors. Parts availability, synchronization, manufacturing and assembly coordination through genetic information, and interface compatibility. The individual parts must precisely fit together. All these steps are better explained through a super intelligent and powerful designer, rather than mindless natural processes by chance, or / and evolution, since we observe all the time minds capabilities producing machines and factories, producing machines and end products.

everything *has* to be in place at once or else an organism has no survival advantage. The thing is, there’s no driver for any of the pieces to evolve individually because single parts confer no advantage in and of themselves. The necessity for the parts of the system to be in place all at once is simply evidence of creation. Photosynthesis missing one piece (like chlorophylls) is like a car missing just one piece of the drive train (such as a differential); it’s not that it doesn’t function as well – it doesn’t function at all!
Posted by: someotherguy on Nov. 19 2015,17:46

Quote (Otangelo @ Nov. 19 2015,17:41)
Quote (Dr.GH @ Nov. 19 2015,15:07)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?
---------------------QUOTE-------------------


Doctor G

i wonder what you have to say about this.

Chlorophyll biosynthesis is a complex pathway with 17 highly specific steps, of which eight last steps are used by specific enzymes uniquely in this pathway.

Even if we find in the sequence space the right steps to make the enzymes required to permit the synthesis of the products of these intermediate steps, so what ? the intermediate products would have no function, and no survival advantage of the organism would be provided. Natural selection could not operate to favor a system with anything less than all seventeen enzymes being present, functioning and processing all intermediate products to get the final product. What evolutionary process could possibly produce complex sophisticated enzymes that generate nothing useful until the whole process is complete? And even if everything were in place correctly, and chlorophyll were synthesized correctly, so what ? Unless chlorophyll AND all other proteins and protein complexes were fully in place, fully evolved and functional, correctly interlocked and working in a interdependent manner, photosynthesis would not happen. But even if photosynthesis would happen, so what ? Why would the organism chose such a extremely complex mechanism, if it was surviving just fine previously ? Furthermore, you do not just need the right enzymes. For the assembly of a biological system of multiple parts, following steps must be explained : the origin of the genome information to produce all subunits and assembly cofactors. Parts availability, synchronization, manufacturing and assembly coordination through genetic information, and interface compatibility. The individual parts must precisely fit together. All these steps are better explained through a super intelligent and powerful designer, rather than mindless natural processes by chance, or / and evolution, since we observe all the time minds capabilities producing machines and factories, producing machines and end products.

everything *has* to be in place at once or else an organism has no survival advantage. The thing is, there’s no driver for any of the pieces to evolve individually because single parts confer no advantage in and of themselves. The necessity for the parts of the system to be in place all at once is simply evidence of creation. Photosynthesis missing one piece (like chlorophylls) is like a car missing just one piece of the drive train (such as a differential); it’s not that it doesn’t function as well – it doesn’t function at all!
---------------------QUOTE-------------------


Yet another copy and paste from here:

< http://reasonandscience.heavenforum.org/t1546-c....pathway >

At least have the decency to continue citing yourself so we can see how little effort you're making.
Posted by: Occam's Aftershave on Nov. 19 2015,17:49

Quote (Otangelo @ Nov. 19 2015,17:41)
i wonder what you have to say about this.

Chlorophyll biosynthesis is a complex pathway with 17 highly specific steps, of which eight last steps are used by specific enzymes uniquely in this pathway.
---------------------QUOTE-------------------


You already C&Ped that three pages back you moron.

You're so confused you can't even remember the stuff you've already plagiarized.
Posted by: Dr.GH on Nov. 19 2015,20:16

Quote (Otangelo @ Nov. 19 2015,15:12)
Quote (Dr.GH @ Nov. 19 2015,15:07)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.
---------------------QUOTE-------------------


No kidding.....
---------------------QUOTE-------------------


No, I was not kidding. You have spent a few days now dodging, and denying obvious facts.

So what was you intent? What motivated you?

You posted some biblical text that you also failed to understand. The Christian Saints Augustine, and Thomas Aquinas rebuke you. There is a Bible centric version of science that is not creationism per se. There are scientists, and theologians who have placed an emphasis on biblical versus like Psalm 19:

1 The heavens are telling of the glory of God; And their expanse is declaring the work of His hands.

2 Day to day pours forth speech, And night to night reveals knowledge.

Or;

Psalm 85:11 which reads, “Truth springs from the earth; and righteousness looks down from heaven.” The Hebrew word translated here as “truth,” emet, basically means “certainty and dependability.”

This promotes the notion that the material universe is a physical "testament" equally true as revealed scripture. Below are a selection of books by Christians who are theologians, scientists, and often both;

Ayala, Francisco
2006 "Darwin and Intelligent Design" Minneapolis: Fortress Press (Ayala was a Jesuit seminarian. Today he is a leading molecular biologist at teh University of California, Irvine).

Collins, Francis S.
2006 "The Language of God: A Scientist Presents Evidence for Belief" New York Free Press- Simon and Schuster (Francis Collins is a born-again Evangelical. He was the Director of the Human Genome Project, and is today Director of the National Institutes of Health, USA).

Frye, Roland Mushat (editor)
1983 "Is God a Creationist?: The Religious Case Against Creation-Science" New York: Charles Scribner's Sons, Inc. (There are several contributors who are clergy, and scientists)

Godfry, Stephen J. and Christopher R. Smith
2005 "Paradigms on Pilgrimage: Creationism, Paleontology, and Biblical Interpretation." Toronto: Clements Publishing. (Interesting combination. Friends from seminary, and now brothers-in-law. One is ordained, the other left the church and is a professional geologist).

Haught, John F.
2001 “Responses to 101 Questions on God and Evolution” New York: Paulist Press. (Haught is a Catholic theologian who testified as a plaintiff expert in the Dover, Pa “Intelligent Design” trial).

Hyers, Conrad
1984 “The Meaning of Creation: Genesis and Modern Science” Atlanta: John Knox Press (Conrad Hyers has served as Professor of the History of Religion and Chair of the Department of Religion at both Beloit College and at Gustavus Adolphus College. He is also an ordained Presbyterian minister)

Miller, Keith B. (editor)
2003 “Perspectives on an Evolving Creation” Grand Rapids: Eerdmans Publishing (There are several contributors who are clergy, and scientists)

Ken Miller
2008 “Only a Theory” New York: Viking Press (Ken Miller is the co-author of the most popular high school biology textbook in the USA. He is a Professor of Biology, and an observant Catholic).

Roberts, Michael
2008 "Evangelicals and Science" Greenwood Press (Michael Roberts is an Anglican Priest, and a Certified Geologist).

Since Otangelo is willing to ignore obvious scientific facts, I expect he will ignore theology, and Bible facts.
Posted by: Otangelo on Nov. 19 2015,21:19

Quote (Dr.GH @ Nov. 19 2015,20:16)
Since Otangelo is willing to ignore obvious scientific facts, I expect he will ignore theology, and Bible facts.
---------------------QUOTE-------------------


Nice dodging.

Who is ignoring who ? Second time i post the same argument, but no answer... LOL.
Posted by: Occam's Aftershave on Nov. 19 2015,21:34

Quote (Otangelo @ Nov. 19 2015,21:19)
 
Quote (Dr.GH @ Nov. 19 2015,20:16)
Since Otangelo is willing to ignore obvious scientific facts, I expect he will ignore theology, and Bible facts.
---------------------QUOTE-------------------


Nice dodging.

Who is ignoring who ? Second time i post the same argument, but no answer... LOL.
---------------------QUOTE-------------------


You didn't post an argument.  You posted some info you C&Ped from AsshatsInGenesis then did your usual IDiot dance "It's SOOOOOOO complex!!  That means GODDIDIT!!"

You couldn't form a coherent argument if your ignorant Fundy life depended on it.
Posted by: Dr.GH on Nov. 19 2015,21:41

Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?
Posted by: Otangelo on Nov. 19 2015,21:53

Quote (Dr.GH @ Nov. 19 2015,21:41)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?
---------------------QUOTE-------------------


dodging again. I am providing to you a hypothesis, to which i am offering you the oportunity here to test your views, and refute my claims if you can.

waiting......

p.s. i am suspecting that you dodge the issue, because you have no good explanation based on natural mechanisms.
Posted by: Otangelo on Nov. 19 2015,21:55

Quote (Dr.GH @ Nov. 19 2015,21:41)
It cannot impress the majority of us who are professional scientists. (In my case retired).
---------------------QUOTE-------------------


Good.

Then below text is reaching the right address.

Please answer......

Doctor G

i wonder what you have to say about this.

Chlorophyll biosynthesis is a complex pathway with 17 highly specific steps, of which eight last steps are used by specific enzymes uniquely in this pathway.

Even if we find in the sequence space the right steps to make the enzymes required to permit the synthesis of the products of these intermediate steps, so what ? the intermediate products would have no function, and no survival advantage of the organism would be provided. Natural selection could not operate to favor a system with anything less than all seventeen enzymes being present, functioning and processing all intermediate products to get the final product. What evolutionary process could possibly produce complex sophisticated enzymes that generate nothing useful until the whole process is complete? And even if everything were in place correctly, and chlorophyll were synthesized correctly, so what ? Unless chlorophyll AND all other proteins and protein complexes were fully in place, fully evolved and functional, correctly interlocked and working in a interdependent manner, photosynthesis would not happen. But even if photosynthesis would happen, so what ? Why would the organism chose such a extremely complex mechanism, if it was surviving just fine previously ? Furthermore, you do not just need the right enzymes. For the assembly of a biological system of multiple parts, following steps must be explained : the origin of the genome information to produce all subunits and assembly cofactors. Parts availability, synchronization, manufacturing and assembly coordination through genetic information, and interface compatibility. The individual parts must precisely fit together. All these steps are better explained through a super intelligent and powerful designer, rather than mindless natural processes by chance, or / and evolution, since we observe all the time minds capabilities producing machines and factories, producing machines and end products.

everything *has* to be in place at once or else an organism has no survival advantage. The thing is, there’s no driver for any of the pieces to evolve individually because single parts confer no advantage in and of themselves. The necessity for the parts of the system to be in place all at once is simply evidence of creation. Photosynthesis missing one piece (like chlorophylls) is like a car missing just one piece of the drive train (such as a differential); it’s not that it doesn’t function as well – it doesn’t function at all!
Posted by: Dr.GH on Nov. 19 2015,22:02

Quote (Dr.GH @ Nov. 19 2015,19:41)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?
---------------------QUOTE-------------------


Apparently you are neither able to learn, or even answer a simple question.

What do you think you are doing?

All I see is a fool.
Posted by: Otangelo on Nov. 19 2015,22:14

Quote (Dr.GH @ Nov. 19 2015,22:02)
What do you think you are doing?

All I see is a fool.
---------------------QUOTE-------------------


haha.

Rather than a rational discourse and subject specific answering of the issue in question, you have decided to start name calling me.

What a nice scientist you are... pffff.....
Posted by: Richardthughes on Nov. 19 2015,22:15

Quote (Otangelo @ Nov. 19 2015,21:53)
Quote (Dr.GH @ Nov. 19 2015,21:41)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?
---------------------QUOTE-------------------


dodging again. I am providing to you a hypothesis, to which i am offering you the oportunity here to test your views, and refute my claims if you can.

waiting......

p.s. i am suspecting that you dodge the issue, because you have no good explanation based on natural mechanisms.
---------------------QUOTE-------------------


Liar and theif accessing others of dodging ? Tsssk
Posted by: Otangelo on Nov. 19 2015,22:17

Quote (Dr.GH @ Nov. 19 2015,22:02)
Quote (Dr.GH @ Nov. 19 2015,19:41)
Otangelo, I won't keep wasting time offering facts. You have shown that you have no interest in facts.

I do have a question that only you can answer; "What are you trying to do?"

It cannot be to learn anything. It cannot impress the majority of us who are professional scientists. (In my case retired). We either already know the science you have garbled, or we have enough education to read the science. Unlike you we can understand what we read.

Are you just jerking off to the attention you have gotten?
---------------------QUOTE-------------------


Apparently you are neither able to learn, or even answer a simple question.

What do you think you are doing?

All I see is a fool.
---------------------QUOTE-------------------


I will help you a littlebit further, Mr. Scientist with air of superiority... LOL...

On the one side you have a intelligent agency based system of irreducible complexity of tight integrated , information rich functional systems which have ready on hand energy directed  for such, that routinely generate the sort of phenomenon being observed.  And on the other side imagine a golfer, who has played a golf ball through an 12 hole course. Can you imagine that  the ball could also play itself around the course in his absence ? Of course, we could not discard, that natural forces, like wind , tornadoes or rains or storms  could produce the same result, given enough time.  the chances against it however are so immense, that the suggestion implies that the non-living world had an innate desire to get through the 12 hole course.
Posted by: Otangelo on Nov. 19 2015,22:18

< http://www.angelfire.com/pro....nce.htm >
Posted by: Occam's Aftershave on Nov. 19 2015,22:36

Quote (Otangelo @ Nov. 19 2015,22:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Jesus tittyfucking Christ if this moron didn't just link to the "genius" of Gordon E. Mullings of Manjack Heights, Montserrat.

:D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D

What a F.I.A.S.C.O.  Where's the 6500 C3 fishing reel?  :p
Posted by: Dr.GH on Nov. 19 2015,22:37

I'll even drop the only question I had that you might have answered.

Apparently you cannot answer it.
Posted by: Otangelo on Nov. 19 2015,22:42

Quote (Dr.GH @ Nov. 19 2015,22:37)
What do you think you are doing?
---------------------QUOTE-------------------


Well, i will tell you what i am doing.

I am showing the superior explanatory power of intelligent design over naturalism.

I will show you now what Blankenship, THE expert of photosynthesis, has to say about the issue in question :

Blankenship: Molecular mechanisms of photosynthesis pg.208:

It is not conceivable that highly complex molecules such as chlorophylls were synthesized by prebiotic chemistry, given their very specific functional groups and multiple chiral centers. Instead, they are the end product of a progressive evolutionary development, in which simple molecules are the start of the biosynthesis chain and are then progressively elaborated in later steps. In this view, each intermediate in the modern pathway was at some point the end point in the pathway. This requires that each intermediate in the modern pathway be usable in the past as an end product. In the case of chlorophyll biosynthesis, Granick proposed that simple porphyrins or porphyrin precursors were the starting points, and that successive steps were added to improve the efficiency of the pigments or to extend light absorption into new spectral ranges. This is an appealing
idea and is probably at least partially true. The Granick hypothesis in the context of photosynthesis has been championed by Mauzerall (1992), as well as embraced by others (Olson and Pierson, 1987; Olson, 1999, 2006).

This is about the best explanation that proponents of naturalistic origins can come up with. All it exemplifies is baseless just so assertions in a superficial manner. Pseudo science at its best. It should be clear to any honest thinker that there is a hudge gap of explanatory power between proponents of naturalism, and design.
Posted by: Dr.GH on Nov. 19 2015,22:45

Quote (Occam's Aftershave @ Nov. 19 2015,20:36)
Quote (Otangelo @ Nov. 19 2015,22:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Jesus tittyfucking Christ if this moron didn't just link to the "genius" of Gordon E. Mullings of Manjack Heights, Montserrat.

:D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D

What a F.I.A.S.C.O.  Where's the 6500 C3 fishing reel?  :p
---------------------QUOTE-------------------


What a fucking moron the Chewtoy is.



Posted by: Otangelo on Nov. 19 2015,22:49

Quote (Dr.GH @ Nov. 19 2015,22:45)
Quote (Occam's Aftershave @ Nov. 19 2015,20:36)
 
Quote (Otangelo @ Nov. 19 2015,22:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Jesus tittyfucking Christ if this moron didn't just link to the "genius" of Gordon E. Mullings of Manjack Heights, Montserrat.

:D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D

What a F.I.A.S.C.O.  Where's the 6500 C3 fishing reel?  :p
---------------------QUOTE-------------------


What a fucking moron the Chewtoy is.



---------------------QUOTE-------------------


haha.

The rational discourse has definitively been exchanged for explicit trolling.

BIG fail...
Posted by: Occam's Aftershave on Nov. 19 2015,22:49

Quote (Otangelo @ Nov. 19 2015,22:42)
   
Quote (Dr.GH @ Nov. 19 2015,22:37)
What do you think you are doing?
---------------------QUOTE-------------------


Well, i will tell you what i am doing.

I am showing the superior explanatory power of intelligent design over naturalism.

I will show you now what Blankenship, THE expert of photosynthesis, has to say about the issue in question :

Blankenship: Molecular mechanisms of photosynthesis pg.208:
---------------------QUOTE-------------------


Hmmm.

The expert on photosysnthesis, the professional scientists who has studied it his entire life, has no doubt the process evolved through natural means.

The scientifically ignorant engineer who only knows how to copy and plagiarize and who doesn't even know what the technical terms mean says with zero evidence GAWD POOFED IT.

Who to believe?   :D
Posted by: Otangelo on Nov. 19 2015,22:51

all spectators will be ashamed of you guy's.... what a petty.... LOL
Posted by: Otangelo on Nov. 19 2015,22:54

< http://postimg.org/image....yfhe9fl >
Posted by: Occam's Aftershave on Nov. 19 2015,22:54

Quote (Otangelo @ Nov. 19 2015,22:49)
 
Quote (Dr.GH @ Nov. 19 2015,22:45)
   
Quote (Occam's Aftershave @ Nov. 19 2015,20:36)
     
Quote (Otangelo @ Nov. 19 2015,22:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Jesus tittyfucking Christ if this moron didn't just link to the "genius" of Gordon E. Mullings of Manjack Heights, Montserrat.

:D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D  :D

What a F.I.A.S.C.O.  Where's the 6500 C3 fishing reel?  :p
---------------------QUOTE-------------------


What a fucking moron the Chewtoy is.



---------------------QUOTE-------------------


haha.

The rational discourse has definitively been exchanged for explicit trolling.

BIG fail...
---------------------QUOTE-------------------


Psst.. hey Otangelo...

You're the one who has been kicked off multiple science discussion boards for being an asshole, only spamming boards with C&Ped stuff you don't understand and running from all questions.  Just like you're doing here.

The difference is we won't ban you.  We'll just point out what an ignorant fool you are every time you post this crap.  Eventually you'll get tired of looking like a fool and leave.
Posted by: Occam's Aftershave on Nov. 19 2015,23:10

Quote (Otangelo @ Nov. 19 2015,22:54)
< http://postimg.org/image......age.... >
---------------------QUOTE-------------------




:D
Posted by: EmperorZelos on Nov. 19 2015,23:41



---------------------QUOTE-------------------
Peer review: a flawed process at the heart of science and journals
---------------------QUOTE-------------------


And here we have it, excuse making when you cannot provide real evidence and scientists see it.



---------------------QUOTE-------------------
Origin of life: no evidence
Biodiversity : no evidence that macro evolution above species ever happened. Plenty of reasons to reject the claims.....
Fossils : plenty of evidence they are young...
---------------------QUOTE-------------------


This is an outright lie because I provided you long lists of evidence, proper peer reviewed ones.
Posted by: EmperorZelos on Nov. 19 2015,23:51



---------------------QUOTE-------------------
I think i do have interest in the truth. I am not interested in self delusion. And i am unimpressed with your credentials. What is relevant to me, are the facts on the table.
---------------------QUOTE-------------------


This is another lie that has been dmeonstrated here, you reject observed science in favour of what suits your pet idea.
Posted by: Otangelo on Nov. 20 2015,00:16

Quote (EmperorZelos @ Nov. 19 2015,23:41)


---------------------QUOTE-------------------
Peer review: a flawed process at the heart of science and journals
---------------------QUOTE-------------------


And here we have it, excuse making when you cannot provide real evidence and scientists see it.



---------------------QUOTE-------------------
Origin of life: no evidence
Biodiversity : no evidence that macro evolution above species ever happened. Plenty of reasons to reject the claims.....
Fossils : plenty of evidence they are young...
---------------------QUOTE-------------------


This is an outright lie because I provided you long lists of evidence, proper peer reviewed ones.
---------------------QUOTE-------------------


Take one, just ONE of the peer reviewed papers in the two lists you provided, and post compelling reasons provided by the papers to accept abiogenesis and macro change, that is empirical data of a unorganized undirected unguided Neo-Darwinian accidental random macro-evolutionary event of a change/transition, where  one "kind" can evolve into another beyond the species level (i.e. speciation) ,  like a organism randomly changing/transition into a whole entire different, new fully functioning biological features in an organism, the emergence of new complex functions, a new genus or higher rank in taxonomy, with the arise of new body plans, wings, eyes, lungs, gills, sexual gender, transition from prokaryotes to eukaryotes, the arise of photosynthesis and nitrogenase in cyanobacteria;  something that we merely don't have to just put  blind faith in.

Call me a liar does not help your case either. Its just a sign of despair. You can do better than that, can't u ?
Posted by: fnxtr on Nov. 20 2015,00:43

Flank's dictum holds. They come in pretending to do science, but they always, always, always descend into Bible-thumping.

Every. Single. Time.
Posted by: The whole truth on Nov. 20 2015,01:00

Quote (Otangelo @ Nov. 19 2015,20:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?
Posted by: Otangelo on Nov. 20 2015,01:06

Quote (The whole truth @ Nov. 20 2015,01:00)
Quote (Otangelo @ Nov. 19 2015,20:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?
---------------------QUOTE-------------------


what i have posted, is all i have read of his website.
Posted by: The whole truth on Nov. 20 2015,04:48

Quote (Otangelo @ Nov. 19 2015,23:06)
Quote (The whole truth @ Nov. 20 2015,01:00)
Quote (Otangelo @ Nov. 19 2015,20:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?
---------------------QUOTE-------------------


what i have posted, is all i have read of his website.
---------------------QUOTE-------------------


Do you agree with everything that gordo (kairosfocus) said on that page? If there is anything that you don't agree with, what is it?
Posted by: Otangelo on Nov. 20 2015,05:08

Quote (The whole truth @ Nov. 20 2015,04:48)
Quote (Otangelo @ Nov. 19 2015,23:06)
Quote (The whole truth @ Nov. 20 2015,01:00)
 
Quote (Otangelo @ Nov. 19 2015,20:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?
---------------------QUOTE-------------------


what i have posted, is all i have read of his website.
---------------------QUOTE-------------------


Do you agree with everything that gordo (kairosfocus) said on that page? If there is anything that you don't agree with, what is it?
---------------------QUOTE-------------------


ah, i have read this as well, which i fully agree with :

For a working biological system to be built by exaptation , the five following conditions would all have to be met:

C1: Availability. Among the parts available for recruitment to form the system, there would need to be ones capable of performing the highly specialized tasks of individual parts, even though all of these items serve some other function or no function.

C2: Synchronization. The availability of these parts would have to be synchronized so that at some point, either individually or in combination, they are all available at the same time.

C3: Localization. The selected parts must all be made available at the same ‘construction site,’ perhaps not simultaneously but certainly at the time they are needed.

C4: Coordination. The parts must be coordinated in just the right way: even if all of the parts of a system are available at the right time, it is clear that the majority of ways of assembling them will be non-functional or irrelevant.

C5: Interface compatibility. The parts must be mutually compatible, that is, ‘well-matched’ and capable of properly ‘interacting’: even if sub systems or parts are put together in the right order, they also need to interface correctly.

( Agents Under Fire: Materialism and the Rationality of Science, pgs. 104-105 (Rowman & Littlefield, 2004). HT: ENV.)

this is a major problem for proponents of macro evolution
Posted by: Soapy Sam on Nov. 20 2015,05:19

Shorter otangelo: "You can't get photosynthesis from a prebiotic soup! Therefore God! Because there's no other way of getting energy into living systems. None. None I'm aware of anyway. "
Posted by: Otangelo on Nov. 20 2015,05:46

Quote (Soapy Sam @ Nov. 20 2015,05:19)
Shorter otangelo: "You can't get photosynthesis from a prebiotic soup! Therefore God! Because there's no other way of getting energy into living systems. None. None I'm aware of anyway. "
---------------------QUOTE-------------------


Another issue to consider, if talking about photosynthesis :

Rubisco's amazing evidence of design  1

Rubisco  is the most important enyzme on the planet.

< http://reasonandscience.heavenforum.org/t1554-t....gn#2337 >

virtually all the organic carbon in the biosphere derives ultimately from the carbon dioxide that this enzyme fixes from the atmosphere. Without it, advanced life would not be possible. And we would not be able to debate our origins. All inquiry and quest about if we are ultimatively the result of a powerful creator, or just random natural chemical reactions and emerging properties of  lifeless matter, if biodiversity is due to evolution, or a intelligent designer, is second to the inquiry of how Rubisco came to be. Through my research i gained remarkable insight about Rubisco's  complex structure, functioning  and synthesis process, how many cell parts , enzymes, proteins and pathways are involved and required to assemble it, how the unfinished sub units  require co and post-translational modifications, specific proteins that help like assembly robots in the manufacturing process,sophisticated pathways and mechanisms of protein import and targeting in chloroplasts through large multiprotein translocon complexes  in the stroma, and andvanced protein communication and information systems. All this is of bewildering complexity, where dozens of individual interconnected and finely tuned parts are required, a web of interlocked extremely complex advanced molecular machines where if one is missing, nothing goes, that defy the intelligence of the best scientists for decades to find out their structure, mechanisms and functions. Could all this  be due to natural processes ?

RuBisCO is a multi-subunit plant protein essential to photosynthesis.  It catalyzes the primary chemical reaction by which inorganic carbon enters the biosphere. In the C3 pathway, RuBisCO is responsible for initiating the first step in carbon dioxide fixation, a process by which atmospheric carbon dioxide is converted by plants to energy-rich molecules such as glucose. This  step of the Calvin Cycle plays a crucial role in providing energy for the cell.

< http://reasonandscience.heavenforum.org/t2164-t....n-cycle >

Rubisco is also the most abundant enzyme on earth. It is present in every plant and  photosynthetic organism, from the smallest cyanobacteria and plankton to palm trees and giant sequoias. Rubisco is a complex composed by eight large subunits and eight small subunits

Synthesized RuBisCO does not have a fully functional active site. It needs to be activated by a CO2 molecule that carbamylates its catalytic Lys to bind Mg2+ that completes the activation process. . The carboxylation involves at least four, perhaps five discrete steps and at least three transition states;

The origin of these highly specific , regulated and coordinated  steps, which are essential for the activation of Rubisco, are best explained through a planning mind, which all set it up. Natural mechanisms are extremely unlikely to be capable to produce these sofisticated metabolic multistep pathways and assembly lines to make Rubisco in the first place . No wonder, that no mainstream scientific papers are able to provide compelling evolutionary scenarios.    As long as the enzyme is not fully functional, nothing goes, and ultimatively, advanced life on earth would not be possible .How did the correct insertion of the correct metal cation Mg2+ surrounded by three H2O/OH molecules emerge ? Trial and error ? The genome needs the right information in order to get the right materials, the right shape and quantity of each subunit co-factors and metal clusters,how to position them at the right active site, and how to mount these parts in the right order . That seems to me only being explained in a compelling manner by the wise planning  of a super intelligent engineer, which knew how to invent and build this highly sophisticated and complex machine and make it fully functional right from scratch. A step wise unguided emergence seems to be extremely unlikely.This mechanism  seems to be the result of a  intelligence, which set it all up through power, will and information.

The eight large  subunits of rubisco are coded by the chloroplast DNA, and the eight small  subunits by nuclear DNA. The small  subunit of Rubisco and all the other Calvin cycle enzymes are encoded by nuclear genes and must be  transported and travel to the chloroplast site after their synthesis in the cytosol.

< http://reasonandscience.heavenforum.org/t2165-p....oplasts >

The precursor forms of these stromal proteins contain an N-terminal stromal-import sequence. This  transit peptide allows transfer of the small subunits synthesized in the cytosol through the chloroplast envelope translocon complexes into the plastid. These are highly complex molecular gates in the chloroplast inner and outer membrane, which filter which molecules go in.  After the unfolded precursor enters the stromal space, it binds transiently to a stromal Hsc70 chaperone and the Nterminal sequence is cleaved.

Folding of the small and large Rubisco subunit proteins is mediated by the amazing GroEL–GroES chaperonin system. Protein folding mediated by chaperonins  is the process by which newly synthesized polypeptide chains acquire the three-dimensional structures necessary for biological function. For many years, protein folding was believed to occur spontaneously.  But it has become apparent that large proteins frequently fail to reach native state, forming nonfunctional aggregates instead. They need the aid of these sophisticated barrel shaped proteins.

< http://reasonandscience.heavenforum.org/t1437-c....perones >

That raises interesting questions : How should and could natural non guided natural mechanisms forsee the necessity of chaperones in order to get a specific goal, that is the right precise 3 dimensional folding resulting in functional proteins to make living organisms ? Non living matter has no natural " drive " or purpose or goal to become living. The make of proteins to create life however is a multistep process of many parallel acting complex metabolic pathways and production-line like processes to make proteins and other life essential products like  nucleotides, amino acids, lipids , carbohydrates etc. The right folding of proteins is just one of several other essential processes in order to get a functional protein. But a functional protein by its own has no function, unless correctly embedded through the right  assembly sequence and order at the right functional place.

Eight S subunits combine with the eight L subunits to yield the active rubisco enzyme. At least three chloroplast outer-membrane proteins, including a receptor that binds the stromal-import sequence and a translocation channel protein, and five inner-membrane proteins are known to be essential for directing proteins to the stroma. Import into the stroma depends on ATP hydrolysis catalyzed by a stromal Hsc70 chaperone. Chloroplasts cannot generate an electrochemical gradient (proton-motive force) across their inner membrane. Thus protein import into the chloroplast stroma is powered solely by ATP hydrolysis. Within the stroma, the S-subunits undergo further posttranslational modification (transit peptide cleavage, Met-1 aN- methylation) prior to assembly into final L8S8 Rubisco complexes. How did natural evolutionary processes find out how to do it ? Trial and error?

In order to make and assemble Rubisco, at least  25 parts, most of them essential and irreducible, are directily involved in Rubisco function , activation, and  synthesis:

< http://reasonandscience.heavenforum.org/t1554-t....gn#3899 >

Could these parts, proteins enzymes  etc.  have evolved separately and gradually ? What about the RbcX Assembly Chaperone, specifically used as assembly tool of Rubisco ? What about the barrel shaped GroEL/GroES chaperonins which perform their function with extremely impressive  simplicity and elegance, namely helping over 100 different proteins to get into their correct shape and form, essential for function ? ( in our case, helping the Rubisco RbcL subunits to get their proper shape )

These chaperone systems are themselves made of proteins which also require the assistance of chaperones to correctly fold and to maintain integrity once folded. Chaperones for chaperones in fact. The very simplest of cells that we know of have these systems in place.

Or  how do proponents of evolution explain how natural selection would have favoured the emergence of Hsp70 chaperones,  central components of the cellular network,  proteins which assist a large variety of protein folding processes in the cell by transient association of their substrate binding domain with short hydrophobic peptide segments within their substrate proteins ?  That is in our case, their function of which was to prevent a still-useless rubisco small subunit from folding outside the chloroplast?  They are made, used during the synthesis process, and once Rubisco assembly has finished, these enzymes are discarted. This is very much a factory-like production and assembly-line process, using fully automatized and programmed nano-robot like molecular machines, namely enzymes.  Most parts, if missing, render 1. the assembly of Rubisco impossible, and 2. Rubisco useless. Many parts, if missing render it not fully functional and defective.  Beside the enzymes that have use in other biological systems, there would be no reason to make them unless all other parts were there too, and the assembly insctructions of Rubisco. As a analogy, if you had to make the implementation of a car factory, why would you make the assembly chain of a piston, if you do not have all the precise instructions to make 1. the car as a whole, and 2. the instructions of the precise shape and the materials required for the piston in particular, and how to mount it in the motor ? Thats precisely what happens in the cell . Evolution has no consciousness, and no forsight nor intelligence. But precisely that is required for PLANNING and make of blueprints. I cannot create a machine, without the precise drawing and project information in advance, which is required to make 1. the assembly tools 2. the subparts 2. the whole machine.

How do proponents of evolution explain how natural selection would have favoured a protein complex the function of which was to prevent a still-useless Rubisco small subunit from folding outside the chloroplast? Before it evolved a way to get the protein inside, there would be no benefit from keeping it unfolded outside. How could blind chance ‘know’ it needed to cause large subunit polypeptides to fold ‘correctly’ and to keep them from clumping? It could not ‘anticipate’ the ‘correct’ conformation before the protein became useful. And evolution would need to be clever indeed to chemically modify something not yet useful so that it could be folded ‘correctly’ when even the ‘correctly’ folded polypeptide would not yet become useful.

Only a designer would know why it would be necessary to produce a specialized protease, target it to the chloroplast, and program it to clip off the targeting sequence of the small subunit at just the right place. And what about the assembly of a collection of meaningless rubisco parts in just one certain way? In order to design a sophisticated set of tools to make something else useful in the future that had, as yet, no function, evolution (as ‘designer’) would have had to have detailed knowledge of the future usefulness of the protein it was so cleverly engineering. If evolution managed to generate any one of these chaperone protein complexes (and it would not), it would still be useless for generating rubisco unless all the other chaperones were also present. Without any one of them, the sixteen-unit complex could not be generated.

That totally destroys the Evolution Theory:  How should and could natural non guided natural mechanisms forsee the necessity of chaperones in order to get a specific goal, that is the right precise 3 dimensional folding resulting in functional proteins to make living organisms ? Non living matter has no natural " drive " or purpose or goal to become living. The make of proteins to create life however is a multistep process of many parallel acting complex metabolic pathways and production-line like processes to make proteins and other life essential products like nucleotides, amino acids, lipids , carbohydrates etc. The right folding of proteins is just one of several other essential processes in order to get a functional protein. But a functional protein by its own has no function, unless correctly embedded through the right assembly sequence and order at the right functional place." thats precisely the problem of evolution. there is no forsight. So why would evolution produce a assembly chaperone enzyme to make rubisco ? You dont make a robot for a assembly line, if the end product is not known.
Posted by: The whole truth on Nov. 20 2015,06:12

Quote (Otangelo @ Nov. 20 2015,03:08)
Quote (The whole truth @ Nov. 20 2015,04:48)
Quote (Otangelo @ Nov. 19 2015,23:06)
 
Quote (The whole truth @ Nov. 20 2015,01:00)
 
Quote (Otangelo @ Nov. 19 2015,20:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?
---------------------QUOTE-------------------


what i have posted, is all i have read of his website.
---------------------QUOTE-------------------


Do you agree with everything that gordo (kairosfocus) said on that page? If there is anything that you don't agree with, what is it?
---------------------QUOTE-------------------


ah, i have read this as well, which i fully agree with :

For a working biological system to be built by exaptation , the five following conditions would all have to be met:

C1: Availability. Among the parts available for recruitment to form the system, there would need to be ones capable of performing the highly specialized tasks of individual parts, even though all of these items serve some other function or no function.

C2: Synchronization. The availability of these parts would have to be synchronized so that at some point, either individually or in combination, they are all available at the same time.

C3: Localization. The selected parts must all be made available at the same ‘construction site,’ perhaps not simultaneously but certainly at the time they are needed.

C4: Coordination. The parts must be coordinated in just the right way: even if all of the parts of a system are available at the right time, it is clear that the majority of ways of assembling them will be non-functional or irrelevant.

C5: Interface compatibility. The parts must be mutually compatible, that is, ‘well-matched’ and capable of properly ‘interacting’: even if sub systems or parts are put together in the right order, they also need to interface correctly.

( Agents Under Fire: Materialism and the Rationality of Science, pgs. 104-105 (Rowman & Littlefield, 2004). HT: ENV.)

this is a major problem for proponents of macro evolution
---------------------QUOTE-------------------


You still haven't answered my question, so I'm going to assume that you agree with everything that gordo (kairosfocus) said on that page.
Posted by: NoName on Nov. 20 2015,06:40

Quote (Otangelo @ Nov. 19 2015,15:23)
Quote (NoName @ Nov. 19 2015,13:17)
No other "possibility" has ever been shown to be actually possible.
I reject the claim.
---------------------QUOTE-------------------


And it has been shown that life can come from non-life ? LOL....
---------------------QUOTE-------------------


Actually, yes it has.
In a number of ways.

Humans and animals and plants all consume non-living material and that material becomes alive.  At no point in the process is magic involved, nor external intervention by non-natural processes.
The very process of life itself transforms non-life into life.

Proceeding, we find the item I've referenced several times already.
Tobacco mosaic virus.
It self-assembles, it is capable of spending time in a distinctly non-living state, and it lives in tobacco and related plants.
It is a very good target for study as it refutes much of the nonsense you spew, or provides evidence to support the logic and reason that show your copy/pasted conclusions to be suspect at best and wrong in general.

But even worse for your case -- if it truly is the case that life cannot come from non-life, than god can't do it either.
Or, we have the inverse problem, how does non-life come from life?  What sources the sub-atomic, atomic, molecular, and aggregates we routinely encounter that are not alive, have never been alive?

Everything we see and know shows that life is distinct from non-life, that non-life precedes life, and thus life came from non-life.
That's the bottom line problem.

Given that we have no evidence (at all) of any non-natural causes (the very notion is a contradiction in terms, nature being defined as the interwove network of cause and effect), we have no warrant to suppose that there could, even in principle, be a non-natural cause for the rise of life from non-living matter.
Posted by: Occam's Aftershave on Nov. 20 2015,08:01

Quote (Otangelo @ Nov. 20 2015,05:08)
ah, i have read this as well, which i fully agree with :
---------------------QUOTE-------------------


Snip another wall of stolen text he doesn't understand by Otangelo the serial plagiarist.
Posted by: Occam's Aftershave on Nov. 20 2015,08:03

Quote (Otangelo @ Nov. 20 2015,05:46)
Another issue to consider, if talking about photosynthesis :
---------------------QUOTE-------------------


...and yet another huge wall of text stolen by Otangelo the serial plagiarist.

Keep stealing and lying Otangelo, make Jesus proud! :)
Posted by: Soapy Sam on Nov. 20 2015,09:23

Quote (Otangelo @ Nov. 20 2015,11:46)
 
Quote (Soapy Sam @ Nov. 20 2015,05:19)
Shorter otangelo: "You can't get photosynthesis from a prebiotic soup! Therefore God! Because there's no other way of getting energy into living systems. None. None I'm aware of anyway. "
---------------------QUOTE-------------------


Another issue to consider, if talking about photosynthesis : [...] snip yaddayaddayadda about photosynthesis.
---------------------QUOTE-------------------


Psssst! otangelo! I was taking the piss! Photosynthesis isn't the only way to get energy into living systems!
Posted by: EmperorZelos on Nov. 20 2015,10:37

Quote (Otangelo @ Nov. 20 2015,00:16)
Take one, just ONE of the peer reviewed papers in the two lists you provided, and post compelling reasons provided by the papers to accept abiogenesis and macro change, that is empirical data of a unorganized undirected unguided Neo-Darwinian accidental random macro-evolutionary event of a change/transition, where  one "kind" can evolve into another beyond the species level (i.e. speciation) ,  like a organism randomly changing/transition into a whole entire different, new fully functioning biological features in an organism, the emergence of new complex functions, a new genus or higher rank in taxonomy, with the arise of new body plans, wings, eyes, lungs, gills, sexual gender, transition from prokaryotes to eukaryotes, the arise of photosynthesis and nitrogenase in cyanobacteria;  something that we merely don't have to just put  blind faith in.

Call me a liar does not help your case either. Its just a sign of despair. You can do better than that, can't u ?
---------------------QUOTE-------------------


Why one when in science not ever is 1 piece of evidence enough, it's the collection of ALL evidence that matters.

As for liar, I call you a liar because you demonstrably LIE. We provide you with actual research and you say there is none. That is an outright lie.
Posted by: Otangelo on Nov. 20 2015,11:23

Quote (The whole truth @ Nov. 20 2015,06:12)
Quote (Otangelo @ Nov. 20 2015,03:08)
Quote (The whole truth @ Nov. 20 2015,04:48)
 
Quote (Otangelo @ Nov. 19 2015,23:06)
 
Quote (The whole truth @ Nov. 20 2015,01:00)
   
Quote (Otangelo @ Nov. 19 2015,20:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?
---------------------QUOTE-------------------


what i have posted, is all i have read of his website.
---------------------QUOTE-------------------


Do you agree with everything that gordo (kairosfocus) said on that page? If there is anything that you don't agree with, what is it?
---------------------QUOTE-------------------


ah, i have read this as well, which i fully agree with :

For a working biological system to be built by exaptation , the five following conditions would all have to be met:

C1: Availability. Among the parts available for recruitment to form the system, there would need to be ones capable of performing the highly specialized tasks of individual parts, even though all of these items serve some other function or no function.

C2: Synchronization. The availability of these parts would have to be synchronized so that at some point, either individually or in combination, they are all available at the same time.

C3: Localization. The selected parts must all be made available at the same ‘construction site,’ perhaps not simultaneously but certainly at the time they are needed.

C4: Coordination. The parts must be coordinated in just the right way: even if all of the parts of a system are available at the right time, it is clear that the majority of ways of assembling them will be non-functional or irrelevant.

C5: Interface compatibility. The parts must be mutually compatible, that is, ‘well-matched’ and capable of properly ‘interacting’: even if sub systems or parts are put together in the right order, they also need to interface correctly.

( Agents Under Fire: Materialism and the Rationality of Science, pgs. 104-105 (Rowman & Littlefield, 2004). HT: ENV.)

this is a major problem for proponents of macro evolution
---------------------QUOTE-------------------


You still haven't answered my question, so I'm going to assume that you agree with everything that gordo (kairosfocus) said on that page.
---------------------QUOTE-------------------


i have not read the rest of his website. How many times do i need to tell you this ?
Posted by: Otangelo on Nov. 20 2015,11:44

Quote (EmperorZelos @ Nov. 20 2015,10:37)
As for liar, I call you a liar
---------------------QUOTE-------------------


Good bye. If keeping that rhythm, soon there will be nobody left....
Posted by: EmperorZelos on Nov. 20 2015,11:52

Quote (Otangelo @ Nov. 20 2015,11:44)
Quote (EmperorZelos @ Nov. 20 2015,10:37)
As for liar, I call you a liar
---------------------QUOTE-------------------


Good bye. If keeping that rhythm, soon there will be nobody left....
---------------------QUOTE-------------------


How pathetic that when demonstrated a liar you run off.
Posted by: NoName on Nov. 20 2015,11:53

Quote (Otangelo @ Nov. 20 2015,12:44)
Quote (EmperorZelos @ Nov. 20 2015,10:37)
As for liar, I call you a liar
---------------------QUOTE-------------------


Good bye. If keeping that rhythm, soon there will be nobody left....
---------------------QUOTE-------------------


That's at least the 3rd time you've said goodbye.
How can we miss you if you won't go away.

And, btw, the proof that you are a liar is in this very thread.
The proof that you are completely unqualified to present the material you present or to make the assertions you make is also in this thread.

You won't be missed.  You've added nothing of value except mere moments of amusement and various useful links provided by others.  Your own content resembles the post-digestion output of infants.
Posted by: Richardthughes on Nov. 20 2015,12:38

Quote (EmperorZelos @ Nov. 20 2015,11:52)
Quote (Otangelo @ Nov. 20 2015,11:44)
Quote (EmperorZelos @ Nov. 20 2015,10:37)
As for liar, I call you a liar
---------------------QUOTE-------------------


Good bye. If keeping that rhythm, soon there will be nobody left....
---------------------QUOTE-------------------


How pathetic that when demonstrated a liar you run off.
---------------------QUOTE-------------------


He'll declare victory once he's not talking to everyone else... because they've all spotted he lies. What a great advert for ID.
Posted by: Otangelo on Nov. 20 2015,14:11

Gone. Last post here.
Posted by: Richardthughes on Nov. 20 2015,14:21

Quote (Otangelo @ Nov. 20 2015,14:11)
Gone. Last post here.
---------------------QUOTE-------------------


Bye liar!
Posted by: NoName on Nov. 20 2015,14:45

Quote (Otangelo @ Nov. 20 2015,15:11)
Gone. Last post here.
---------------------QUOTE-------------------


Promises, promises.

I notice you're still hanging around, doubtlessly hoping to see some kind of reaction.

Your not up to the usual level of fool we encounter.  Even afdave had more class and worked harder at his schtick.
You're mostly just pathetic.
Posted by: The whole truth on Nov. 20 2015,15:47

Quote (Otangelo @ Nov. 20 2015,09:23)
Quote (The whole truth @ Nov. 20 2015,06:12)
Quote (Otangelo @ Nov. 20 2015,03:08)
 
Quote (The whole truth @ Nov. 20 2015,04:48)
 
Quote (Otangelo @ Nov. 19 2015,23:06)
   
Quote (The whole truth @ Nov. 20 2015,01:00)
   
Quote (Otangelo @ Nov. 19 2015,20:18)
< http://www.angelfire.com/pro........nce.htm >
---------------------QUOTE-------------------


Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?
---------------------QUOTE-------------------


what i have posted, is all i have read of his website.
---------------------QUOTE-------------------


Do you agree with everything that gordo (kairosfocus) said on that page? If there is anything that you don't agree with, what is it?
---------------------QUOTE-------------------


ah, i have read this as well, which i fully agree with :

For a working biological system to be built by exaptation , the five following conditions would all have to be met:

C1: Availability. Among the parts available for recruitment to form the system, there would need to be ones capable of performing the highly specialized tasks of individual parts, even though all of these items serve some other function or no function.

C2: Synchronization. The availability of these parts would have to be synchronized so that at some point, either individually or in combination, they are all available at the same time.

C3: Localization. The selected parts must all be made available at the same ‘construction site,’ perhaps not simultaneously but certainly at the time they are needed.

C4: Coordination. The parts must be coordinated in just the right way: even if all of the parts of a system are available at the right time, it is clear that the majority of ways of assembling them will be non-functional or irrelevant.

C5: Interface compatibility. The parts must be mutually compatible, that is, ‘well-matched’ and capable of properly ‘interacting’: even if sub systems or parts are put together in the right order, they also need to interface correctly.

( Agents Under Fire: Materialism and the Rationality of Science, pgs. 104-105 (Rowman & Littlefield, 2004). HT: ENV.)

this is a major problem for proponents of macro evolution
---------------------QUOTE-------------------


You still haven't answered my question, so I'm going to assume that you agree with everything that gordo (kairosfocus) said on that page.
---------------------QUOTE-------------------


i have not read the rest of his website. How many times do i need to tell you this ?
---------------------QUOTE-------------------


My original questions:

"Otangelo, do you agree with everything that gordo (kairosfocus) said on that page? Do you agree with everything that he says on his other pages on his blogs and at UD? If there is anything that you disagree with, what is it?"

And then, after you said that you haven't read any of gordo's pages except the one that you posted a link to I removed one of my questions and asked you these two questions again:

"Do you agree with everything that gordo (kairosfocus) said on that page? If there is anything that you don't agree with, what is it?"

You still haven't answered those questions, even though they are in regard to the page that you have admitted to reading.
Posted by: EmperorZelos on Nov. 21 2015,00:58

Quote (Otangelo @ Nov. 20 2015,14:11)
Gone. Last post here.
---------------------QUOTE-------------------



Posted by: ChemiCat on Nov. 21 2015,06:38



---------------------QUOTE-------------------
Gone. Last post here.
---------------------QUOTE-------------------



Less staying power than Postcardo, what a waste of space this thread was.
Posted by: stevestory on Nov. 21 2015,09:04

they don't make creationists like they used to!  :p


Posted by: k.e.. on Nov. 21 2015,09:15

Quote (stevestory @ Nov. 21 2015,17:04)
they don't make creationists like they used to!  :p
---------------------QUOTE-------------------


They're devolving into prebiotic soup. Now all we need is some lightning!



Ooooooohhhhhhh instant culture.
Posted by: EmperorZelos on Nov. 21 2015,10:31

Quote (stevestory @ Nov. 21 2015,09:04)
they don't make creationists like they used to!  :p
---------------------QUOTE-------------------



Posted by: k.e.. on Nov. 21 2015,10:53


Posted by: Dr.GH on Nov. 21 2015,13:24

Quote (stevestory @ Nov. 21 2015,07:04)
they don't make creationists like they used to!  :p
---------------------QUOTE-------------------


Who was that Ed "???" on the T.O. list. Conrad?

He could repeat the same bullshit for days, get hammered on the facts, and start over from the top.
Posted by: JonF on Nov. 22 2015,08:01

That was Ed.

It appears that edconrad.com has gone with the dinosaurs.
Posted by: EmperorZelos on Nov. 22 2015,09:29

This is a descriptive picture of ID "Scientists"


Posted by: Cubist on Nov. 22 2015,14:53

Quote (JonF @ Nov. 22 2015,08:01)
That was Ed.

It appears that edconrad.com has gone with the dinosaurs.
---------------------QUOTE-------------------


Peculiar. The Internet Archive has several versions of Ed's website, the most recent being < 12 September 2015 >.
Posted by: Otangelo on Dec. 01 2015,11:00

DNA replication, and its mind boggling nano technology  that defies naturalistic explanations

< http://reasonandscience.heavenforum.org/t1849-d....aryotes >


DNA replication is the most crucial step in cellular division, a process necessary for life, and errors can cause cancer and many other diseases. Genome duplication presents a formidable enzymatic challenge, requiring the high fidelity replication of millions of bases of DNA. It is a incredible system involving a city of proteins, enzymes, and other components that are breathtaking in their complexity and efficiency.

How do you get a living cell capable of self-reproduction from a “protein compound … ready to undergo still more complex changes”? Dawkins has to admit:

“Darwin, in his ‘warm little pond’ paragraph, speculated that the key event in the origin of life might have been the spontaneous arising of a protein, but this turns out to be less promising than most of Darwin’s ideas. … But there is something that proteins are outstandingly bad at, and this Darwin overlooked. They are completely hopeless at replication. They can’t make copies of themselves. This means that the key step in the origin of life cannot have been the spontaneous arising of a protein.” (pp. 419–20)

The process of DNA replication depends on many separate protein catalysts to unwind, stabilize, copy, edit, and rewind the original DNA message. In prokaryotic cells, DNA replication involves more than thirty specialized proteins to perform tasks necessary for building and accurately copying the genetic molecule. These specialized proteins include DNA polymerases, primases, helicases, topoisomerases, DNA-binding proteins, DNA ligases, and editing enzymes. DNA needs these proteins to copy the genetic information contained in DNA. But the proteins that copy the genetic information in DNA are themselves built from that information. This again poses what is, at the very least, a curiosity: the production of proteins requires DNA, but the production of DNA requires proteins.

Proponents of Darwinism are at a loss to tell us how this marvelous system began.  Charles Darwin's main contribution, natural selection, does not apply until a system can reproduce all its parts.  Getting a reproducible cell in a primordial soup is a giant leap, for which today's evolutionary biologists have no answer, no evidence, and no hope.  It amounts to blind faith to believe that undirected, purposeless accidents somehow built the smallest, most complex, most efficient system known to man.

Several decades of experimental work have convinced us that DNA synthesis and replication actually require a plethora of proteins.

Replication of the genetic material is the single central property of living systems. Dawkins provocatively claimed that organisms are but vehicles for replicating and evolving genes, and I believe that this simple concept captures a key aspect of biological evolution. All phenotypic features of organisms—indeed, cells and organisms themselves as complex physical entities—emerge and evolve only inasmuch as they are conducive to genome replication. That is, they enhance the rate of this process, or, at least, do not impede it.

DNA replication is an enormously complex process with many different components that interact to ensure the faithful passing down of genetic components that interact to ensure the faithful passing down of genetic information to the next generation. A large number of parts have to work together to that end. In the absence of one or more of a number of the components, DNA replication is either halted completely or significantly compromised, and the cell either dies or becomes quite sick. Many of the components of the replication machinery form conceptually discrete sub-assemblies with conceptually discrete functions.

Wiki mentions that a key feature of the DNA replication mechanism  is that it is designed to replicate relatively large genomes rapidly and with high fidelity. Part of the cellular machinery devoted to  DNA replication and DNA-repair. The regulation of DNA replication is a vital cellular process. It is controlled by a series of mechanisms. One point of control is by modulating the accessibility of replication machinery components ( called the replisome )  to the single origin (oriC) region on the DNA. DNA replication should take place only when a cell is about to divide. If DNA replication occurs too frequently, too many copies of the bacterial chromosome will be found in each cell. Alternatively, if DNA replication does not occur frequently enough, a daughter cell will be left without a chromosome. Therefore, cell division in bacterial cells must be coordinated with DNA replication.

In prokaryotes, the DNA is circular.  Replication starts at a single origin (ori C) and is bi-directional. The region of replicating DNA associated with the single origin is called a replication bubble  and consists of two replication forks moving in opposite direction around the DNA circle. During DNA replication, the two parental strands separate and each acts as a template to direct the enzyme catalysed synthesis of a new complementary daughter strand following the normal base pairing rule. At least 10 different enzymes or proteins  participate in the initiation phase of replication. Three basic steps involved in DNA replication are Initiation, elongation and termination, subdivided in eight discrete steps.

< http://reasonandscience.heavenforum.org/t1849-d....es#4365 >

Initiation phase:

Step 1: Initiation begins, when DNA binds around an initiator protein complex DnaA with the goal to pull the two DNA strands apart. That  creates a number of problems. First of all, the two strands like to be together - they stick to each other just as if they had tiny magnets up and down their length. In order to pull apart the DNA you have to put energy into the system. In modern cells, a protein called DnaA  binds to a specific spot along the DNA, called single origin ( oriC ) and the protein proceeds to open up the double strand. The protein is a monomer, has motifs to bind to unique monomer sites, also they have motifs for protein-protein interaction, thus they can form clusters.   They have hydrophobic regions for helical coiling and protein–protein interactions.  Binding of the monomers to DnaA-A boxes, in ATP dependent manner (proteins have ATPase activity), leads to cooperative binding of more proteins.  This clustering of proteins on DNA makes the DNA to wrap around the proteins, which induces torsional twist and it is this left handed twist that makes DNA to melt at 13-mer region and AT rich region; perhaps the negative super helical topology in this region may further facilitate the melting of the DNA. Opening or unwinding of dsDNA ( double strand DNA )  into single stranded region is an important event in initiation.  

Single-strand binding protein (SSB)
< http://reasonandscience.heavenforum.org/t1849p1....es#4377 >

The Hexameric DnaB Helicase
< http://reasonandscience.heavenforum.org/t1849p1....es#4367 >

DnaC, and strategies for helicase recruitment and loading in bacteria
< http://reasonandscience.heavenforum.org/t1849p1....es#4371 >

Unwinding the DNA Double Helix Requires DNA Helicases,Topoisomerases, and Single- Stranded DNA Binding Proteins
< http://reasonandscience.heavenforum.org/t1849p1....es#4374 >

Step 2:  During DNA replication, the two strands of the double helix must unwind at each replication fork to expose the single strands to the enzymes responsible for copying them. Three classes of proteins with distinct functions facilitate this unwinding process: DNA helicases, topoisomerases, and single-stranded DNA binding proteins ( SSB's). Helicase ( DnaB ) now comes along. The helicase exposes a region of single-stranded DNA that must be kept open for copying to proceed. Helicase is like a snowplow; it is a molecular machine that plows down the middle of the double helix, pushing apart the two strands. this allows the polymerase and associated proteins to travel along behind it in ease and comfort.  DnaB helicase alone has no affinity for ssDNA ( single stranded DNA ) bound by SSB (single- stranded binding protein). Thus, entry of the DnaB helicase complex into the unwound oriC depends on DnaC, a  additional protein factor. DnaC helps or facilitates the helicase to be loaded onto ssDNA  at the replication fork in ATP dependent manner. The DnaB-DnaC complex forms a topologically open, three-tiered toroid.  DnaC remodels DnaB to produce a cleft in the helicase ring suitable for DNA passage. DnaC’s  fold is dispensable for DnaB loading and activation. DnaB possesses autoregulatory elements that control helicase loading and unwinding. Using energy derived from ATP hydrolysis, these proteins unwind the DNA double helix in advance of the replication fork, breaking the hydrogen bonds as they go. Helicase recruitment and loading in bacteria is a remarkable process. Following video shows how that works:

< https://www.youtube.com/watch?v....LsqMqyE >




There is a problem, though, with this setup. If you push apart two DNA strands they generally do not float around separately. If they are close to one another they will rapidly snap back and form a double strand again almost as soon as the helicase passes. Even if the strands are not near each other, a single strand will usually fold up and form hydrogen bonds with itself - in other words, a tangled mess. So it is not enough to push apart the two strands of DNA; there must be a way to keep the strands apart once they have been separated. In modern cells this job is done by single-strand binding proteins, or SBB's. As the helicase separates the strands of DNA, SSB's bind to the single stranded DNA and coats them.   . SSB's prevent DNA from reannealing. SSB's associate to form tetramers around which the DNA is wrapped in a manner that significantly compacts the single-stranded DNA. There is another difficulty in being a double helix. The unwinding associated with DNA replication would create an intolerable amount of supercoiling and possibly tangling in the rest of the DNA. It can be illustrated with a simple example. Take two interwined shoe laces and ask a friend to hold them together at each end. Now take a pencil, insert it between the strands near one end, and start pushing it down toward the other end. As you can see, shoestrings behind the pencil become melted, in the jargon of biochemistry. The shoestrings ahead of the pencil become more and more tangled. It becomes harder and harder to push the pencil forward.  Helicase and polymerase encounter the same problem with DNA. It does not matter wheter you are talking about interwined strings or interwined DNA strands. The problem of tangling is the result of the topological interconnectness of the two strands. If this problem persisted for very long in a  cell, DNA replication would grind to a halt. However, the cell contains several enzymes, called topoisomerases, to take care of the difficulty. The way in which they do so can be illustrated with a enzyme called gyrase. Gyrase binds to DNA, pulls them apart and allows a separate portion of the DNA to pass through the cut. It then reseals the cut and lets go of the DNA. This action decreases the number of twists in DNA. The parental DNA is unwound by DNA helicases and SSB (travels in 5’-3’ direction), the resulting positive super-coiling (torsional stress) is relieved by topoisomerse I and II (DNA gyrase) by inducing transient single stranded breaks.Topoisomerases are amazing enzymes. In this topic, a video shows how they function :

Topoisomerase II enzymes, amazing evidence of design
< http://reasonandscience.heavenforum.org/t2111-t....omerase >

In modern organisms, helicase, SSB, and gyrase all are required at the replication fork. Mutants in which any of them are missing are not viable - they die.

Question : Had not all three parts , the SSB binding proteins, the topoisomerase, and the helicase and the DnaC loading proteins not have to be there all at once, otherwise, nothing goes ? They might exercise their function but their own, but then they would not replicate DNA or have function in a bigger picture. Its evident that they had to come together to provide a functional whole.  What we see here are highly coordinated , goal oriented tasks with specific  movements designed to provide a specific outcome. Auto-regulation and control   that seems required beside constant energy supply through ATP enhances the difficulty to make the whole mechanism work in the right manner. All this is awe inspiring and evidences the wise guidance and intelligence required to make all this happening in the right way.

Step 3:  The enzyme DNA primase (primase, an RNA polymerase)  attaches to the DNA and synthesizes a short RNA primer to initiate synthesis of the leading strand of the first replication fork.

Elongation phase :

Step 4: In the elongation fase, DNA polymerase III extends the RNA primer made by primase.

DNA Polymerase
< http://reasonandscience.heavenforum.org/t1849p1....es#4375 >

DNA polymerase possesses separate catalytic sites for polymerization and degradation of nucleic acid strands. All DNA polymerases make DNA in 5’-3’ direction . A ring-shaped sliding clamp protein encircles the DNA double helix and binds to DNA polymerase, thereby allowing the DNA polymerase to slide along the DNA while remaining firmly attached to it. Most enzymes work by colliding with their substrate, catalyzing a reaction and dissociating from the product. If that were the case with DNA polymerase, then it would bind to DNA, add a nucleotide to the new chain that was being made, and then fall off of the chain. Then ,put the next nucleotide onto the growing end,  bind it and catalyze the addition. This same cycle would have to repeat itself a very large number of times to complete a new DNA chain. Polymerases however catalyze the addition of a nucleotide but do not fall off the DNA. Rather, they stay bound to it, until the next nucleotide comes in, and then they catalyze its addition to the chain. and they again stay bound. If it were not so, the replication process would be very slow. In the cell, polymerases stay on the DNA until their job is completed, which might be only after millions of nucleotides have been joined. This velocity is only possible because of clamp proteins. These have a ring shape. The ring can be opened up.  These clamp proteins are joined to the DNA polymerase in a intricate way, through a clamp loader protein, which has a remarkable shape similar to a human hand. It takes the clamp, like a hand with five fingers would grab it, opens it up becoming like a doughnut shape,where the whole hole in the middle is big enough to accommodate the DNA,  and then, when it is on the DNA, it positions it in a precise manner on the DNA polymerase, where it stays bound until it reaches the end of its polymerizing job. Through this ingenious process, the clamp stabilizes the DNA, making it possible to increase the speed of polymerization dramatically.  They can be seen here:

The sliding clamp and clamp loader
< http://reasonandscience.heavenforum.org/t1849p1....es#4376 >

Question : How would and could natural , unguided processes have figured out 1. the requirement of high-speed of polymerization ? How could they have figured out the right configuration and process to do so ? how could natural processes have emerged with the right proteins incrementally, with the hand-shaped clamp loader, and the precisely fitting clamp , enabling the fast process ?? Even the most intelligent scientists are still not able to imagine how this process is engineered ?  Furthermore, the process requires molecular energy in the form of ATP, and everything must fit together, and be functional. Without the clamp loader protein, the clamp could not be positioned to the polymerase enzyme, and processivity would not rise to the required speed. The whole process must also be regulated and controlled. How could that regulation have been programmed ? Trial and error ?

Several Proteins Are Required for DNA Replication at the Replication Fork
< http://reasonandscience.heavenforum.org/t1849p1....es#4398 >

The various proteins involved in DNA replication are all closely associated in one large complex, called a replisome.  
Leading strand synthesis:  On the template strand with 3’-5’ orientation, new DNA is made continuously in 5’-3’ direction towards the replication fork. The new strand that is continuously synthesized in 5’-3’ direction is the leading strand.
Lagging strand synthesis: In the lagging strand, the synthesis of DNA also elongates in a 5ʹ to 3ʹ manner, but it does so in the direction away from the replication fork. In the lagging strand, RNA primers must repeatedly initiate the synthesis of short segments of DNA; thus, the synthesis has to be discontinuous.

The Primase (DnaG) enzyme, and the primosome complex
< http://reasonandscience.heavenforum.org/t1849p1....es#4379 >

The length of these fragments in bacteria is typically 1000 to 2000 nucleotides. In eukaryotes, the fragments are shorter—100 to 200 nucleotides. Each fragment contains a short RNA primer at the 5ʹ end, which is made by primase. The remainder of the fragment is a strand of DNA made by DNA polymerase III. The DNA fragments made in this manner are known as Okazaki fragments. To complete the synthesis of Okazaki fragments within the lagging strand, three additional events must occur: removal of the RNA primers, synthesis of DNA in the area where the primers have been removed, and the covalent attachment of adjacent fragments of DNA. In E. coli, the RNA primers are removed by the action of DNA polymerase I. This enzyme has a 5ʹ to 3ʹ exonuclease activity, which means that DNA polymerase I digests away the RNA primers in a 5ʹ to 3ʹ direction, leaving a vacant area. DNA polymerase I then synthesizes DNA to fill in this region. It uses the 3ʹ end of an adjacent Okazaki fragment as a primer. , DNA polymerase I would remove the RNA primer from the first Okazaki fragment and then synthesize DNA in the vacant region by attaching nucleotides to the 3ʹ end of the second Okazaki fragment. After the gap has been completely filled in, a covalent bond is still missing between the last nucleotide added by DNA polymerase I and the adjacent DNA strand that had been previously made by DNA polymerase III. To the left of the origin, the top strand is made continuously, whereas to the right of the origin it is made in Okazaki fragments. By comparison, the synthesis of the bottom strand is just the opposite. To the left of the origin it is made in Okazaki fragments and to the right of the origin the synthesis is continuous. Finally the two ends of the fragment have to be joined together; this is the job of an enzyme called DNA ligase.  After the completion of one Okazaki fragment , the equipment has to be released, the clamp has to let go, and a new clamp has to be loaded at the beginning of the next fragment. Clearly the formation and control of the replication fork is an enormously complex process.

Step 5:   After DNA synthesis by DNA pol III, DNA polymerase I uses its 5’-3’ exonuclease activity to remove the RNA primer and fills the gaps with new DNA. In the next step, finally DNA ligase joins the ends of the DNA fragments together.  As the replisome moves along the DNA in the direction of the replication fork, it must accommodate the fact that DNA is being synthesized in opposite directions along the template on the two stands. Picture above  provides a schematic model illustrating how this might be accomplished by folding the lagging strand template into a loop.Creating such a loop allows the DNA polymerase molecules on both the leading and lagging strands to move in the same physical direction, even though the two template strands are oriented with opposite polarity. The replisome faces special challenges as it makes new DNA at rates that can approach 1,000 nucleotides per second. Unlike the machines that make proteins and RNA, which work relatively sluggishly and in a linear fashion, the replisome must simultaneously copy two strands of DNA that are aligned in opposite directions (5ʹ to 3ʹ and 3ʹ to 5ʹ). Replisome chemistry obeys two rules.


Questions: How did they arise with that cabability to " obey two rules " ?  Suppose a primitive polymerase were duplicated and somehow started to replicate the second strand in the opposite direction while remaining attached to the first strand -  how could that change have been directed , and why should that feat have happened randomly ?




The DNA polymerase holoenzyme alone would not be able to duplicate the long DNA faithfully. Tests have shown that Polymerase III alone gets stuck. Furthermore, Polymerase III is not a simple enzyme. Its rather three enzymes in one. Beside replicating DNA, it can also degrade DNA in two different ways. It does so by three different, discrete regions of the molecule. The exonuclease activity plays a critical role in replication. It allows the enzyme to proofread the new DNA and cut out any mistakes it has made. Although the polymerase reads the sequence of the old DNA to produce a new DNA, it turns out that simple base bairing allows about one mistake per thousand base pairs copied. Proofreading reduces errors to about one mistake in a million base pairs. The question is if wheter  a proofreading exonuclease and other DNA repair mechanisms had to be present in the very first cell.

Eigen’s theory revealed the existence of the fundamental limit on the fidelity of replication (the Eigen threshold): If the product of the error (mutation) rate and the information capacity (genome size) is below the Eigen threshold, there will be stable inheritance and hence evolution; however, if it is above the threshold, the mutational meltdown and extinction become inevitable (Eigen, 1971). The Eigen threshold lies somewhere between 1 and 10 mutations per round of replication (Tejero, et al., 2011) regardless of the exact value, staying above the threshold fidelity is required for sustainable replication and so is a prerequisite for the start of biological evolution. Indeed, the very origin of the first organisms presents at least an appearance of a paradox because a certain minimum level of complexity is required to make self-replication possible at all; high-fidelity replication requires additional functionalities that need even more information to be encoded (Penny, 2005). The crucial question in the study of the origin of life is how the Darwin-Eigen cycle started—how was the minimum complexity that is required to achieve the minimally acceptable replication fidelity attained? In even the simplest modern systems, such as RNA viruses with the replication fidelity of only about 10^3 and viroids that replicate with the lowest fidelity among the known replicons (about 10^2; Gago, et al., 2009), replication is catalyzed by complex protein polymerases. The replicase itself is produced by translation of the respective mRNA(s), which is mediated by the immensely complex ribosomal apparatus. Hence, the dramatic paradox of the origin of life is that, to attain the minimum complexity required for a biological system to start on the Darwin-Eigen spiral, a system of a far greater complexity appears to be required. How such a system could evolve is a  puzzle that defeats conventional evolutionary thinking, all of which is about biological systems moving along the spiral; the solution is bound to be unusual.

DNA damage and repair
< http://reasonandscience.heavenforum.org/t2043-d....+repair >
< http://reasonandscience.heavenforum.org/t1849p3....es#4401 >

Replication forks may stall frequently and require some form of repair to allow completion of chromosomal duplication. Failure to solve these replicative problems comes at a high price, with the consequences being genome instability, cell death and, in higher organisms, cancer. Replication fork repair and hence reloading of DnaB may be needed away from oriC at any point within the chromosome and at any stage during chromosomal duplication. The potentially catastrophic effects of uncontrolled initiation of chromosomal duplication on genome stability suggests that replication restart must be regulated as tightly as DnaA-directed replication initiation at oriC. This implies reloading of DnaB must occur only on ssDNA at repaired forks or D-loops rather than onto other regions of ssDNA, such as those created by blocks to lagging strand synthesis.Thus an alternative replication initiator protein, PriA helicase, is utilized during replication restart to reload DnaB back onto the chromosome

Question: Could the first cell, with its required complement of genes coded for by DNA, have successfully reproduced for a significant number of generations without a proofreading function ? A further question is how the function of synthesis of the lagging strand could have arisen, and the machinery to do so. That is, the Primosome, and the function of Polymerase I to remove the short peaces of RNA that the cell uses to prime replication, allowing the polymerase III function to fill the gap. These functions all require precise regulation, and coordinated functional machine-like steps. These are all complex, advanced functions and had to be present right from the beginning. How could this complex machinery have emerged in a gradual manner ? the Primosome had to be fully functional, otherwise polymerisation could not have started, since a prime sequence is required.

Step 6: Finally DNA ligase joins the ends of the DNA fragments together.

Termination phase:

Termination of DNA replication
< http://reasonandscience.heavenforum.org/t1849p1....es#4399 >

Step 7: The two replication forks meet ~ 180  degree opposite to ori C, as DNA is circular in prokaryotes. Around this region there are several terminator sites which arrest the movement of forks by binding to the tus gene product, an inhibitor of helicase (Dna B).
Step 8: Once replication is complete, the two double stranded circular DNA molecules (daughter strands) remain interlinked. Topoisomerase II makes double stranded cuts to unlink these molecules.

According to mainstream scientific papers, the following twenty protein and protein complexes are essential for prokaryotic DNA replication. Each one mentioned below. They cannot be reduced. If one is missing, DNA replication cannot occur:

Pre-replication complex  Formation of the pre-RC is required for DNA replication to occur
DnaA The crucial component in the initiation process is the DnaA protein
DiaA this novel protein plays an important role in regulating the initiation of chromosomal replication via direct interactions with the DnaA initiator.
DAM methylase  It’s gene expression requires full methylation of GATC at its promoter region.
DnaB helicase Helicases are essential enzymes for DNA replication, a fundamental process in all living organisms.
DnaC Loading of the DnaB helicase is the key step in replication initiation.  DnaC is essential for replication in vitro and in vivo.
HU-proteins  HU protein is required for proper synchrony of replication initiation
SSB Single-stranded binding proteins  Single-stranded DNA binding proteins are essential for the sequestration and processing of single-stranded DNA. 6
SSBs from the OB domain family play an essential role in the maintenance of genome stability, functioning in DNA replication, the repair of damaged DNA, the activation of cell cycle checkpoints, and in telomere maintenance. SSB proteins play an essential role in DNA metabolism by protecting single-stranded DNA and by mediating several important protein–protein interactions. 7
Hexameric DNA helicases DNA helicases are essential during DNA replication because they separate double-stranded DNA into single strands allowing each strand to be copied.
DNA polymerase I and III DNA polymerase 3 is essential for the replication of the leading and the lagging strands whereas DNA polymerase 1 is essential for removing of the RNA primers from the fragments and replacing it with the required nucleotides.
DnaG Primases  They are essential for the initiation of such phenomena because DNA polymerases are incapable of de novo synthesis and can only elongate existing strands
Topoisomerases  are essential in the separation of entangled daughter strands during replication. This function is believed to be performed by topoisomerase II in eukaryotes and by topoisomerase IV in prokaryotes. Failure to separate these strands leads to cell death.
Sliding clamp and clamp loader the clamp loader is a crucial aspect of the DNA replication machinery.  Sliding clamps are DNA-tracking platforms that are essential for processive DNA replication in all living organisms
Primase (DnaG) Primases are essential RNA polymerases required for the initiation of DNA replication, lagging strand synthesis and replication restart.  They are essential for the initiation of such phenomena because DNA polymerases are incapable of de novo synthesis and can only elongate existing strands.
RTP-Ter complex Ter sequences would not seem to be essential, but they may prevent overreplication by one fork in the event that the other is delayed or halted by an encounter with DNA damage or some other obstacle
Ribonuclease H  RNase H1 plays essential roles in generating and clearing RNAs that act as primers of DNA replication.
Replication restart primosome Replication restart primosome is a complex dynamic system that is essential for bacterial survival.
DNA repair:
RecQ helicase  In prokaryotes RecQ is necessary for plasmid recombination and DNA repair from UV-light, free radicals, and alkylating agents.
RecJ nuclease the repair machinery must be designed to act on a variety of heterogeneous DNA break sites.

I do not know of any scientific paper  that explains in a detailed manner how DNA replication de novo or any of its parts might have emerged in a naturalistic manner, without involving intelligence. The systems responsible for DNA replication are well beyond the explanatory power of unguided natural processes without guiding intelligence involved. Indeed, machinery of the complexity and sophistication of that described above is, is in my view best explained through a intelligent designer.

Precisely BECAUSE WE KNOW that each of the described and mentioned parts is indispensable, it had to arise all at once. We know of intelligence being able to project, plan and make such a motor-like system based on lots of information , and it could not have emerged through evolution ( even less so because evolution depends on dna replication being in place ) we can infer rationally design as the best explanation. Chance is no reasonable option to explain the origin of DNA replication since the individual parts would have no function by their own, and there is no reason why matter aleatory-like would group itself in such highly organized and complex machine-like system.

1) < http://www.weizmann.ac.il/plants....ean.pdf >
2) < http://cshperspectives.cshlp.org/content....16.full >
3) < https://en.wikipedia.org/wiki....ication >
4) < http://www.biochem.umd.edu/biochem....ein.htm >
5) < http://www.nature.com/nsmb....56.html >
6) < http://www.biomedcentral.com/1471-21....9 >
7) < http://www.ncbi.nlm.nih.gov/pmc....3632105 >
8 ) Meyer, signature of the cell, page 111
9 ) < http://journal.frontiersin.org/article....full#F1 >
10 ) < http://creationsafaris.com/epoi_c0....c08.htm >
11) < http://creationsafaris.com/ar_srds....rds.htm >
12) < http://www.ncbi.nlm.nih.gov/books....NBK6360 >
13) from the book: The Logic of Chance: The Nature and Origin of Biological Evolution By Eugene V. Koonin, page 266
14) < https://www-als.lbl.gov/index.p....on.html >
15) < http://www.nature.com/nature....85.html >
16) < http://ethos.bl.uk/OrderDe.....604184 >
Posted by: NoName on Dec. 01 2015,11:19

Weren't you going away?

NOTHING you have presented is anything other than an argument from incredulity.

None of the points you raise are new, unknown to researchers, or fatally problematic for naturalism.

Get over it.
Posted by: OgreMkV on Dec. 01 2015,11:55



---------------------QUOTE-------------------
DNA replication, and its mind boggling nano technology  that defies naturalistic explanations
---------------------QUOTE-------------------



That is incorrect. Therefore everything that follows is meaningless.

You need to read research papers instead of creationists.

Let me ask you a question (not that you'll answer).

If it could be proven that someone lied to you, multiple times, would you still use their arguments in discussions? Would you answer be different if you disagreed with their position?
Posted by: Richardthughes on Dec. 01 2015,13:12

I see the liar is back, having lied again.
Posted by: rossum on Dec. 01 2015,15:08

Quote (Otangelo @ Dec. 01 2015,11:00)
DNA replication, and its mind boggling nano technology  that defies naturalistic explanations
---------------------QUOTE-------------------


Rearrange the following words to make a well known phrase or saying: GALLOP GISH.
Posted by: JohnW on Dec. 01 2015,15:36

Quote (rossum @ Dec. 01 2015,13:08)
Quote (Otangelo @ Dec. 01 2015,11:00)
DNA replication, and its mind boggling nano technology  that defies naturalistic explanations
---------------------QUOTE-------------------


Rearrange the following words to make a well known phrase or saying: GALLOP GISH.
---------------------QUOTE-------------------


He could have saved a lot of typing by posting a picture of a fishing reel.
Posted by: NoName on Dec. 01 2015,15:54

He should shuffle a standard deck of cards, deal them out in a row, and contemplate the astounding improbability of exactly that sequence occurring.
He should take special note of pairs, runs, or other 'winning' series of cards.
Impossible!  Clearly, no naturalistic explanation is possible for this precise sequence of cards!
Posted by: ChemiCat on Dec. 02 2015,04:06



---------------------QUOTE-------------------

Quote (Otangelo @ Dec. 01 2015,11:00)
DNA replication, and its mind boggling nano technology  that defies naturalistic explanations.

---------------------QUOTE-------------------



Please, Trollangelo, point to anywhere in your copypasta that cannot be explained by the laws of physics and chemistry.

Better yet, point to somewhere in the DNA molecule and show what your miracle worker (sorry, Intelligent Designer) did, when and how.
With evidence and full chemical analysis in your own words.

Waiting..
Posted by: Cubist on Dec. 02 2015,06:47

Quote (Otangelo @ Nov. 17 2015,03:48)
 
Quote (Cubist @ Nov. 17 2015,03:10)

---------------------QUOTE-------------------


   

---------------------QUOTE-------------------
Fortunately, the fossil record here in the RealWorld does contain various transitional fossils, so your question doesn't arise.
---------------------QUOTE-------------------



I think there is enough evidence to say, the fossil record does NOT confirm the ToE…
---------------------QUOTE-------------------


That's nice. By all means, think what you like. The mere fact that what you like to think has little-to-no bearing upon reality, doesn't bar you from thinking what you like.

In an earlier comment, you asked the question:


---------------------QUOTE-------------------
If there are no transitional fossils in the fossil record, how would you confirm  the ToE in regard of paleontology?
---------------------QUOTE-------------------


This question presumes, as a hypothetical, that there aren't any transitional fossils in the fossil record. Do you understand that your hypothetical is invalid—that the fossil record does, in fact, contain some transitional fossils—and that, therefore, my response that the fossil record does, indeed contain some transitional fossils, is a valid answer to the question it was written in reply to?



---------------------QUOTE-------------------
Did Darwin also predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found?
---------------------QUOTE-------------------


I have no idea what Darwin may have predicted, or failed to predict, as regards specific features of the fossil record. If it does indeed turn out to be the case that Darwin made some predictions about specific features of the fossil record, and those (hypothetical?) predictions of Darwin's turn out to have been wrong, what of it?



---------------------QUOTE-------------------
 

---------------------QUOTE-------------------
Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Once its granted that non-intelligence mechanisms are unable to create information-rich systems, your question is moot.
---------------------QUOTE-------------------


Sure: If one grants that "non-intelligence mechanisms are unable to create information-rich systems", then my question does, indeed, become moot.

If.

As it happens, I do not grant that "non-intelligence mechanisms are unable to create information-rich systems".



---------------------QUOTE-------------------
We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.
---------------------QUOTE-------------------


That's nice. And if I had written anything in the general neighhborhood of do you have evidence for the existence of "intelligence outside the human realm", it would even be a cogent response.

However, I did not ask you for evidence that "intelligent agents" other than human beings exist. Rather, I asked you for evidence that "intelligent agents" other than human beings have produced "information-rich systems".

I ask again: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

 
Quote (Otangelo @ Nov. 16 2015,19:03)
 
Quote (Cubist @ Nov. 16 2015,18:51)

---------------------QUOTE-------------------


   

---------------------QUOTE-------------------
What does "new information" look like? Given an arbitrary string of nucleotides, and a mutation which alters that string of nucleotides, how can you tell whether or not the post-mutation version of that string contains any "new" information?
---------------------QUOTE-------------------


< http://reasonandscience.heavenforum.org/t2062-p....roteins >

Few of the many  possible polypeptide chains will be useful to Cells
Paul Davies puts it more graphically: ‘Making a protein simply by injecting energy is rather like exploding a stick of dynamite under a pile of bricks and expecting it to form a house…"
---------------------QUOTE-------------------


That's nice. It's nothing even vaguely approximating an answer to my question, but it's nice.



---------------------QUOTE-------------------
Bruce Alberts writes in Molecular biology of the cell :

Since each of the 20 amino acids is chemically distinct and each can, in principle, occur at any position in a protein chain, there are 20 x 20 x 20 x 20 = 160,000 different possible polypeptide chains four amino acids long…
---------------------QUOTE-------------------


Again: That's not an answer to my question, but it's nice.

It's a simple enough question: What does "new information" look like? I am not asking you to define what "new information" is, nor am I even asking you to justify your assumption that 'new information" exists; I am, instead, asking you how one would recognize this "new information" stuff if one actually saw it. Would you care to answer the question I actually wrote, as opposed to… some question you wish I'd written, or some question you imagine me to have written?
Posted by: Otangelo on Dec. 16 2015,16:59

Factory and machine planning and design, and what it tells us about cell factories and molecular machines

< http://reasonandscience.heavenforum.org/t2245-f....achines >

Some steps to consider in regard of factory planning, design and operation

All text in red requires INTELLIGENCE :

Choosing Manufacturing   and Factory location
Selecting Morphology of Factory Types
Factory planning
Factory design
Information management within factory planning and design
Factory layout planning
Equipment supply
Process planning
Production Planning and Control
establishing various internal and external  Communication networks
Establishing Quantity and Variant Flexibility
The planning of either a rigid or flexible volume concept depending of what is required
Establishing Networking and Cooperation
Establishing Modular organization
Size and internal factory space organization, compartmentalization and layout
Planning of recycling Economy
Waste management
Controlled factory implosion programming

All these procedures and operational steps are required and implemented in human factories, and so in biological cells which operate like factories. It takes a lot of faith to believe, human factories require intelligence, but cells, far more complex and elaborated, do not require intelligence to make them, and intelligent programming to work in a self sustaining and self replicating manner, and to self disctruct, when required.  

Molecular machines:

The most complex molecular machines are proteins found within cells. 1 These include motor proteins, such as myosin, which is responsible for muscle contraction, kinesin, which moves cargo inside cells away from the nucleus along microtubules, and dynein, which produces the axonemal beating of motile cilia and flagella. These proteins and their nanoscale dynamics are far more complex than any molecular machines that have yet been artificially constructed.

Probably the most significant biological machine known is the ribosome. Other important examples include ciliary mobility. A high-level-abstraction summary is that, "[i]n effect, the [motile cilium] is a nanomachine composed of perhaps over 600 proteins in molecular complexes, many of which also function independently as nanomachines." Flexible linker domains allow the connecting protein domains to recruit their binding partners and induce long-range allostery via protein domain dynamics.

Engineering design process

The engineering design process is a methodical series of steps that engineers use in creating functional products and processes. 2

All text in red requires INTELLIGENCE  

locating information and research
feasibility study
evaluation and analysis of the potential of a proposed project
process of decision making. Outlines and analyses alternatives or methods of achieving the desired outcome
feasibility report is generated
determine whether the engineer's project can proceed into the design phase
the project needs to be based on an achievable idea
concept study (conceptualization, conceptual engineering
project planning
solutions must be identified
ideation, the mental process by which ideas are generated
morphological chart - independent design characteristics are listed in a chart, and different engineering solutions are proposed for each solution. Normally, a preliminary sketch and short report accompany the morphological chart.
the engineer imagines him or herself as the item and asks, "What would I do if I were the system?"
Synthesis is the process of taking the element of the concept and arranging them in the proper way.
Synthesis creative process is present in every design.
thinking of different ideas, typically as part of a small group, and adopting these ideas in some form as a solution to the problem
Establishing design requirements is one of the most important elements in the design process
feasibility analysis
Some design requirements include hardware and software parameters, maintainability, availability, and testability
the overall system configuration is defined, and schematics, diagrams, and layouts of the project will provide early project configuration.
detailed design and optimization
the preliminary design focuses on creating the general framework to build the project on.
further elaborate each aspect of the project by complete description through solid modeling,drawings as well as specifications.
Some of the said specifications include:
Operating parameters
Operating and nonoperating environmental stimuli
Test requirements
External dimensions
Maintenance and testability provisions
Materials requirements
Reliability requirements
External surface treatment
Design life
considering packaging requirements and implant them
External marking
production planning and tool design
planning how to mass-produce the project and which tools should be used in the manufacturing of the part.
selecting the material, selection of the production processes, determination of the sequence of operations, and selection of tools, such as jigs, fixtures, metal cutting and metal forming tools.
start of manufactoring
the machines must be inspected regularly to make sure that they do not break down and slow production

Someone can object and say, that human invented machines do nor replicate, and therefor the comparison is invalid. Fact is however, that replication adds further complexity , since humans have not been able to construct self replicating machines in large scale. This is imho what every living cell is able and programmed to do. In order to so so, extremely complex celluar mechanisms are required, like DNA replication.

1) < https://en.wikipedia.org/wiki....machine >
2) < https://en.wikipedia.org/wiki....process >
Posted by: NoName on Dec. 16 2015,17:12

Ah, more drive-by irrelevancy from the master of incomprehension.
Posted by: Glen Davidson on Dec. 16 2015,17:53



---------------------QUOTE-------------------

Someone can object and say, that human invented machines do nor replicate, and therefor the comparison is invalid. Fact is however, that replication adds further complexity , since humans have not been able to construct self replicating machines in large scale.
---------------------QUOTE-------------------



So the "analogy" falls apart at that point.  Or would, if there were any real analogy in the first place.

"See, it's unlike things that we know were designed.  If that isn't proof of design, what could be?"

By the way, deal with the fact that the information isn't distributed according to required function, but according to heredity.  Sort of like we'd expect of unintelligent evolution, not of some supremely intelligent being capable of handing extreme complexity.

But you won't deal with that, any more than you'll come up with an honest analogy.

Glen Davidson
Posted by: Occam's Aftershave on Dec. 16 2015,18:04

Quote (Otangelo @ Dec. 16 2015,16:59)
Factory and machine planning and design, and what it tells us about cell factories and molecular machines
---------------------QUOTE-------------------


Hey, the serial plagiarizer's back!
Posted by: OgreMkV on Dec. 16 2015,18:06

Poor guy is too dumb to realize that nothing on his list requires intelligence... since none of it is red.

Of course, he's partially right... some of that requires intelligence. But that's meaningless to the idea of intelligent design, since there is no intelligence that can perform the requirements for evolution.

That's all you have to do Otangelo. Provide the designer. Provide the designer that has built the universe and designed and constructed all the living things in said universe.

Everything else you (and all ID proponents) is meaningless garbage. You REQUIRE a designer, yet you are totally unable to even describe said designer, much less its actual capabilities.
Posted by: fnxtr on Dec. 16 2015,23:39

Huh. What can we conclude from the return after a two-week absence.

1. Forgot he had flounced.
2. Slow healer.
3. Attention whore.
4. Meds need adjusting.
5....???
Posted by: MagickMan on Dec. 17 2015,05:24

Quote (fnxtr @ Dec. 16 2015,23:39)
Huh. What can we conclude from the return after a two-week absence.

1. Forgot he had flounced.
2. Slow healer.
3. Attention whore.
4. Meds need adjusting.
5....???
---------------------QUOTE-------------------



5. Prophet?
Posted by: ChemiCat on Dec. 17 2015,06:13



---------------------QUOTE-------------------
Factory and machine planning and design, and what it tells us about cell factories and molecular machines [rubbishy analogy redacted]

---------------------QUOTE-------------------



Except that cell structures don't have forward planning or design, just the laws of physics and chemistry.
Posted by: Cubist on Dec. 19 2015,21:01

Quote (Otangelo @ Dec. 16 2015,16:59)
Factory and machine planning and design, and what it tells us about cell factories and molecular machines…
---------------------QUOTE-------------------


Hello, Otangelo! I can't help but notice that you have, once again, neglected to answer the questions I had for you.

Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

I am not asking you to provide evidence that "intelligent agents" other than human beings exist. Rather, I am asking you to provide evidence that "intelligent agents" other than human beings have produced "information-rich systems".

Question: What does "new information" look like?

Given an arbitrary string of nucleotides, and a mutation which alters that string of nucleotides, how can you tell whether or not the post-mutation version of that string contains any "new" information?

I am not asking you to define what "new information" is. I am not asking you to justify your assumption that "new information" exists. I am, instead, asking you how one would recognize this "new information" stuff if one actually saw it.

I look forward to reading your answers to my questions.
Posted by: ChemiCat on Dec. 21 2015,04:31



---------------------QUOTE-------------------
Hello, Otangelo! I can't help but notice that you have, once again, neglected to answer the questions[...]
---------------------QUOTE-------------------



Did you expect a testable, falsifiable answer from Trollangelo, Cubist? Don't hold your breath.

The first rule of Creationist Club? Don't answer questions about Creationist Club!
Posted by: Cubist on Dec. 21 2015,04:39

Quote (ChemiCat @ Dec. 21 2015,04:31)
 

---------------------QUOTE-------------------
Hello, Otangelo! I can't help but notice that you have, once again, neglected to answer the questions[...]
---------------------QUOTE-------------------


Did you expect a testable, falsifiable answer from Trollangelo, Cubist? Don't hold your breath.

The first rule of Creationist Club? Don't answer questions about Creationist Club!
---------------------QUOTE-------------------


You are, of course, correct. I am merely following in the footsteps of Lenny Flank; as he liked to point out, his oft-repeated questions did their job regardless of whether or not their Creationist target responded to them in any way.
Posted by: ChemiCat on Dec. 21 2015,15:10

Hi Cubist

Not being American I had to look up "Lenny Flank". I now see where you are coming from.
Posted by: Cubist on Dec. 21 2015,19:42

Quote (ChemiCat @ Dec. 21 2015,15:10)
Hi Cubist

Not being American I had to look up "Lenny Flank". I now see where you are coming from.
---------------------QUOTE-------------------


In addition to not being American, you're also relatively new to AtBC. I say "relatively new" because while Lenny hasn't posted much here in the past few years, there was a time when he was very active on this forum, and if you'd been around in those days, you would surely have remembered Lenny.

Try googling on [ site:www.antievolution.org "lenny flank" ]. I think you may enjoy what you find.
Posted by: ChemiCat on Dec. 23 2015,03:27

Thanks Cubist

I'm working my way through them.
Posted by: Otangelo on Jan. 09 2016,18:45

Quote (Cubist @ Dec. 19 2015,21:01)
[quote=Otangelo,Dec. 16 2015,16:59]

Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
Posted by: Otangelo on Jan. 09 2016,18:46

ATP synthases: molecular nano power plants

< http://reasonandscience.heavenforum.org/t1439p1....se#4550 >

From Marcos Eberlin's excellent book : Life and the Universe by Intelligent Design

< https://www.widbook.com/ebook....-design >

ATP synthase motor. The smallest and most efficient power plant on this planet powering the production of energy of Life. One of the essential requirements for Life is energy. Living organisms require large amounts of energy, and the molecule that stores and releases energy of life is adenosine triphosphate represented by the acronym ATP (Figure 2). And then there is a need for a huge amount of this molecule. And to synthesize it with efficiency and optimization, Life requires adenosine - a heterocyclic nitrogenous base, a ribose sugar molecule (one sugar) and three phosphates. Note the difficulty here for any unguided process  you "want to imagine" to form such a molecule. Sugars are formed by formaldehyde - essentially - a highly reactive molecule. Sugars are reactive and unstable, and reaction media that allow synthesis of sugars are incompatible with the means of synthesis of nitrogenous bases. Anions phosphate precipitate in the presence of metal ions such as Ca2 +, for example. And links between phosphate anions involve slow reactions, and need to be catalyzed by enzymes. Therefore, this molecule synthesis routes give a hell lot of work that only the machinery of life can perform. And to make matters worse for the task, the ATP molecule is unstable and hydrolyzes easily in water, and is exothermical (gives off heat). And then to establish the third phosphate connection, which requires most energy,  life must go against the kinetics and enthalpy and so uses the only way to overcome such cumber thermodynamic: a machine, and an incredible nanomachine: ATP synthase

The ATP molecule - a chemical masterpiece- to generate the energy of Life.
The ATP synthase is the name given to a true nanomolecular "power plant"  made by turbines and protein reactors, that in a spectacular and artfully crafted way, synthesizes - and reverse the synthesis - the molecule of ATP (adenosine triphosphate) from ADP (adenosine bifosfate) and anions of inorganic phosphate in the cells (Figure 1). A nanomolecular marvel of technology, chemistry and mechanical engineering mega intelligent.

Carved like a work of chemical art , beautiful and awe-inspiring - it appears to challenge failed theories - ATP synthase has the smallest engine known in this universe. And this engine, professional thing, it performs like  a perfect and finely tuned ballet,  a synchronized set of thousands and thousands of inter- and intramolecular interactions. This plant also has input channels and output protons also artfully constructed with extreme skill and sophistication and astonishing precision, and nanometrical distances and forces set and finely calculated for the purpose of building a nanomolecular plant maximized to produce  chemical energy.

With a nanomolecular turbine powered by protons and which transmits its movement through a molecular rotor, and channels that direct the movement of these protons - kind of molecular slides to the water parks, the ATP synthase has fascinated many electrical and  chemical engineers primarily - for its perfection in performing reactions and producing energy. In it, we also have "molecular pins" that attach the rotor to the chemical reactor (F1 unit) catalyst, which accommodates within itself the reagents and literally confines them and "Squeezes", so as to accelerate the desired chemical reaction. And that tightens and loosens are all promoted by a synchronized spin - one opens and closes nanometrically set - governed by a molecular piece of oval shape crankshaft type in camshafts, those that man added to their combustion engines
A fantastic chemical reaction then occurs in the ATP synthase: ADP + ATP → PO4-. And the whole machinery of ATP synthase is there fitted perfectly in the cell wall of the inner mitochondrial membrane , that hyper mega high tech " cell ship" . And all with homochiral molecules, AA type lefthanded only.

The ATP synthase is therefore a show of sophistication, specification and aperiodicity, and hyper mega irreducible complexity . Disconnect one of its components, disturb one of its forms, replace some of your AA position, and there are thousands and thousands of them, and the system loses function altogether. Try to build it slowly, step by step, by mindless unguided processes, will it be possible? Viable at the molecular level? Where would the energy come from to build it, if it is the energy provider of life? Remember though that the energy that produces ATP synthase is essential to life, virtually for all forms of life. And it is power required  at the right time at the right flow! The structure of ATP synthase is so ingenious that its elucidation earned a Nobel Prize in 1997, as the enormity and significance of the feat. Our cells contain thousands of these nanomotors embedded in their mitochondria, and installed in their membranes. And these nanomotors - nano power plants - are about 200,000 times smaller than a pinhead. And that nanomotor is there for the sole purpose of forcing the occurrence of a single reaction: the third phosphate bond in ADP "crushing it" along with phosphate to form ATP
The ATP molecules are used in key processes in the cell which require energy, which is released , then regenerating ADP and a free phosphate. The energy produced is directed, for example in humans, for contraction of muscles, beating of the heart and processes in the brain, whereas the reaction products are economically and wisely recycled . In the center of the ATP synthase is a small rotor which rotates around 100 revolutions per second, synthesizing 3 ATP molecules per revolution, or 300 molecules of ATP per second! Only for our thinking and walking, we recycle proportional to our body weight (80 kg) of ATP every day. Each enzyme in the ATP synthase is composed of 31 other proteins that, in turn, are made of thousands of amino acids precisely arranged. Remove any of the 31 proteins and the motor becomes simply useless.
The ATP synthase, along with the Scourge, is one of the most "striking" examples of mega irreducible complexity we see around the corner in life. And there's more: all the immense set of genetic information and RNA, plus dozens of proteins needed to build the ATP synthase, are in total even more irreducibly complex than the ATP synthase itself. The car factory is -by principle - more irreducibly complex than the car it manufactures.

Described in more details chemical and biochemical (insane task), the ATP synthase is a protein complex consisting of several proteins that fit perfectly synchronously, and - in a synchronized chemical ballet - in the form of a "mushroom". This nano mill is in thousands "installed" on the inner membrane of the mitochondria (Figure 6). There are two main components: (1) head - a spherical area comprised by the catalytic portion of the enzyme known as Factor connection 1, or simply F1, which measures about 90 Å in diameter; and (2) basic - called F0 - fixing the whole to the inner membrane of mitochondria. High resolution SEM micrographs revealed that the head (1) and the bottom part (2) are joined by a central rod - formed by subunits F1 and F0 - relatively narrow (45) which is connected to a peripheral button 90-100 Å in diameter. A mitochondria located in human liver cells has about 15,000 copies of ATP synthase

The most efficient way to conduct a chemical reaction known in this universe, "the hard way"! In the ATP synthase, a protein complex jointly embraces a ADP difosfate  molecule and one anion phosphate (Pi) providing energy and forcing them "mechanically" by reacting . Reaction occurred "by force", the engine spins at 8,500 RPM and the protein complex "opens" then its arms, by the action of the crankshaft driven by an engine and rotor, and releases the product, the tri-phosphate ATP molecule. The ATP synthase is the smallest rotary engine known today. To give you an idea of its tiny size, in a millimeter, can be grouped, side by side, approximately about 100 000 ATP synthases. This engine is driven not by power, but by "proton energy"; that is, by a countercurrent flow of protons.
The ATP synthase would then be the headless product of evolution, not guided or inexcusable evidence of intelligent design? Remember that without energy there is no life, and in life there is no power without ATP, and in life there is no ATP without ATP synthase. The ATP synthase is thus more one of the great "chicken-egg" dilemmas  of Life! For all biochemical processes that coordinate the functioning and structure need to be supplied ATP synthase molecule itself produces: ATP. About 14 trillion body cells at this point are conducting this biochemical reaction via ATP synthase, in about a million times per minute through mitochondria.
To give you even more ingenius details of this fabulous machine, note that the F1 region of ATP synthase (F1-ATPase) is made up of six protein units, and divided into three pairs of active sites. These units form regions which provide "chemical hugs" through a docking site for ADP and phosphate. An anchoring (or stator) is curved on the outside of the structure in order to fix the base (F0) to the head (F1). Three molecules of ATP are formed for each complete shaft rotation. Chemical engineering of ATP synthase is  shown - there's no denying - intelligent and mega efficient . The complex has a spiral shaft, called "Y", which is the circumference between F0 and F1 and allows the connection of one region to the other, like a pen within a cardboard tube. The intelligent design of this nanomolecular machine causes the flow of protons, across the membrane, turn the shaft and the base. So it's not turning the base and the axis "attracts" the protons, as originally thought, but it is the flow of protons turning the engine. The turning occurs when the central axis (y) puts pressure on the inner walls of the six proteins in the F1 region thus result in a smooth structural deformation with consequent reformation alternately. My vote here for the "pinnacle" of chemical engineering in the nanomolecular this universe. Heck, what a  genius mind that knew Chemistry as anyone else, to come up with something like that!

Note further that the F0 subunit, which is fixed on the membrane of mitochondria, rotates clockwise. Laterally annexed the F0, is another input channel subunit which serves as the channel where the protons will be directed to the engine. The rotation is synchronized around its own axis and provides that individually protons enter and exit, respectively. Since the protons are attracted to the input channel, they connect to F0, and follow  nearly a complete rotation, they then are  conveyed to an output channel present on the same side frame attached to where F0 enters. The subunit F1 (F1 ATPase) is that attracts molecules adenosine diphosphate (ADP) and phosphate (Pi), which are released together with ATP.

3D view at the molecular level of ATP synthase: nano power plant vital to life on this planet.

But there is even more wonder in the ATP synthase: the rotational mechanism used for F0 is performed routinely when there is a high concentration of protons in the cytosol and a low concentration of ATP inside the mitochondria. But when these concentrations are reversed, the enzyme " understands biochemically" that its function was successful, and if it continues, will promote serious imbalance in the cell. Control is everything! In this situation, the ATP synthase "thinks and reacts," and and makes its F0 turn now in the opposite direction, and the mechanism is reversed, and the proton exit channel now becomes the input channel, and the  protons inside the organelle return to the cytosol. ATP molecules are now converted to ADP and phosphate free, in a chemical "retro-reaction" . A chemical balance nano-mechanically directed and controlled! Since you know this fantastic nanomachine a little better  at the molecular level, , what do you think: chance or design?

Referências e notas
1. "ATP synthase — a marvellous rotary engine of the cell" M. Yoshida, E. Muneyuki, T. Hisabori, Nature Reviews Molecular Cell Biology 2001, 2, 669.
2. Paul D. Boyer. The ATP Synthase - a splendid molecular machine. Annual Review of Biochemistry, Vol. 66: 717-749 (July 1997)
Posted by: OgreMkV on Jan. 09 2016,22:41

Quote (Otangelo @ Jan. 09 2016,18:45)
[quote=Cubist,Dec. 19 2015,21:01]
Quote (Otangelo @ Dec. 16 2015,16:59)


Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
---------------------QUOTE-------------------


Yes.

I believe these were already mentioned for you.

1) Stars
2) Termites
3) Crystals
4) Rock Layers

Now answer the question.

Do you or do you now, have evidence of "information rich systems" being produced by intelligent agents other than humans?
Posted by: NoName on Jan. 10 2016,11:45

Oooooh -- "hyper mega irreducible complexity"!
Not impressive.
There is no such thing as 'irreducible complexity'.
Your arguments from incredulity do not serve to establish the meaningfulness and applicability of the alleged concept.
It has less relevance to science than 'the current king of France' does to politics.
For the same reason.

Meanwhile, your concept of a supernatural entity is incoherent, internally contradictory, and unsupported by evidence of any sort.
Just the sort of thing you find intellectually satisfying.

Shameful.
Posted by: ChemiCat on Jan. 10 2016,14:40

[QUOTE]
Quote (Cubist @ Dec. 19 2015,21:01)
Quote (Otangelo @ Dec. 16 2015,16:59)


Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
---------------------QUOTE-------------------



Pleading the fifth, Trollangelo?

The first rule of Creationist Club? Don't answer questions about Creationist Club! Case proven.
Posted by: Soapy Sam on Jan. 10 2016,14:59

Flounce.
Anyway, about this ATP synthase.
Flounce again, and this time I mean it.
Anyway, about this ATP synthase.
Posted by: ChemiCat on Jan. 12 2016,04:52

And Trollangelo continues his drive-by behaviour.

I'll bet good money that he is a postal bible college student who gains credits for bearding the "evilutionists" in their own lair. He has now gone off to email his "professor" for more copy pasta and get a pat on the head for being a good evangelist.
Posted by: k.e.. on Jan. 12 2016,07:34

Quote (Cubist @ Dec. 22 2015,03:42)
Quote (ChemiCat @ Dec. 21 2015,15:10)
Hi Cubist

Not being American I had to look up "Lenny Flank". I now see where you are coming from.
---------------------QUOTE-------------------


In addition to not being American, you're also relatively new to AtBC. I say "relatively new" because while Lenny hasn't posted much here in the past few years, there was a time when he was very active on this forum, and if you'd been around in those days, you would surely have remembered Lenny.

Try googling on [ site:www.antievolution.org "lenny flank" ]. I think you may enjoy what you find.
---------------------QUOTE-------------------


Those were the halcyon days of ID/AtBC with Lenny, Arden, Louis, and Dave Scott. There were others too that now seem to have dissappeared into tbe mists of time.
Posted by: Otangelo on Jan. 12 2016,11:54

Quote (OgreMkV @ Jan. 09 2016,22:41)
[quote=Otangelo,Jan. 09 2016,18:45]
Quote (Cubist @ Dec. 19 2015,21:01)
Quote (Otangelo @ Dec. 16 2015,16:59)


Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
---------------------QUOTE-------------------


Yes.

I believe these were already mentioned for you.

1) Stars
2) Termites
3) Crystals
4) Rock Layers

Now answer the question.

Do you or do you now, have evidence of "information rich systems" being produced by intelligent agents other than humans?
---------------------QUOTE-------------------


non of your examples contain complex, specified, coded information, as found in a book, a computer code, a partiture, or a morse code, or..... dna.
Posted by: Otangelo on Jan. 12 2016,11:56

Quote (NoName @ Jan. 10 2016,11:45)
Oooooh -- "hyper mega irreducible complexity"!
Not impressive.
There is no such thing as 'irreducible complexity'.
Your arguments from incredulity do not serve to establish the meaningfulness and applicability of the alleged concept.
It has less relevance to science than 'the current king of France' does to politics.
For the same reason.

Meanwhile, your concept of a supernatural entity is incoherent, internally contradictory, and unsupported by evidence of any sort.
Just the sort of thing you find intellectually satisfying.

Shameful.
---------------------QUOTE-------------------


Are your thought natural, or supernatural ?
if they are natural, can you detect , feel, smell, taste , see them ?
If not, they cannot be examined scientifically....
Posted by: OgreMkV on Jan. 12 2016,12:02

Quote (Otangelo @ Jan. 12 2016,11:54)
[quote=OgreMkV,Jan. 09 2016,22:41]
Quote (Otangelo @ Jan. 09 2016,18:45)
Quote (Cubist @ Dec. 19 2015,21:01)
 
Quote (Otangelo @ Dec. 16 2015,16:59)


Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
---------------------QUOTE-------------------


Yes.

I believe these were already mentioned for you.

1) Stars
2) Termites
3) Crystals
4) Rock Layers

Now answer the question.

Do you or do you now, have evidence of "information rich systems" being produced by intelligent agents other than humans?
---------------------QUOTE-------------------


non of your examples contain complex, specified, coded information, as found in a book, a computer code, a partiture, or a morse code, or..... dna.
---------------------QUOTE-------------------


Of course not.

I didn't think you would accept it.

You've defined (without telling us, despite us asking) information as only being produced by intelligence. Congratulations. You've created a circular argument.

Information can only come from intelligence. Therefore any thing that comes from non-intelligent sources is not information.

Tell you what. Define all that clap trap you've babbled about information in a robust, repeatable, mathematical system... then we'll talk. Until then, enjoy your circle jerk.
Posted by: NoName on Jan. 12 2016,12:13

Quote (Otangelo @ Jan. 12 2016,12:56)
Quote (NoName @ Jan. 10 2016,11:45)
Oooooh -- "hyper mega irreducible complexity"!
Not impressive.
There is no such thing as 'irreducible complexity'.
Your arguments from incredulity do not serve to establish the meaningfulness and applicability of the alleged concept.
It has less relevance to science than 'the current king of France' does to politics.
For the same reason.

Meanwhile, your concept of a supernatural entity is incoherent, internally contradictory, and unsupported by evidence of any sort.
Just the sort of thing you find intellectually satisfying.

Shameful.
---------------------QUOTE-------------------


Are your thought natural, or supernatural ?
if they are natural, can you detect , feel, smell, taste , see them ?
If not, they cannot be examined scientifically....
---------------------QUOTE-------------------


Massively dishonest.

What does it mean for something to be 'supernatural'?
What distinguishes the natural and the supernatural?

The general consensus, even amongst dualists, idealists, and religionists of most stripes, is that thoughts are natural.
The are 'detected' in the thinking of them.
Thoughts stop when brain activity stops.
Of course, for some out there, thoughts never start.
Or perhaps you are simply unable to detect your own thoughts.
That might account for your incoherent, internally contradictory, and unsupported by any evidence whatsoever notions.

Are your thoughts supernatural?
Are supernatural entities, processes, and/or events detectable?  If so, how?
Are they public, that is accessible to multiple individuals as the same entities, processes, and/or events?
If so, how?
And how do they, then, differ from natural entities, processes, and/or events?

ETA:  You clearly do not know enough  about science to dictate what the pre-requisites are for something to be susceptible to scientific study.  Yet another shameful behavior on your part.
You make a particularly contemptible representative of whatever superstition you partake in.
Posted by: Cubist on Jan. 12 2016,17:24

Quote (Otangelo @ Jan. 09 2016,18:45)
   
Quote (Cubist @ Dec. 19 2015,21:01)

Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
---------------------QUOTE-------------------


Why are you asking me, of all people, that question? I quote myself, from the 2nd page of this thread: "To the best of my knowledge, we have no experience whatsoever of 'information-rich systems' being produced by 'intelligent agents' other than humans."

I repeat the question you have conspicuously failed to answer: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings? I am not asking you to provide evidence that "intelligent agents" other than human beings exist. Rather, I am asking you to provide evidence that "intelligent agents" other than human beings have produced "information-rich systems".

And while I'm at it, I may as well repeat another question you have conspicuously failed to answer: What does "new information" look like? I am not asking you to define what "new information" is. I am not asking you to justify your assumption that "new information" exists. I am, instead, asking you how one would recognize this "new information" stuff if one actually saw it.

I look forward to reading your answers to my questions.
Posted by: fnxtr on Jan. 12 2016,21:27

... and I look forward to reading about successful cold fusion.
Posted by: Cubist on Jan. 13 2016,05:31

Quote (fnxtr @ Jan. 12 2016,21:27)
... and I look forward to reading about successful cold fusion.
---------------------QUOTE-------------------


You can. While it's true that the more grandiose claims of Pons and Fleischmann failed to pan out, I am given to understand that scientists attempting to replicate P&F's experiments have come up with some peculiar and interesting results.
Posted by: Otangelo on Jan. 20 2016,19:00

Quote (OgreMkV @ Jan. 12 2016,12:02)
[quote=Otangelo,Jan. 12 2016,11:54]
Quote (OgreMkV @ Jan. 09 2016,22:41)
Quote (Otangelo @ Jan. 09 2016,18:45)
 
Quote (Cubist @ Dec. 19 2015,21:01)
 
Quote (Otangelo @ Dec. 16 2015,16:59)


Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
---------------------QUOTE-------------------


Yes.

I believe these were already mentioned for you.

1) Stars
2) Termites
3) Crystals
4) Rock Layers

Now answer the question.

Do you or do you now, have evidence of "information rich systems" being produced by intelligent agents other than humans?
---------------------QUOTE-------------------


non of your examples contain complex, specified, coded information, as found in a book, a computer code, a partiture, or a morse code, or..... dna.
---------------------QUOTE-------------------


Of course not.

I didn't think you would accept it.

You've defined (without telling us, despite us asking) information as only being produced by intelligence. Congratulations. You've created a circular argument.

Information can only come from intelligence. Therefore any thing that comes from non-intelligent sources is not information.

Tell you what. Define all that clap trap you've babbled about information in a robust, repeatable, mathematical system... then we'll talk. Until then, enjoy your circle jerk.
---------------------QUOTE-------------------


sorry, not just information. coded, specified complex information only comes from a mind.
Posted by: Otangelo on Jan. 20 2016,19:03

And here come  the next two knock out arguments against naturalistic fairy tale stories.

1. The origin of the genetic cipher 1
1.Triplet codons must be assigned to amino acids to establish a genetic cipher.  Nucleic-acid bases and amino acids don’t recognize each other directly, but have to deal via chemical intermediaries ( tRNA's and  Aminoacyl tRNA synthetase ), there is no obvious reason why particular triplets should go with particular amino acids.
2. Other translation assignments are conceivable, but whatever cipher is established, the right amino acids must be assigned to permit polypeptide chains, which fold to active funcional proteins. Functional amino acid chains in sequence space are rare.  There are two possibilities to explain the correct assignment of the codons to the right amino acids. Chance, and design. Natural selection is not a option at this stage, since DNA replication is not setup at this stage.
3. If it were a lucky accident happened by chance, luck would have  hit the jackpot  trough trial and error amongst 1.5 × 10^84 possible genetic codes . That is the number of atoms in the whole universe. That puts any real possibility of chance providing the feat out of question. Its , using  Borel's law, in the realm of impossibility. Natural selection would have to evaluate roughly 10^55 codes per second to find the one that's universal. Put simply, the chemical lottery lacks the time necessary to find the universal genetic code.
4. We have not even considered that there are also  over 500 possible amino acids, which would have to be sorted out, to get only 20, and select  all L amino and R sugar bases......
5. We know that minds do invent languages, codes, translation systems, ciphers, and complex, specified information all the time.
6. Put it in other words : The task compares to invent two languages, two alphabets, and a translation system, and the information content of a book ( for example hamlet)  being written in english translated  to chinese  in a extremely sophisticared hardware system.
7. The genetic code and its translation system is best explained through the action of a intelligent designer.


2. The software and hardware of the cell are irreducibly complex 2
1. The cell contains a complex information storage medium through DNA and mRNA.
2. The cell has a complex information processing system ( through  RNA polymerase, transcription factors , a spliceosome , a  ribosome,  chaperone enzymes, specialized transport proteins , and ATP
3. The cell contains a genetic code which is at or very close to a global optimum for error minimization across plausible parameter space
4. The cell stores complex, specified, coded information ( the software )
5. The cell has a complex translation system through a universal cipher, which assigns 61 codons (4x4x4=64-3 stop and start=64) to 20 amino acids and permits the translation of the genetic code into functional proteins
6. This constitutes a logical structure of information processing : DNA>>RNA>>>Protein, based on software and hardware. Both aspects must be explained.
7. There is no reason for information processing machinery to exist without the software, and vice versa.
8. Systems of interconnected software and hardware are irreducibly complex.
9. A irreducible complex system can not arise in a step wise, evolutionary manner.
10. Only minds are capable to conceptualise and implement  instructional information control systems transformed into molecular dynamics
11. Therefore , a  intelligent designer  exists.
Posted by: OgreMkV on Jan. 20 2016,21:45

Quote (Otangelo @ Jan. 20 2016,19:00)
[quote=OgreMkV,Jan. 12 2016,12:02]
Quote (Otangelo @ Jan. 12 2016,11:54)
Quote (OgreMkV @ Jan. 09 2016,22:41)
 
Quote (Otangelo @ Jan. 09 2016,18:45)
 
Quote (Cubist @ Dec. 19 2015,21:01)
   
Quote (Otangelo @ Dec. 16 2015,16:59)


Question: Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?
---------------------QUOTE-------------------


Question :  Do you, or do you not, have evidence of "information-rich systems" being produced by NON "intelligent agents" at all ?
---------------------QUOTE-------------------


Yes.

I believe these were already mentioned for you.

1) Stars
2) Termites
3) Crystals
4) Rock Layers

Now answer the question.

Do you or do you now, have evidence of "information rich systems" being produced by intelligent agents other than humans?
---------------------QUOTE-------------------


non of your examples contain complex, specified, coded information, as found in a book, a computer code, a partiture, or a morse code, or..... dna.
---------------------QUOTE-------------------


Of course not.

I didn't think you would accept it.

You've defined (without telling us, despite us asking) information as only being produced by intelligence. Congratulations. You've created a circular argument.

Information can only come from intelligence. Therefore any thing that comes from non-intelligent sources is not information.

Tell you what. Define all that clap trap you've babbled about information in a robust, repeatable, mathematical system... then we'll talk. Until then, enjoy your circle jerk.
---------------------QUOTE-------------------


sorry, not just information. coded, specified complex information only comes from a mind.
---------------------QUOTE-------------------


As I said, you have a circular reasoning.

Coded is the result of an activity done to information. In general use, it does imply a mind to do the coding and decoding. Of course, a mind isn't required, but your simplistic understanding does.

Specified requires something to specify the information. Again, in general use, it does imply a mind to make the specification. Of course, a mind isn't required, but your simplistic understanding does.

You have defined the information you seek as only that which comes from a mind, then use that to justify belief in the mind that created it. That is circular logic.

Define "coded, specified complex information"

What does "coded" mean in this context? What determines if some information is "coded" or not? Does meaning play any part in that?

What does "specified" mean in this context? Who does the specifying? With what tools and systems? How?

What does "complex" mean in this context? How do you measure complexity? What units? Why?

What does "information" mean in this context? How do you measure it? What units? Why?

What values of the above require a mind? What values do not require a mind? Why?

What is the "mind" that resulted in life as we know it? How do you know?

Can you, Otangelo, determine the difference between coded, specified information and random information? I challenge you to do so.

If you cannot, then you have no possible way to determine the answers that you think you already know. If you can, and can do so reliably, then you will have a Nobel prize (or whatever the equivalent is) for mathematics waiting for you.

Just let me know when you are ready. I'll provide two strings. One random and one that is complex, coded, and specified.
Posted by: fnxtr on Jan. 20 2016,21:55

A propaganda fly-by!

Thanks for dropping your leaflets there, Otangelo, we were running out of TP.
Posted by: Wesley R. Elsberry on Jan. 20 2016,22:31

Otangelo:

 

---------------------QUOTE-------------------

3. If it were a lucky accident happened by chance, luck would have  hit the jackpot  trough trial and error amongst 1.5 × 10^84 possible genetic codes . That is the number of atoms in the whole universe. That puts any real possibility of chance providing the feat out of question. Its , using  Borel's law, in the realm of impossibility. Natural selection would have to evaluate roughly 10^55 codes per second to find the one that's universal. Put simply, the chemical lottery lacks the time necessary to find the universal genetic code.

---------------------QUOTE-------------------



Piffle. This assumes that one and only one genetic code will work. We know of a number of alternative genetic codes that are somewhat different from < the canonical genetic code >, which is presumably the one that Otangelo believes is uniquely functional.

In fact, if one uses the partition rule and determines the number of genetic codes that are alternatives to the canonical code, but have *exactly* the same distribution of degenerate coding, one gets a number around 2.3e69 alternatives. And that isn't even allowing for the alternative codes that have slightly different patterns of redundancies and probably would work just fine.

If God had wanted a clear signal that species were immutable, it would have been simple for Him to provide each species with its very own genetic code. That isn't what we find. We find the canonical genetic code is widespread, and the alternatives to it when analyzed phylogenetically show the usual nested hierarchy pattern of divergence expected under common descent.
Posted by: RumraketR on Jan. 21 2016,02:15

Otangelo, aka Elsamah, aka Jireh, aka Coroama, aka Elsamah77, aka lonelynutjob is emerging as a remarkably incompetent copy-paster on several sketicism/rationalist fora.

See for example how he mindlessly copy-pastes the same crap over here: http://www.theleagueofreason.co.uk/viewtop.... Thread > (It's one of five such threads he has over there where he just mindlessly copy-pastes from his personal "library" of quotemines and copypasta).

He has no idea what any of the stuff he copy-pastes even means. He seems to be totally infatuated with engineering and computer-science related technical jargon, and diagrams with lots of arrows and tables with abbreviations and numbers in them.
Posted by: ChemiCat on Jan. 21 2016,02:54



---------------------QUOTE-------------------
1.Triplet codons must be assigned to amino acids to establish a genetic cipher.  Nucleic-acid bases and amino acids don’t recognize each other directly, but have to deal via chemical intermediaries ( tRNA's and  Aminoacyl tRNA synthetase ), there is no obvious reason why particular triplets should go with particular amino acids.
---------------------QUOTE-------------------



Trollangelo, now explain why this is not possible within the laws of physics and chemistry alone without the interference of your gods.

In retrospect don't bother, I know you can't.
Posted by: Cubist on Jan. 21 2016,15:02

Hello, Otangelo! I see that you found time to deposit another load of verbiage on this forum. I also see that your latest load of verbiage does not contain anything within bazooka range of an answer to either of the questions I've repeatedly asked you. That's okay, here they are again; boldfacing was apparently not enough to get you to notice these questions the last time around, but perhaps boldface plus a larger font will do the job:

Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


I look forward to reading your answers to my questions.
Posted by: fnxtr on Jan. 21 2016,15:06

Quote (Cubist @ Jan. 21 2016,13:02)
Hello, Otangelo! I see that you found time to deposit another load of verbiage on this forum. I also see that your latest load of verbiage does not contain anything within bazooka range of an answer to either of the questions I've repeatedly asked you. That's okay, here they are again; boldfacing was apparently not enough to get you to notice these questions the last time around, but perhaps boldface plus a larger font will do the job:

Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


I look forward to reading your answers to my questions.
---------------------QUOTE-------------------


and cue rubber/glue response in 3, 2....
Posted by: Otangelo on Jan. 21 2016,16:23

Quote (OgreMkV @ Jan. 20 2016,21:45)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Of course, a mind isn't requiredOf course, a mind isn't required, but your simplistic understanding does.
---------------------QUOTE-------------------



baseless assertion. Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
Posted by: fnxtr on Jan. 21 2016,16:35

Quote (fnxtr @ Jan. 21 2016,13:06)
 
Quote (Cubist @ Jan. 21 2016,13:02)
Hello, Otangelo! I see that you found time to deposit another load of verbiage on this forum. I also see that your latest load of verbiage does not contain anything within bazooka range of an answer to either of the questions I've repeatedly asked you. That's okay, here they are again; boldfacing was apparently not enough to get you to notice these questions the last time around, but perhaps boldface plus a larger font will do the job:

Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


I look forward to reading your answers to my questions.
---------------------QUOTE-------------------


and cue rubber/glue response in 3, 2....
---------------------QUOTE-------------------



Posted by: Otangelo on Jan. 21 2016,17:24

Quote (Wesley R. Elsberry @ Jan. 20 2016,22:31)

---------------------QUOTE-------------------




---------------------QUOTE-------------------
Piffle. This assumes that one and only one genetic code will work. We know of a number of alternative genetic codes that are somewhat different from < the canonical genetic code >, which is presumably the one that Otangelo believes is uniquely functional.
---------------------QUOTE-------------------



I agree . But its not any code and cipher that will to the job.

The genetic code is nearly optimal for allowing additional information within protein-coding sequences
< http://www.ncbi.nlm.nih.gov/pmc....1832087 >

DNA sequences that code for proteins need to convey, in addition to the protein-coding information, several different signals at the same time. These “parallel codes” include binding sequences for regulatory and structural proteins, signals for splicing, and RNA secondary structure. Here, we show that the universal genetic code can efficiently carry arbitrary parallel codes much better than the vast majority of other possible genetic codes. This property is related to the identity of the stop codons. We find that the ability to support parallel codes is strongly tied to another useful property of the genetic code—minimization of the effects of frame-shift translation errors. Whereas many of the known regulatory codes reside in nontranslated regions of the genome, the present findings suggest that protein-coding regions can readily carry abundant additional information.

if we employ weightings to allow for biases in translation, then only 1 in every million random alternative codes generated is more efficient than the natural code. We thus conclude not only that the natural genetic code is extremely efficient at minimizing the effects of errors, but also that its structure reflects biases in these errors, as might be expected were the code the product of selection.

Fazale Rana wrote in his book Cell's design:   In 1968, Nobel laureate Francis Crick argued that the genetic code could not undergo significant evolution. His rationale is easy to understand. Any change in codon assignments would lead to changes in amino acids in every polypeptide made by the cell. This wholesale change in polypeptide sequences would result in a large number of defective proteins. Nearly any conceivable change to the genetic code would be lethal to the cell.

Question: how did the translation of the triplet anti codon to amino acids, and its assignment, arise ?  There is no physical affinity between the anti codon and the amino acids. What must be explained, is the arrangement of the codon " words " in the standard codon table which is highly non-random, redundant and optimal, and serves to translate the information into the amino acid sequence to make proteins, and the origin of the assignment of the 64 triplet codons to the 20 amino acids. That is, the origin of its translation. The origin of a alphabet through the triplet codons is one thing, but on top, it has to be translated to a other " alphabet " constituted through the 20 amino acids. That is as to explain the origin of capability to translate the english language into chinese. We have to constitute the english and chinese language and symbols first, in order to know its equivalence. That is a mental process.

And:

the fact that various genetic codes exist, means, common ancestry, bye bye:

< http://reasonandscience.heavenforum.org/t2277-t....c-codes >
Posted by: Occam's Aftershave on Jan. 21 2016,17:31

Quote (Otangelo @ Jan. 21 2016,17:24)
 
Quote (Wesley R. Elsberry @ Jan. 20 2016,22:31)

---------------------QUOTE-------------------


   

---------------------QUOTE-------------------
Piffle. This assumes that one and only one genetic code will work. We know of a number of alternative genetic codes that are somewhat different from < the canonical genetic code >, which is presumably the one that Otangelo believes is uniquely functional.
---------------------QUOTE-------------------



I agree . But its not any code and cipher that will to the job.

The genetic code is nearly optimal for allowing additional information within protein-coding sequences
< http://www.ncbi.nlm.nih.gov/pmc........1832087 >
---------------------QUOTE-------------------


Your own source gives a supported evolutionary hypothesis for how the code evolved.

 

---------------------QUOTE-------------------
How did such near optimality for parallel codes evolve? One possibility is that the ability to include parallel codes within protein-coding sequences conferred a selection advantage during the early evolution of the genetic code. Alternatively, the genetic code might have been fixed in evolution before most parallel codes existed. We therefore sought a different selection pressure on the code, which could have existed in the early stages of the evolution of the genetic code. One such inherent feature of protein translation is frame-shift translation errors (Parker 1989; Farabaugh and Bjork 1999; Seligmann and Pollock 2004). In these errors, the ribosome shifts the reading frame, either forward or backward. This results in a nonsense translated peptide, and usually loss of protein function. These errors occur in ribosomes nearly as frequently as misread errors (3 × 10−5 per codon, compared with misread errors of 10−4 per codon [Parker 1989]). These errors have a relatively large effect on fitness because they result in a nonsense polypeptide. Frame-shift errors may thus pose a selectable constraint on the genetic code: Codes that are able to abort translation more rapidly following frame-shift errors have an advantage
---------------------QUOTE-------------------



Nice own goal there Otangebozo.
Posted by: Otangelo on Jan. 21 2016,17:33

Quote (RumraketR @ Jan. 21 2016,02:15)
Otangelo, aka Elsamah, aka Jireh, aka Coroama, aka Elsamah77, aka lonelynutjob is emerging as a remarkably incompetent copy-paster on several sketicism/rationalist fora.

See for example how he mindlessly copy-pastes the same crap over here: <a href="http://www.theleagueofreason.co.uk/viewtopic.php?f=8&p=170215#p170215< The" target="_blank">http://www.theleagueofreason.co.uk/viewtop.... Thread > (It's one of five such threads he has over there where he just mindlessly copy-pastes from his personal "library" of quotemines and copypasta).

He has no idea what any of the stuff he copy-pastes even means. He seems to be totally infatuated with engineering and computer-science related technical jargon, and diagrams with lots of arrows and tables with abbreviations and numbers in them.
---------------------QUOTE-------------------


It must be frustrating seing your world view cranked down bits by bits, argument by argument, one after the other, isnt it, Rumraket?
I hope you will get the curve before its too late. Because then you will still enjoy a meaningful life here on earth, and a happy time in eternity.
Posted by: Richardthughes on Jan. 21 2016,17:37

Quote (Otangelo @ Jan. 21 2016,17:33)
Quote (RumraketR @ Jan. 21 2016,02:15)
Otangelo, aka Elsamah, aka Jireh, aka Coroama, aka Elsamah77, aka lonelynutjob is emerging as a remarkably incompetent copy-paster on several sketicism/rationalist fora.

See for example how he mindlessly copy-pastes the same crap over here: <a href="http://www.theleagueofreason.co.uk/viewtopic.php?f=8&p=170215#p170215< The" target="_blank">http://www.theleagueofreason.co.uk/viewtop.... Thread > (It's one of five such threads he has over there where he just mindlessly copy-pastes from his personal "library" of quotemines and copypasta).

He has no idea what any of the stuff he copy-pastes even means. He seems to be totally infatuated with engineering and computer-science related technical jargon, and diagrams with lots of arrows and tables with abbreviations and numbers in them.
---------------------QUOTE-------------------


It must be frustrating seing your world view cranked down bits by bits, argument by argument, one after the other, isnt it, Rumraket?
I hope you will get the curve before its too late. Because then you will still enjoy a meaningful life here on earth, and a happy time in eternity.
---------------------QUOTE-------------------


Brought to you by Spammerz4Jebus.
Posted by: Otangelo on Jan. 21 2016,17:37

Quote (Occam's Aftershave @ Jan. 21 2016,17:31)
Quote (Otangelo @ Jan. 21 2016,17:24)
 
Quote (Wesley R. Elsberry @ Jan. 20 2016,22:31)

---------------------QUOTE-------------------


   

---------------------QUOTE-------------------
Piffle. This assumes that one and only one genetic code will work. We know of a number of alternative genetic codes that are somewhat different from < the canonical genetic code >, which is presumably the one that Otangelo believes is uniquely functional.
---------------------QUOTE-------------------



I agree . But its not any code and cipher that will to the job.

The genetic code is nearly optimal for allowing additional information within protein-coding sequences
< http://www.ncbi.nlm.nih.gov/pmc........1832087 >
---------------------QUOTE-------------------


Your own source gives a supported evolutionary hypothesis for how the code evolved.

   

---------------------QUOTE-------------------
How did such near optimality for parallel codes evolve? One possibility is that the ability to include parallel codes within protein-coding sequences conferred a selection advantage during the early evolution of the genetic code. Alternatively, the genetic code might have been fixed in evolution before most parallel codes existed. We therefore sought a different selection pressure on the code, which could have existed in the early stages of the evolution of the genetic code. One such inherent feature of protein translation is frame-shift translation errors (Parker 1989; Farabaugh and Bjork 1999; Seligmann and Pollock 2004). In these errors, the ribosome shifts the reading frame, either forward or backward. This results in a nonsense translated peptide, and usually loss of protein function. These errors occur in ribosomes nearly as frequently as misread errors (3 × 10−5 per codon, compared with misread errors of 10−4 per codon [Parker 1989]). These errors have a relatively large effect on fitness because they result in a nonsense polypeptide. Frame-shift errors may thus pose a selectable constraint on the genetic code: Codes that are able to abort translation more rapidly following frame-shift errors have an advantage
---------------------QUOTE-------------------



Nice own goal there Otangebozo.
---------------------QUOTE-------------------


aham. Because the papper says so, it most be true. Forgot to activate your brain and think critically ? ah. Almost forgot. Naturalists have the bad habit to swallow junk food, aka. just so scientific papper stories brainlessly. Isnt it ?
Posted by: fnxtr on Jan. 21 2016,18:09

Quote (Otangelo @ Jan. 21 2016,15:33)
Quote (RumraketR @ Jan. 21 2016,02:15)
Otangelo, aka Elsamah, aka Jireh, aka Coroama, aka Elsamah77, aka lonelynutjob is emerging as a remarkably incompetent copy-paster on several sketicism/rationalist fora.

See for example how he mindlessly copy-pastes the same crap over here: <a href="http://www.theleagueofreason.co.uk/viewtopic.php?f=8&p=170215#p170215< The" target="_blank">http://www.theleagueofreason.co.uk/viewtop.... Thread > (It's one of five such threads he has over there where he just mindlessly copy-pastes from his personal "library" of quotemines and copypasta).

He has no idea what any of the stuff he copy-pastes even means. He seems to be totally infatuated with engineering and computer-science related technical jargon, and diagrams with lots of arrows and tables with abbreviations and numbers in them.
---------------------QUOTE-------------------


It must be frustrating seing your world view cranked down bits by bits, argument by argument, one after the other, isnt it, Rumraket?
I hope you will get the curve before its too late. Because then you will still enjoy a meaningful life here on earth, and a happy time in eternity.
---------------------QUOTE-------------------


a.s.s.f.
Posted by: Cubist on Jan. 21 2016,18:35

Hm. Curious. Otangelo posted, but again seems not to have notice my questions. Okay, a little larger this time…

Do you have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


I look forward to reading your answers to my questions.
Posted by: OgreMkV on Jan. 21 2016,20:16

Quote (Otangelo @ Jan. 21 2016,16:23)
Quote (OgreMkV @ Jan. 20 2016,21:45)

---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
Of course, a mind isn't requiredOf course, a mind isn't required, but your simplistic understanding does.
---------------------QUOTE-------------------



baseless assertion. Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------


Sure. But to provide the information you want... I need...

Define "coded, specified complex information"

What does "coded" mean in this context? What determines if some information is "coded" or not? Does meaning play any part in that?

What does "specified" mean in this context? Who does the specifying? With what tools and systems? How?

What does "complex" mean in this context? How do you measure complexity? What units? Why?

What does "information" mean in this context? How do you measure it? What units? Why?

What values of the above require a mind? What values do not require a mind? Why?

What is the "mind" that resulted in life as we know it? How do you know?

Also, I note you snipped all the questions AND ignored my challenge. Which I will repeat here for you...

Can you, Otangelo, determine the difference between coded, specified information and random information? I challenge you to do so.

If you cannot, then you have no possible way to determine the answers that you think you already know. If you can, and can do so reliably, then you will have a Nobel prize (or whatever the equivalent is) for mathematics waiting for you.

Just let me know when you are ready. I'll provide two strings. One random and one that is complex, coded, and specified.

eta: I have already provided the information that you requested, however, YOUR definitions seem to reject those systems. Therefore, without precise definitions of what you mean, nothing more can be done.

I'm willing to bet any amount of money that you've never even tried to define or measure those words you keep using.


Posted by: Wesley R. Elsberry on Jan. 21 2016,20:55

Otangelo:



---------------------QUOTE-------------------

the fact that various genetic codes exist, means, common ancestry, bye bye:

---------------------QUOTE-------------------



Hmmm... what part of the statement that when examined phylogenetically, the alternative codes are in the pattern expected from common descent is Otangelo having difficulty comprehending?

Plus math doesn't seem to be his strong suit.
Posted by: Occam's Aftershave on Jan. 21 2016,21:06

Quote (Otangelo @ Jan. 21 2016,17:37)
aham. Because the papper says so, it most be true.
---------------------QUOTE-------------------


You posted the paper to support your claims you moron.  Are you now saying the paper is false and doesn't support your claims? :D

What a clueless tool.
Posted by: RumraketR on Jan. 22 2016,03:59

Quote (Otangelo @ Jan. 21 2016,17:33)
Quote (RumraketR @ Jan. 21 2016,02:15)
Otangelo, aka Elsamah, aka Jireh, aka Coroama, aka Elsamah77, aka lonelynutjob is emerging as a remarkably incompetent copy-paster on several sketicism/rationalist fora.

See for example how he mindlessly copy-pastes the same crap over here: <a href="http://www.theleagueofreason.co.uk/viewtopic.php?f=8&p=170215#p170215< The" target="_blank">http://www.theleagueofreason.co.uk/viewtop.... Thread > (It's one of five such threads he has over there where he just mindlessly copy-pastes from his personal "library" of quotemines and copypasta).

He has no idea what any of the stuff he copy-pastes even means. He seems to be totally infatuated with engineering and computer-science related technical jargon, and diagrams with lots of arrows and tables with abbreviations and numbers in them.
---------------------QUOTE-------------------


It must be frustrating seing your world view cranked down bits by bits, argument by argument, one after the other, isnt it, Rumraket?
I hope you will get the curve before its too late. Because then you will still enjoy a meaningful life here on earth, and a happy time in eternity.
---------------------QUOTE-------------------


Did he seriously just write this bafflegab? Somebody tell me I'm being trolled.  :p
Posted by: RumraketR on Jan. 22 2016,04:05

Quote (Wesley R. Elsberry @ Jan. 21 2016,20:55)
Otangelo:

 

---------------------QUOTE-------------------

the fact that various genetic codes exist, means, common ancestry, bye bye:

---------------------QUOTE-------------------



Hmmm... what part of the statement that when examined phylogenetically, the alternative codes are in the pattern expected from common descent is Otangelo having difficulty comprehending?
---------------------QUOTE-------------------


The whole thing. He does not know what a phylogenetic relationship is. He does not know how one is constructed. He does not know about the logic involved, he has never looked into the inferences. He has zero skill or education in even rudimentary logic or reasoning. He does not understand what a prediction is, he does not understand how falsification happens or what it means. He does not understand why it is even important for something to be falsifiable, or to make predictions. All of these concepts are totally foreign to him.

He thinks scientists are like priests, they just read stuff and believe it really hard, then make up rationalizations after the fact to "save" their worldview from disproof.

After all, that is what he does himself and how he thinks his own authority figures work. But he also believes his own authority figures are "more right" and "more trustworthy" than secular/nonbelieving authority figures, because "his" authority figures are infallibly inspired by an omnipotent god.
Posted by: ChemiCat on Jan. 22 2016,10:29



---------------------QUOTE-------------------
Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------



Jesus christ on a pogo stick.

Sorry, I saw that Ogre beat me to the exact questions I was going to ask.

So, Trollangelo, when can we expect your answers? And why should I have any fear of your baseless threats of eternity?
Posted by: ChemiCat on Jan. 22 2016,10:34

Trollangelo,

Which of this list has more "Specified Complex information"?

           post
           opts
           tops
           stop
           pots
           spot

And give justification for your answer.
Posted by: Otangelo on Jan. 23 2016,06:38

Quote (OgreMkV @ Jan. 21 2016,20:16)
Quote (Otangelo @ Jan. 21 2016,16:23)
Quote (OgreMkV @ Jan. 20 2016,21:45)

---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
Of course, a mind isn't requiredOf course, a mind isn't required, but your simplistic understanding does.
---------------------QUOTE-------------------



baseless assertion. Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------


Sure. But to provide the information you want... I need...

Define "coded, specified complex information"

What does "coded" mean in this context? What determines if some information is "coded" or not? Does meaning play any part in that?

What does "specified" mean in this context? Who does the specifying? With what tools and systems? How?

What does "complex" mean in this context? How do you measure complexity? What units? Why?

What does "information" mean in this context? How do you measure it? What units? Why?

What values of the above require a mind? What values do not require a mind? Why?

What is the "mind" that resulted in life as we know it? How do you know?

Also, I note you snipped all the questions AND ignored my challenge. Which I will repeat here for you...

Can you, Otangelo, determine the difference between coded, specified information and random information? I challenge you to do so.

If you cannot, then you have no possible way to determine the answers that you think you already know. If you can, and can do so reliably, then you will have a Nobel prize (or whatever the equivalent is) for mathematics waiting for you.

Just let me know when you are ready. I'll provide two strings. One random and one that is complex, coded, and specified.

eta: I have already provided the information that you requested, however, YOUR definitions seem to reject those systems. Therefore, without precise definitions of what you mean, nothing more can be done.

I'm willing to bet any amount of money that you've never even tried to define or measure those words you keep using.
---------------------QUOTE-------------------


< http://www.uncommondescent.com/intelli....erstand >
Posted by: Otangelo on Jan. 23 2016,06:39

Quote (Wesley R. Elsberry @ Jan. 21 2016,20:55)

---------------------QUOTE-------------------


the alternative codes are in the pattern expected from common descent //why is that expected ?
Posted by: Otangelo on Jan. 23 2016,06:41

Quote (Occam's Aftershave @ Jan. 21 2016,21:06)
Quote (Otangelo @ Jan. 21 2016,17:37)
aham. Because the papper says so, it most be true.
---------------------QUOTE-------------------


You posted the paper to support your claims you moron.  Are you now saying the paper is false and doesn't support your claims? :D

What a clueless tool.
---------------------QUOTE-------------------


I posted the paper because of the science and the evidence presented. NOT BECAUSE OF THE BIASED INFERENCE of the author of the paper. Learn the difference.
Posted by: Otangelo on Jan. 23 2016,06:43

Quote (RumraketR @ Jan. 22 2016,04:05)
Quote (Wesley R. Elsberry @ Jan. 21 2016,20:55)
Otangelo:

 

---------------------QUOTE-------------------

the fact that various genetic codes exist, means, common ancestry, bye bye:

---------------------QUOTE-------------------



Hmmm... what part of the statement that when examined phylogenetically, the alternative codes are in the pattern expected from common descent is Otangelo having difficulty comprehending?
---------------------QUOTE-------------------


The whole thing. He does not know what a phylogenetic relationship is. He does not know how one is constructed. He does not know about the logic involved, he has never looked into the inferences. He has zero skill or education in even rudimentary logic or reasoning. He does not understand what a prediction is, he does not understand how falsification happens or what it means. He does not understand why it is even important for something to be falsifiable, or to make predictions. All of these concepts are totally foreign to him.

He thinks scientists are like priests, they just read stuff and believe it really hard, then make up rationalizations after the fact to "save" their worldview from disproof.

After all, that is what he does himself and how he thinks his own authority figures work. But he also believes his own authority figures are "more right" and "more trustworthy" than secular/nonbelieving authority figures, because "his" authority figures are infallibly inspired by an omnipotent god.
---------------------QUOTE-------------------


wow. it seems you have gone to university to study what i do, or do not know ?

amazing. It seems you know more about me, than i about myself.

Genetic Phylogeny

< http://www.detectingdesign.com/genetic....ny.html >

mollusks (scallops) are more closely related to deuterostomes (sea urchins) than arthropods (brine shrimp).  Of course, this is not too surprising.  Intuitively, a scallop seems more like a sea urchin than a shrimp.  So, the 82% correlation between the scallop and sea urchin is not surprising.  However, in this light it is surprising is that a tarantula (also an arthropod) has a 92% correlation with the scallop.  Here we have two different arthropods, a shrimp and an tarantula.  How can a scallop be much more related to one type of arthropod and much less related to the other type of arthropod? This troubling thought led the authors of the Science article to remark:

Different representative species, in this case brine shrimp or tarantula for the arthropods, yield wildly different inferred relationships among phyla. Both trees have strong bootstrap support (percentage at node). . .  The critical question is whether current models of 18S rRNA evolution are sufficiently accurate to successfully compensate for long branch attraction between the animal phyla. Without knowing the correct tree ahead of time, this question will be hard to answer. However, current models of DNA substitution usually fit the data poorly .
Posted by: Otangelo on Jan. 23 2016,06:48

Quote (ChemiCat @ Jan. 22 2016,10:29)


---------------------QUOTE-------------------
Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------



Jesus christ on a pogo stick.

Sorry, I saw that Ogre beat me to the exact questions I was going to ask.

So, Trollangelo, when can we expect your answers? And why should I have any fear of your baseless threats of eternity?
---------------------QUOTE-------------------


i have not threaten anyone. If you interpret it that way, its your business.

How do u know what i believe about eternity is baseless ? Ever died and came back and know now ?

a universe from nothing, or eternal >> impossible.
fine tuning of the universe by chance >> impossible
abiogenesis >> impossible
a mind from matter >> impossible
biodiversity through macro evolution ==>> impossible.

naturalism ==>> impossible

:O

a universe created by a eternal God >> possible.
fine tuning of the universe by a fine tuner >> possible
biogenesis >> possible
a mind from a mind >> possible
biodiversity through a creator ==>> possible.

theism ==>> possible

:)
Posted by: Cubist on Jan. 23 2016,07:06

Another Otangelo post; another opportunity for him to answer my simple questions—an opportunity which Otangelo has, once again, declined to take advantage of. Let's see if italicizing the questions makes them any more evident to Otangelo:

Do you have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


As ever, I look forward to reading Otangelo's answers to my questions.
Posted by: NoName on Jan. 23 2016,07:14

Quote (Otangelo @ Jan. 23 2016,07:48)
   
Quote (ChemiCat @ Jan. 22 2016,10:29)
   

---------------------QUOTE-------------------
Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------



Jesus christ on a pogo stick.

Sorry, I saw that Ogre beat me to the exact questions I was going to ask.

So, Trollangelo, when can we expect your answers? And why should I have any fear of your baseless threats of eternity?
---------------------QUOTE-------------------


i have not threaten anyone. If you interpret it that way, its your business.

How do u know what i believe about eternity is baseless ? Ever died and came back and know now ?
---------------------QUOTE-------------------


You first.
It's never happened, on the evidence.
 

---------------------QUOTE-------------------
a universe from nothing, or eternal >> impossible.
---------------------QUOTE-------------------

Prove it.
   

---------------------QUOTE-------------------
fine tuning of the universe by chance >> impossible
---------------------QUOTE-------------------

 Prove it.  Start by proving the universe is actually 'fine tuned'.  That the fundamental constants of physics appear to be tightly coupled is no more sign of an "exterior" tuner than the tight coupling between pi and the circumference and radius of a circle.
   

---------------------QUOTE-------------------
abiogenesis >> impossible
---------------------QUOTE-------------------

 Prove it.  Highly improbable != impossible.
   

---------------------QUOTE-------------------
a mind from matter >> impossible
---------------------QUOTE-------------------

 Prove it.  Unbelievable by you != impossible.  What more than matter and energy is there?
   

---------------------QUOTE-------------------
biodiversity through macro evolution ==>> impossible.
---------------------QUOTE-------------------

 Prove it.  Highly unlikely != impossible.  Unbelievable by you != impossible
   

---------------------QUOTE-------------------
naturalism ==>> impossible
---------------------QUOTE-------------------

 Prove it.  Use only non-natural means.  Unaccepted by you != impossible.

...

   

---------------------QUOTE-------------------
a universe created by a eternal God >> possible.
---------------------QUOTE-------------------

 False.  Requires equivocation on 'create' such that the term becomes meaningless.  Proven false in countless ways, countless times.  Acquaint yourself with the primary literature, not the pre-digested third-hand prejudicial accounts you seem to have a taste for.
   

---------------------QUOTE-------------------
fine tuning of the universe by a fine tuner >> possible
---------------------QUOTE-------------------

 False, as 'fine tuning' in the sense required has yet to be demonstrated.  And ultimately this falls to the same logic as non-natural "cause" interacting with nature.
   

---------------------QUOTE-------------------
biogenesis >> possible
---------------------QUOTE-------------------

 Of course.  But not in the sense you intend, for the reasons given above.  Biogenesis logically requires abiogenesis or you fall to infinite regress -- which you reject in your silly "universe from nothing, or eternal >> impossible" assertion.[/quote]
   

---------------------QUOTE-------------------
a mind from a mind >> possible
---------------------QUOTE-------------------

 Probably, but far from a given and not yet accomplished, on the evidence.
   

---------------------QUOTE-------------------
biodiversity through a creator ==>> possible.
---------------------QUOTE-------------------

Not in the supernaturalist sense you intend.  Otherwise banal and trivial -- witness dogs, cats, wheat, etc.

 

---------------------QUOTE-------------------
theism ==>> possible
---------------------QUOTE-------------------


Given that this is identical to the claim 'error ==>> possible' or 'incorrect belief ==>> possible', yes, of course.  Trivially true.
Theism ==> true remains an unproven assertion based on faulty logic enabled by incoherent definitions.
Posted by: JonF on Jan. 23 2016,07:58

Quote (Otangelo @ Jan. 21 2016,17:23)
Quote (OgreMkV @ Jan. 20 2016,21:45)

---------------------QUOTE-------------------


 

---------------------QUOTE-------------------
Of course, a mind isn't requiredOf course, a mind isn't required, but your simplistic understanding does.
---------------------QUOTE-------------------



baseless assertion. Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------


Hilarious!

Tell you what.  You identify ten instances coded, specified, complex information (showing your work and reasoning, of course) and we'll critique them.

BTW, it's not our job to disprove your garbage,  You claim it, you support it.

But you can't. It's a shame; that would be really fun.

{ABE} Your link does not provide any operational definitions or examples.


Posted by: The whole truth on Jan. 23 2016,08:20

Quote (Otangelo @ Jan. 23 2016,04:48)
   
Quote (ChemiCat @ Jan. 22 2016,10:29)
     

---------------------QUOTE-------------------
Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------



Jesus christ on a pogo stick.

Sorry, I saw that Ogre beat me to the exact questions I was going to ask.

So, Trollangelo, when can we expect your answers? And why should I have any fear of your baseless threats of eternity?
---------------------QUOTE-------------------


i have not threaten anyone. If you interpret it that way, its your business.

How do u know what i believe about eternity is baseless ? Ever died and came back and know now ?

a universe from nothing, or eternal >> impossible.
fine tuning of the universe by chance >> impossible
abiogenesis >> impossible
a mind from matter >> impossible
biodiversity through macro evolution ==>> impossible.

naturalism ==>> impossible

:O

a universe created by a eternal God >> possible.
fine tuning of the universe by a fine tuner >> possible
biogenesis >> possible
a mind from a mind >> possible
biodiversity through a creator ==>> possible.

theism ==>> possible

:)
---------------------QUOTE-------------------


Otangelo, how do you know that what you believe about eternity is not baseless? Have you ever died and been to eternity to verify your belief?

"a universe from nothing, or eternal >> impossible."

Why is a universe from nothing or eternal impossible, but your chosen, so-called "God", that you obviously believe is a fact, is (allegedly) from nothing and eternal?

"fine tuning of the universe by chance >> impossible"

Fine tuning for what, humans? The vast majority of the universe would kill humans, and most of Earth would too without protective gear, vessels, etc. And what's with the "chance" crap? Does anyone or everyone who doesn't believe as you do assert that everything is the result of only "chance"?

"abiogenesis >> impossible"

Why? How do you know?

"a mind from matter >> impossible"

Where was your mind before you were born?

"biodiversity through macro evolution ==>> impossible."

Define biodiversity and macro evolution.

"naturalism ==>> impossible"

Define naturalism.

"a universe created by a eternal God >> possible.
fine tuning of the universe by a fine tuner >> possible
biogenesis >> possible
a mind from a mind >> possible
biodiversity through a creator ==>> possible.

theism ==>> possible"

Which so-called "God", of the thousands of so-called 'Gods' that people have imagined, created the universe and how do you know? How do you know that "God" is eternal? How did/does "God" fine tune the universe and how do you know? How did "God" do biogenesis on Earth and how do you know? Did/does "God" do biogenesis throughout the universe or only on Earth and how do you know? If a mind comes from a mind, which mind did 'God's' mind come from and how do you know? Does a two headed human have two minds or one? Do slugs, dogs, chimpanzees, elephants, butterflies, dolphins, snakes, and plants have minds? Is "biodiversity through a creator" called Ra, Achamán, Zeus, or Tupã possible? Define theism, and is all theism possible?

Is it possible that an eternal pink unicorn created the universe?
Posted by: OgreMkV on Jan. 23 2016,10:33

Quote (Otangelo @ Jan. 23 2016,06:38)
Quote (OgreMkV @ Jan. 21 2016,20:16)
Quote (Otangelo @ Jan. 21 2016,16:23)
 
Quote (OgreMkV @ Jan. 20 2016,21:45)

---------------------QUOTE-------------------


   

---------------------QUOTE-------------------
Of course, a mind isn't requiredOf course, a mind isn't required, but your simplistic understanding does.
---------------------QUOTE-------------------



baseless assertion. Can you show me a example of coded, specified, complex information, that has not a intelligence as origin ?
---------------------QUOTE-------------------


Sure. But to provide the information you want... I need...

Define "coded, specified complex information"

What does "coded" mean in this context? What determines if some information is "coded" or not? Does meaning play any part in that?

What does "specified" mean in this context? Who does the specifying? With what tools and systems? How?

What does "complex" mean in this context? How do you measure complexity? What units? Why?

What does "information" mean in this context? How do you measure it? What units? Why?

What values of the above require a mind? What values do not require a mind? Why?

What is the "mind" that resulted in life as we know it? How do you know?

Also, I note you snipped all the questions AND ignored my challenge. Which I will repeat here for you...

Can you, Otangelo, determine the difference between coded, specified information and random information? I challenge you to do so.

If you cannot, then you have no possible way to determine the answers that you think you already know. If you can, and can do so reliably, then you will have a Nobel prize (or whatever the equivalent is) for mathematics waiting for you.

Just let me know when you are ready. I'll provide two strings. One random and one that is complex, coded, and specified.

eta: I have already provided the information that you requested, however, YOUR definitions seem to reject those systems. Therefore, without precise definitions of what you mean, nothing more can be done.

I'm willing to bet any amount of money that you've never even tried to define or measure those words you keep using.
---------------------QUOTE-------------------


< http://www.uncommondescent.com/intelli....erstand >
---------------------QUOTE-------------------


So you don't know either. Fair enough, then I would suggest you quit using the argument.

It's obvious to anyone who pays attention that no one at UD (including Dembski) knows what this stuff means... other than there is some arbitrary point that any random series of results will cross and therefore design (god).

It's been fun, but you have no idea what's going on.
Posted by: Otangelo on Jan. 23 2016,12:18

What a trashy place here. It even smells bad. Don 't know if i come back.
Posted by: Occam's Aftershave on Jan. 23 2016,12:29

Quote (Otangelo @ Jan. 23 2016,12:18)
What a trashy place here. It even smells bad. Don 't know if i come back.
---------------------QUOTE-------------------


When you leave the smell of your bullshit will leave with you.
Posted by: NoName on Jan. 25 2016,12:46

Quote (Otangelo @ Jan. 23 2016,13:18)
What a trashy place here. It even smells bad. Don 't know if i come back.
---------------------QUOTE-------------------


You have promised to leave before.
I thought there was something about not breaking promises in your 'big book of rules'?

On the other hand, if you're detecting aromas on specific web sites, seek professional help.  That's a sign of serious psychiatric disturbance.
If you ever want to mess with a psychologist/psychiatrist, use smell words when describing your take on rorschach images.

Back on topic -- how can we miss you if you won't leave?
Posted by: Henry J on Jan. 25 2016,13:58

It's smellamentary!
Posted by: OgreMkV on Jan. 25 2016,14:57

Quote (Otangelo @ Jan. 23 2016,12:18)
What a trashy place here. It even smells bad. Don 't know if i come back.
---------------------QUOTE-------------------


In other words, you can't answer any questions asked of you. It's making you look bad. And you're just going to leave instead. IN 3-4 months you will return continuing where you left off as if none of will remember (or hit the previous page button) and not ask you embarrassing questions again.

Typical.
Posted by: ChemiCat on Jan. 26 2016,02:42



---------------------QUOTE-------------------
What a trashy place here. It even smells bad. Don 't know if i come back.
---------------------QUOTE-------------------



Just a minute, Trollangelo, I'll open a window for you. Don't worry about smelling we are used to the stench of IDiots.

Now how about answering some questions...
Posted by: ChemiCat on Jan. 26 2016,02:48



---------------------QUOTE-------------------
I hope you will get the curve before its too late. Because then you will still enjoy a meaningful life here on earth, and a happy time in eternity.

---------------------QUOTE-------------------



Isn't that a threat, albeit a veiled one, of your Hell, Trollangelo?

It seems as though you are unable to understand your own words not just biology.
Posted by: Otangelo on Feb. 09 2016,21:06

Open questions in biology, biochemistry, and evolution

< http://reasonandscience.heavenforum.org/t2299-o....olution >

When methodological naturalism is applied, the only explanation for the origin of life is abiogenesis, and of biodiversity, Darwins Theory of evolution. Proponents repeat like a mantra : Evolution is a fact. If that were the case, there would exist far more convincing , clear scientific answers to  almost all relevant scientific questions and issues. This is far from being the case. Based on scientific papers, quite a different picture arises. Instead of compelling answers, questionmarks and lack of understanding, generalized ignorance in regard of almost all relevant issues,  and conceptual problems are the most common. Since the information is widely sparse and scattered amongst thousands of scientific papers, its not so evident that this is the factual state of matter. The general public is duped by effect slogans, that give the false impression of certainty of naturalism. The standard answer, when proponents of naturalism are confronted with this situation, is: "We are working on it". Or: "We don't know yet". As if naturalism would be the answer in the future, no matter what. Aren't these not a prima facie of  " evolution of the gaps" arguments ? The question is: If a certain line of reasoning  is not persuasive or convincing, or only leads to dead ends, then why do proponents of materialism not change their mind because of it? The more scientific papers are published, the less likely the scenario of evolution  and abiogenesis and cosmic evolution becomes. The gaps are NOT being closed. They widen more and more. Some evolutionary predictions have even been falsified. We should consider the fact that modern biology may have reached its limits on several key issues and subjects. All discussions on principal theories and experiments in the field either end in vague suppositions and guesswork, statements of blind faith, made up scenarios,  or in a confession of ignorance.  Fact is  there remains a huge gulf in our understanding… This lack of understanding is not just ignorance about some secondary details; it is a big conceptual gap.  The reach of the end of the road is evident in the matter of almost all major questions. The major questions of evolutionary novelties and abiogenesis  are very far from being clearly formulated, even understood,  and nowhere near being solved, and for most, there is no solution at all at sight. But proponents of evolution firmly believe, one day a solution will be found. It doesn't take a couple of month, and a new scientific paper with wild speculations about abiogenesis is published, and eagerly swallowed by the anscious public, that finally wants its preferred world view being confirmed.  We don't know yet, therefore evolution and abiogenesis ? That way, the design hypothesis remains out of the equation in the beginning, and out at the end, and never receives a serious and honest consideration. If the scientific evidence does not provide satisfactory explanations through naturalism, why should we not change your minds and look somewhere else ?  I see only one reason : there is a emotional commitment to naturalism. Reason is not on the side of the materialist. The believer in creation imho has good reasons to hold his world view. Reason is on his side. The evidence points massive in that direction. There is certainly the oponent just right on the corner, eagerly waiting to claim " argument of ignorance ". Because evolution is not true, intelligent design is ?! I suggest to read the answer here : < http://reasonandscience.heavenforum.org/t1983-i....norance >
Posted by: fnxtr on Feb. 09 2016,22:47

Well, that about wraps it up for biology then, doesn't it.

Otangelo clearly knows more than all the scientists who have ever lived. He sees what no-one else can.

Yawn.
Posted by: Cubist on Feb. 09 2016,23:43

Curious: In spite of the boldfacing, italics, and oversized letters, Otangelo apparently managed to miss the most-recent iteration of the two questions I'd like him to answer. Well… perhaps making them an attention-getting color will help…

Do you have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


As ever, I look forward to reading Otangelo's answers to my questions.
Posted by: Otangelo on Feb. 10 2016,04:40

Quote (Cubist @ Feb. 09 2016,23:43)
Curious: In spite of the boldfacing, italics, and oversized letters, Otangelo apparently managed to miss the most-recent iteration of the two questions I'd like him to answer. Well… perhaps making them an attention-getting color will help…

Do you have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


As ever, I look forward to reading Otangelo's answers to my questions.
---------------------QUOTE-------------------


Confirmation of intelligent design predictions

< http://reasonandscience.heavenforum.org/t1659-c....ictions >

In order to make design prediction, it must be established what can be recognized as design in nature :

Something having the PROPERTIES that we might attribute to that of a designed system:
1) IRREDUCIBLY COMPLEX
2) Acts as an informational processing systems, -
3) a system which uses some form of digital code, translated into instructions by another universal language translation (universal genetic code). This is LANGUAGE, MEANING.
4) Appearance of highly complex dependencies thus giving the appearence of Implicit intelligence (although not intelligent itself, indicates an origin involving intelligence.. )
5) use of molecular machinery on a scale and complexity which mankind has never IMAGINED possible - all with appearence of exact purpose, intent, function and dependencies
6) exhibiting logical functional layers - regulatory genes controlling gene expression - conceptually teh same as a logical software layer controlling teh underlying system.
7) another layer of complex 3 Dimensional control and access, and adaptation to environment: Epiogentics.
8  Implicit built in ERROR checking from the get go: reducing mutations to a minimal
9) Display the DESIGN of complex software, designed to adapt and EVOLVE in a very controlled and careful way - while at the same time minimizing mutations. A system designed to EVOLVE and SURVIVE. (gene splicing ) ..
10) Something which as well as exhibiting all of the above, also has no conceptual way of coming into existence through naturalistic means, : or something whose existence and origins appears to defy all known scientific understanding. Something which requires the application of alot of FAITH and IMAGINATION of some theories to describe its origins through natural means alone.
So the application of COMMON SENSE and inference, from observations from the world around us (information processing systems) might indicate to us certain things having these above PROPERTIES, would fall into the category of things that have been DESIGNED.
One of the most intelligent concepts in the known universe is the concept of Evolution itself.
Posted by: ChemiCat on Feb. 10 2016,07:04

And our Trollangelo is back after his last flounce. I wonder how long he will last this time before his sad arse cannot take any more kicking.

Trollangelo, what is "digital" about a DNA molecule? Does this mean that every chemical reaction is digital?

Please give us some evidence for your preposterous claims about molecules. (Not that I expect a reply as you have none to give.).
Posted by: ChemiCat on Feb. 10 2016,07:05

Now you have ignored my last questions please give us an example of irreducible complexity that has not yet been trashed.
Posted by: OgreMkV on Feb. 10 2016,08:28

In other words, you define "new information" to be "information which is created by god".

I should point out that, before you can use those properties of design, you first have to establish that a non-intelligent system cannot generate those properties.

1) It's already been shown that non-intelligent systems can result in irreducible complexity.

2) It's already been shown that non-intelligent systems can result in an information processing system.

3) Conflates information with meaning. Tell me does "Ph'nglui mglw'nafh Cthulhu R'lyeh wgah'nagl fhtagn." have meaning... even though you don't understand the language? Does EnCt24683abbf1d511ae4ba1af8e9fe0925375e0ba1714683abbf1d511ae4ba1af8e9kgpXKel=JgB
SAoBHu1ZPKhK7aPjUiH4kguGMWRmUdG9Gbo4ad8up4fUgNqCZE25n3zPDwrgpXi3ces3DcannlVs=IwE
mS
have meaning, even though you can't see it?

4) Known systems can generate complexity without intelligence. Of course, it also depends on how you define complexity. Jupiter is extremely complex.

5) So, mankind doesn't know a lot of things. You make this claim now, but in 15 years, will this statement still be valid?

6) Non-intelligently designed systems have done this.

7) You have no idea what epigenetics is do you?

8) This isn't even a real feature of biological systems.

9) In other words. It's designed because it evolves?!?!?

10) "also has no conceptual way of coming into existence through naturalistic means" THIS is what you have utterly failed to show. You have no way of judging this, especially with your limited understanding of reality.

11) COMMON SENSE is meaningless. If common sense controlled our universe, then the sun would orbit Earth and things like quantum physics wouldn't exist. But you don't understand that because that's all you have to use. You don't understand biology, chemistry, or physics. So you use the flawed concept of common sense, combined with a structured belief system that must come to a specific conclusion, mixing in your utter misunderstanding of high school level concepts and the result, as expected, is utter gibberish that you can't even talk intelligently about, much less support with evidence.

Decrypt it at < https://encipher.it/....pher.it >
Posted by: NoName on Feb. 10 2016,08:32

Quote (Otangelo @ Feb. 10 2016,05:40)
 
Quote (Cubist @ Feb. 09 2016,23:43)
Curious: In spite of the boldfacing, italics, and oversized letters, Otangelo apparently managed to miss the most-recent iteration of the two questions I'd like him to answer. Well… perhaps making them an attention-getting color will help…

Do you have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


As ever, I look forward to reading Otangelo's answers to my questions.
---------------------QUOTE-------------------


Confirmation of intelligent design predictions

< http://reasonandscience.heavenforum.org/t1659-c....ictions >

In order to make design prediction, it must be established what can be recognized as design in nature :

Something having the PROPERTIES that we might attribute to that of a designed system:
1) IRREDUCIBLY COMPLEX
---------------------QUOTE-------------------


Countless designs are not 'irreducibly complex'.  Countless manufactured items are not 'irreducibly complex'.  Insofar as the notion is coherent and useful, it is not a marker of design.
 

---------------------QUOTE-------------------
2) Acts as an informational processing systems, -
---------------------QUOTE-------------------

Vague to the point of meaninglessness.  What is 'information'?  The Amazon rain forest does an amazing job at processing the information it receives about temperature gradients.  It continually processes those temperature gradients so as to minimize them.
 

---------------------QUOTE-------------------
3) a system which uses some form of digital code, translated into instructions by another universal language translation (universal genetic code). This is LANGUAGE, MEANING.
---------------------QUOTE-------------------

Simply wrong-headed in the extreme.
Digital != language.  DNA is not a digital code.  Chemistry is not a digital code nor a language in any precise sense of the term.
 

---------------------QUOTE-------------------
4) Appearance of highly complex dependencies thus giving the appearence of Implicit intelligence (although not intelligent itself, indicates an origin involving intelligence.. )
---------------------QUOTE-------------------

Absurd -- you're begging the question.  This requires citations and  examples.  'Highly complex dependencies' is vague to the point of uselessness.  How is complexity measured?  At what point does it become 'highly complex' as opposed to merely 'complex'?  Appearance is not an intrinsic characteristic of external objects, events, or processes.  Things appear to intelligence as ...  The nature of the appearance is as heavily dependent on the perceiver as it is the thing perceived.
 

---------------------QUOTE-------------------
5) use of molecular machinery on a scale and complexity which mankind has never IMAGINED possible - all with appearence of exact purpose, intent, function and dependencies
---------------------QUOTE-------------------

Assumes the conclusion.  What is the difference between the various chemical reactions and systems of reactions such that some are 'machinery' and some are not?  You are being distracted and misled by analogies.  Bad analogies at that.
 

---------------------QUOTE-------------------
6) exhibiting logical functional layers - regulatory genes controlling gene expression - conceptually teh same as a logical software layer controlling teh underlying system.
---------------------QUOTE-------------------

Assuming your conclusion again.  Countless systems exhibit functional layers.  The weather system springs immediately to mind.  One could argue that it is inherent to systems that they exhibit functional layering.  Particularly so when one takes in the full range of phenomena to be accounted for -- sub-atomic particles to atoms to molecules to systems of molecules to systems of systems ...
 

---------------------QUOTE-------------------
7) another layer of complex 3 Dimensional control and access, and adaptation to environment: Epiogentics.
---------------------QUOTE-------------------

Not a proper point in and of itself.  When you can't even correctly spell the technical term for the phenomenon you are calling on for support,  you've already failed.
 

---------------------QUOTE-------------------
8  Implicit built in ERROR checking from the get go: reducing mutations to a minimal
---------------------QUOTE-------------------

Asserts facts not in evidence, requires citation, and most of all, requires support against the argument that systems, as such, have implicit functionality, that the mere presence (or absence) of this or that function is to be expected in the complex world of complex systems.
 

---------------------QUOTE-------------------
9) Display the DESIGN of complex software, designed to adapt and EVOLVE in a very controlled and careful way - while at the same time minimizing mutations. A system designed to EVOLVE and SURVIVE. (gene splicing ) ..
---------------------QUOTE-------------------

Assuming your conclusion.  This is not supportive of your point, it rather represents the challenge you and your ilk need to face up to -- you have to sh ow that the system was designed, was manufactured, and works as intended.  In this as in all such matters, this requires recourse to the designer -- these features cannot be read off the thing as such.
 

---------------------QUOTE-------------------
10) Something which as well as exhibiting all of the above, also has no conceptual way of coming into existence through naturalistic means, : or something whose existence and origins appears to defy all known scientific understanding. Something which requires the application of alot of FAITH and IMAGINATION of some theories to describe its origins through natural means alone.
---------------------QUOTE-------------------

Appeal to "we don't know the answer today therefore we'll never know the answer, there is no answer, buy my superstition please."  You have no explanation, nor any conceptual basis for an explanation of the phenomenon.
Worse, you have nothing but your own incredulity and prejudice as (failed) warrant for asserting, without support, that there are reactions or systems of reactions that are inherently impossible to nature  and yet occur.
What are they and how do you know?


---------------------QUOTE-------------------
So the application of COMMON SENSE and inference, from observations from the world around us (information processing systems) might indicate to us certain things having these above PROPERTIES, would fall into the category of things that have been DESIGNED.
One of the most intelligent concepts in the known universe is the concept of Evolution itself.
---------------------QUOTE-------------------


Your response was, as per usual, non-responsive.
The application of 'common sense' is starkly missing from your screed.  It's really more by way of a rant alongside an agenda rather than an argument, isn't it?

As always, boring fail.  You have nothing to suggest that naturalistic explanations cannot, in principle, address any of the concerns you copy/paste without comprehending.
Posted by: Cubist on Feb. 10 2016,08:59

Quote (Otangelo @ Feb. 10 2016,04:40)
   
Quote (Cubist @ Feb. 09 2016,23:43)
Curious: In spite of the boldfacing, italics, and oversized letters, Otangelo apparently managed to miss the most-recent iteration of the two questions I'd like him to answer. Well… perhaps making them an attention-getting color will help…

Do you have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

What does "new information" look like?


As ever, I look forward to reading Otangelo's answers to my questions.
---------------------QUOTE-------------------


Confirmation of intelligent design predictions

< http://reasonandscience.heavenforum.org/t1659-c....ictions >

In order to make design prediction, it must be established what can be recognized as design in nature :
---------------------QUOTE-------------------


You may be right. I await your answers to the two questions I've been asking.
 

---------------------QUOTE-------------------
Something having the PROPERTIES that we might attribute to that of a designed system:
1) IRREDUCIBLY COMPLEX
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
2) Acts as an informational processing systems, -
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
3) a system which uses some form of digital code, translated into instructions by another universal language translation (universal genetic code). This is LANGUAGE, MEANING.
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
4) Appearance of highly complex dependencies thus giving the appearence of Implicit intelligence (although not intelligent itself, indicates an origin involving intelligence.. )
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
5) use of molecular machinery on a scale and complexity which mankind has never IMAGINED possible - all with appearence of exact purpose, intent, function and dependencies
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
6) exhibiting logical functional layers - regulatory genes controlling gene expression - conceptually teh same as a logical software layer controlling teh underlying system.
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
7) another layer of complex 3 Dimensional control and access, and adaptation to environment: Epiogentics.
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
8  Implicit built in ERROR checking from the get go: reducing mutations to a minimal
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
9) Display the DESIGN of complex software, designed to adapt and EVOLVE in a very controlled and careful way - while at the same time minimizing mutations. A system designed to EVOLVE and SURVIVE. (gene splicing ) ..
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
10) Something which as well as exhibiting all of the above, also has no conceptual way of coming into existence through naturalistic means, : or something whose existence and origins appears to defy all known scientific understanding. Something which requires the application of alot of FAITH and IMAGINATION of some theories to describe its origins through natural means alone.
---------------------QUOTE-------------------


This bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.
 

---------------------QUOTE-------------------
So the application of COMMON SENSE and inference, from observations from the world around us (information processing systems) might indicate to us certain things having these above PROPERTIES, would fall into the category of things that have been DESIGNED.
One of the most intelligent concepts in the known universe is the concept of Evolution itself.
---------------------QUOTE-------------------


And, finally, this bit is neither evidence that "information-rich" systems can be produced by non-human intelligent agents, nor an explanation of how one can recognize "new information" when one sees it.

At this point, I think it appropriate to remind you that I have never disputed the proposition that "intelligent agents" can produce "information-rich systems", nor have I ever disputed that there is, indeed, plenty of evidence to support the proposition that "intelligent agents" can produce "information-rich systems".

What I have done, instead, is point out that we have plenty of evidence that "information-rich systems" have been produced by the specific class of "intelligent agents" known as human beings, and, further, that we have no evidence of "information-rich systems" ever having been produced by any "intelligent agents" other than human beings. How, then, can any "system" which existed prior to the emergence of humans, be an "information-rich system"? Are you arguing for time-travel, perhaps?

Likewise, it's appropriate to remind you that I have never disputed the proposition that "new information" exists;; I have, instead, asked you to explain how you recognize this 'new information' stuff when you see it. Since a part of your argumentation is apparently dependent on the properties of "new information", I would have thought that you'd be able to explain how the heck you recognize it when you see it…
Posted by: Otangelo on Feb. 10 2016,16:56

Quote (ChemiCat @ Feb. 10 2016,07:05)
Now you have ignored my last questions please give us an example of irreducible complexity that has not yet been trashed.
---------------------QUOTE-------------------


A list of irreducible complex systems

< http://reasonandscience.heavenforum.org/t2166-a....systems >
Posted by: Otangelo on Feb. 10 2016,17:01

Quote (OgreMkV @ Feb. 10 2016,08:28)
In other words, you define "new information" to be "information which is created by god".

I should point out that, before you can use those properties of design, you first have to establish that a non-intelligent system cannot generate those properties.

1) It's already been shown that non-intelligent systems can result in irreducible complexity.

2) It's already been shown that non-intelligent systems can result in an information processing system.

3) Conflates information with meaning. Tell me does "Ph'nglui mglw'nafh Cthulhu R'lyeh wgah'nagl fhtagn." have meaning... even though you don't understand the language? Does EnCt24683abbf1d511ae4ba1af8e9fe0925375e0ba1714683abbf1d511ae4ba1af8e9kgpXKel=JgB
SAoBHu1ZPKhK7aPjUiH4kguGMWRmUdG9Gbo4ad8up4fUgNqCZE25n3zPDwrgpXi3ces3DcannlVs=IwE
mS
have meaning, even though you can't see it?

4) Known systems can generate complexity without intelligence. Of course, it also depends on how you define complexity. Jupiter is extremely complex.

5) So, mankind doesn't know a lot of things. You make this claim now, but in 15 years, will this statement still be valid?

6) Non-intelligently designed systems have done this.

7) You have no idea what epigenetics is do you?

8) This isn't even a real feature of biological systems.

9) In other words. It's designed because it evolves?!?!?

10) "also has no conceptual way of coming into existence through naturalistic means" THIS is what you have utterly failed to show. You have no way of judging this, especially with your limited understanding of reality.

11) COMMON SENSE is meaningless. If common sense controlled our universe, then the sun would orbit Earth and things like quantum physics wouldn't exist. But you don't understand that because that's all you have to use. You don't understand biology, chemistry, or physics. So you use the flawed concept of common sense, combined with a structured belief system that must come to a specific conclusion, mixing in your utter misunderstanding of high school level concepts and the result, as expected, is utter gibberish that you can't even talk intelligently about, much less support with evidence.

Decrypt it at < https://encipher.it/....phe....pher.it >
---------------------QUOTE-------------------


1) It's already been shown that non-intelligent systems can result in irreducible complexity.

show me.

2) It's already been shown that non-intelligent systems can result in an information processing system.

show me how the software and hardware of the cell could arise without intelligence.

3) Paul Davies: Although DNA is a material structure, it is pregnant with meaning. The arrangement of the atoms along the helical strands of your DNA determines how you look and even, to a certain extent, how you feel and behave. DNA is nothing less than a blueprint—or, more accurately, an algorithm or instruction manual—for building a living, breathing, thinking human being.

Where does biological information come from?

4) the cell is the most complex factory in the universe. How could it arise without intelligence ?

5) yes, we will discover that there will be even more questions than answers.

6) show me.

7) Epigenetics

< http://reasonandscience.heavenforum.org/t2098-e....enetics >



The argument of the genetic piano
1. Dr. Kohzoh Mitsuya [University of Texas Health Science Center] who studies genes says the work of epigenetics “corresponds to a pianist playing a piece of music. Like keys on a piano, DNA is the static blueprint for all the proteins that cells produce.”
2. “Epigenetic information provides additional dynamic or flexible instructions as to how, where and when the blueprint will be used.”
3. After watching the response of mice deficient in the RNA, he said, “It shows how one note is played on the piano. The symphony has only just come into view. We can hear it, but we need to learn how all the parts are being played.”
4. Here the questions are: who’s the pianist and who’s the conductor?
5. The environment cannot be the musician; it is oblivious to the needs of the organism.  Heredity cannot be the musician; it has no foresight to read or comprehend a collection of processes organized into a work.
6. Thus, this discovery and explanation of Dr. Mitsuya causes trouble for Darwin while it fits precisely into the intelligent design theory.
7. There must be an origin of the information required to produce function.
8. A classical answer to this by the evolutionists is: “this evolved, that’s why it is there.”
9. Answering this we say: “Science is supposed to seek efficient causes, not just-so stories or appeals to chance based on circular reasoning. For example, in his book The Making of the Fittest, Sean Carroll writes “the degree of similarity in DNA is an index of the [evolutionary] relatedness of species.” [98] This can only make sense if we first assume evolution is true. But Carroll’s book is a defense of evolution, intended to demonstrate that the theory is true without first assuming it is true. He seeks to prove evolution is true, but he begins with evolutionary reasoning and interpretations. That is circular reasoning.”
10. The alternative and only explanation is therefore intelligent design with a known cause sufficient to produce functional information: intelligence. Only intelligence can organize atoms or building blocks into order and activities. There is no other experience of anything else putting things into order and motion.
11. Intelligent design means intelligence of the greatest scientist all men call God.
12. God exists.
Posted by: OgreMkV on Feb. 10 2016,17:51

Quote (Otangelo @ Feb. 10 2016,17:01)

---------------------QUOTE-------------------


"show me"

I already have. You don't accept it. That's not my problem.

"4) the cell is the most complex factory in the universe. How could it arise without intelligence ? "

Here's the main problem. YOU can't understand how it could arise without intelligence. Therefore, it requires an intelligence.

Flawed argument is flawed.

"yes, we will discover that there will be even more questions than answers. "

Of course we will. It's called science. Your "intelligence" stops all questions and answers.

You use a bad analogy written in a press release to argue that god exists. You are truly a dizzying intellect.
Posted by: Otangelo on Feb. 10 2016,17:57

Quote (OgreMkV @ Feb. 10 2016,17:51)
"4) the cell is the most complex factory in the universe. How could it arise without intelligence ? "

Here's the main problem. YOU can't understand how it could arise without intelligence. Therefore, it requires an intelligence.
---------------------QUOTE-------------------


Not only i can't understand it. The whole scientific community can't. For obvious reasons. The cell is irreducible complex. If even one protein, like topoisomerase is missing, the cell dies. Abiogenesis is impossible to the extreme. But since a creator does not fit your wished world view without God, no matter what, the evidence is rejected and neglected.
Posted by: OgreMkV on Feb. 10 2016,18:22

Quote (Otangelo @ Feb. 10 2016,17:57)
Quote (OgreMkV @ Feb. 10 2016,17:51)
"4) the cell is the most complex factory in the universe. How could it arise without intelligence ? "

Here's the main problem. YOU can't understand how it could arise without intelligence. Therefore, it requires an intelligence.
---------------------QUOTE-------------------


Not only i can't understand it. The whole scientific community can't. For obvious reasons. The cell is irreducible complex. If even one protein, like topoisomerase is missing, the cell dies. Abiogenesis is impossible to the extreme. But since a creator does not fit your wished world view without God, no matter what, the evidence is rejected and neglected.
---------------------QUOTE-------------------


So, what you're saying is that the only known intelligence can't do what you say must be done by an intelligent designer.

LOL

There is no evidence for a designer. Incredulity is not evidence.
Posted by: Otangelo on Feb. 10 2016,20:07

Quote (OgreMkV @ Feb. 10 2016,18:22)
Quote (Otangelo @ Feb. 10 2016,17:57)
Quote (OgreMkV @ Feb. 10 2016,17:51)
"4) the cell is the most complex factory in the universe. How could it arise without intelligence ? "

Here's the main problem. YOU can't understand how it could arise without intelligence. Therefore, it requires an intelligence.
---------------------QUOTE-------------------


Not only i can't understand it. The whole scientific community can't. For obvious reasons. The cell is irreducible complex. If even one protein, like topoisomerase is missing, the cell dies. Abiogenesis is impossible to the extreme. But since a creator does not fit your wished world view without God, no matter what, the evidence is rejected and neglected.
---------------------QUOTE-------------------


So, what you're saying is that the only known intelligence can't do what you say must be done by an intelligent designer.

LOL

There is no evidence for a designer. Incredulity is not evidence.
---------------------QUOTE-------------------


Keep your self delusion. The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
Posted by: OgreMkV on Feb. 10 2016,20:41

Quote (Otangelo @ Feb. 10 2016,20:07)
Quote (OgreMkV @ Feb. 10 2016,18:22)
Quote (Otangelo @ Feb. 10 2016,17:57)
 
Quote (OgreMkV @ Feb. 10 2016,17:51)
"4) the cell is the most complex factory in the universe. How could it arise without intelligence ? "

Here's the main problem. YOU can't understand how it could arise without intelligence. Therefore, it requires an intelligence.
---------------------QUOTE-------------------


Not only i can't understand it. The whole scientific community can't. For obvious reasons. The cell is irreducible complex. If even one protein, like topoisomerase is missing, the cell dies. Abiogenesis is impossible to the extreme. But since a creator does not fit your wished world view without God, no matter what, the evidence is rejected and neglected.
---------------------QUOTE-------------------


So, what you're saying is that the only known intelligence can't do what you say must be done by an intelligent designer.

LOL

There is no evidence for a designer. Incredulity is not evidence.
---------------------QUOTE-------------------


Keep your self delusion. The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------


Fantastic. As requested dozens of times, provide evidence that a mind that COULD make it actually EXISTS.

The existence of a thing is not evidence of a designer of the thing.
Posted by: Cubist on Feb. 11 2016,16:16

Quote (Otangelo @ Feb. 10 2016,20:07)
The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------


I quote you, from one of your earliest posts in this thread: "We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…" However, the only "intelligent agents" which we actually do have "broad and repeated experience" of their "produc[ing] information-rich systems" are human beings.

In the absence of time-travel, it's clearly absurd to suppose that human beings could have created something which existed before any human being was born. Please provide evidence that "intelligent agents" other than human beings have created "information-rich systems". If you can't won't do that, please provide evidence that human beings have time-traveled to any era before any human being was born.
Posted by: Otangelo on Feb. 15 2016,10:25

Quote (Cubist @ Feb. 11 2016,16:16)
Quote (Otangelo @ Feb. 10 2016,20:07)
The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------


I quote you, from one of your earliest posts in this thread: "We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…" However, the only "intelligent agents" which we actually do have "broad and repeated experience" of their "produc[ing] information-rich systems" are human beings.

In the absence of time-travel, it's clearly absurd to suppose that human beings could have created something which existed before any human being was born. Please provide evidence that "intelligent agents" other than human beings have created "information-rich systems". If you can't won't do that, please provide evidence that human beings have time-traveled to any era before any human being was born.
---------------------QUOTE-------------------


well, of course God is not a human being.
Posted by: jeffox on Feb. 15 2016,11:56

Some loser quipped, "

---------------------QUOTE-------------------
Keep your self delusion. The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------



And, yet, that's exactly what the evidence shows.  Going against the evidence is irrational.  Show us god, then show us god did it.  Otherwise, you fail.
Posted by: OgreMkV on Feb. 15 2016,17:03

Quote (Otangelo @ Feb. 15 2016,10:25)
Quote (Cubist @ Feb. 11 2016,16:16)
Quote (Otangelo @ Feb. 10 2016,20:07)
The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------


I quote you, from one of your earliest posts in this thread: "We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…" However, the only "intelligent agents" which we actually do have "broad and repeated experience" of their "produc[ing] information-rich systems" are human beings.

In the absence of time-travel, it's clearly absurd to suppose that human beings could have created something which existed before any human being was born. Please provide evidence that "intelligent agents" other than human beings have created "information-rich systems". If you can't won't do that, please provide evidence that human beings have time-traveled to any era before any human being was born.
---------------------QUOTE-------------------


well, of course God is not a human being.
---------------------QUOTE-------------------


Feel free to provide evidence that ANY non-human intelligence exists.

Feel free to provide evidence that ANY non-human intelligence did all the things you say evolution can't.

Feel free to provide evidence that ANY deity exists.
Posted by: Cubist on Feb. 16 2016,07:18

Quote (Otangelo @ Feb. 15 2016,10:25)
 
Quote (Cubist @ Feb. 11 2016,16:16)
 
Quote (Otangelo @ Feb. 10 2016,20:07)
The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------


I quote you, from one of your earliest posts in this thread: "We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…" However, the only "intelligent agents" which we actually do have "broad and repeated experience" of their "produc[ing] information-rich systems" are human beings.

In the absence of time-travel, it's clearly absurd to suppose that human beings could have created something which existed before any human being was born. Please provide evidence that "intelligent agents" other than human beings have created "information-rich systems". If you can't won't do that, please provide evidence that human beings have time-traveled to any era before any human being was born.
---------------------QUOTE-------------------


well, of course God is not a human being.
---------------------QUOTE-------------------


That's nice.

If you want to believe the religious notion that your favorite deity-of-choice created life, go for it. Have a ball. But if you want to argue that my favorite deity-of-choice created life is an honest-to-Bacon scientific theory, well, you're gonna have to pony up some, you know, actual evidence in support of your soi-disant 'scientific theory'. Well, you're gonna have to do that if you want real scientists to take your 'theory' seriously.

I ask, one more time: Do you have any evidence that "intelligent agents" other than human beings have created "information-rich systems"?

And, lest my other question be forgotten: What does "new information" look like?
Posted by: ChemiCat on Feb. 16 2016,10:01



---------------------QUOTE-------------------
Feel free to provide evidence that ANY non-human intelligence exists.

Feel free to provide evidence that ANY non-human intelligence did all the things you say evolution can't.

Feel free to provide evidence that ANY deity exists.

---------------------QUOTE-------------------



I'll just add

Feel free to flounce back to your god-bubble, IDiot.
Posted by: Otangelo on Mar. 03 2016,16:26

Quote (jeffox @ Feb. 15 2016,11:56)
Some loser quipped, "

---------------------QUOTE-------------------
Keep your self delusion. The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------



And, yet, that's exactly what the evidence shows.  Going against the evidence is irrational.  Show us god, then show us god did it.  Otherwise, you fail.
---------------------QUOTE-------------------


Show me nothing did it. Otherwise, you fail.
Posted by: Otangelo on Mar. 03 2016,17:22

Where Do Complex Organisms Come From?

< http://reasonandscience.heavenforum.org/t2316-w....me-from >
Posted by: NoName on Mar. 03 2016,18:18

Quote (Otangelo @ Mar. 03 2016,18:22)
Where Do Complex Organisms Come From?

< http://reasonandscience.heavenforum.org/t2316-w....me-from >
---------------------QUOTE-------------------


When a complex organism mommy and a complex organism daddy love each other very much, they hug each other in a special way and months later a baby complex organism is born.
The stork is a myth.
(So are immaterial causal agents.)
Posted by: OgreMkV on Mar. 03 2016,18:42

Quote (Otangelo @ Mar. 03 2016,16:26)
Quote (jeffox @ Feb. 15 2016,11:56)
Some loser quipped, "  

---------------------QUOTE-------------------
Keep your self delusion. The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------



And, yet, that's exactly what the evidence shows.  Going against the evidence is irrational.  Show us god, then show us god did it.  Otherwise, you fail.
---------------------QUOTE-------------------


Show me nothing did it. Otherwise, you fail.
---------------------QUOTE-------------------


Again. We have. The fact that you refuse to accept scientific evidence is your problem. Not ours.

This thread is full of examples of complex systems arising WITHOUT intelligent agents. You can't accept that, so you ignore it. You flounce off and come back 3-4 weeks later repeating the same thing, getting the same response, and ignoring it.

It's a shame really. You are so hypocritical. You use the tools given to you by science in an attempt to show that science is wrong.

You have already failed. By allowing other humans, who are not trustworthy, to do your thinking for you. You believe their words so much, that you refuse to accept reality. You live in a straight- jacket of your own making.
Posted by: ChemiCat on Mar. 04 2016,03:13



---------------------QUOTE-------------------
You live in a straight- jacket provided by the institution
---------------------QUOTE-------------------



FTFY, Ogre.

This would explain why his posts are 3-4 weeks apart, they allow internet access whilst they change the jacket. It keeps him calm.
Posted by: Cubist on Mar. 04 2016,06:52

Quote (Otangelo @ Mar. 03 2016,16:26)
 
Quote (jeffox @ Feb. 15 2016,11:56)
Some loser quipped, "    

---------------------QUOTE-------------------
Keep your self delusion. The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------


And, yet, that's exactly what the evidence shows.  Going against the evidence is irrational.  Show us god, then show us god did it.  Otherwise, you fail.
---------------------QUOTE-------------------


Show me nothing did it. Otherwise, you fail.
---------------------QUOTE-------------------


Hello, Otangelo! Good to see you again. On the off chance that this comment wasn't just a drive-by, I again ask you those two questions you have occasionaly replied to, but never yet answered:

Do you have any evidence that "intelligent agents" other than human beings have created "information-rich systems"?

What does "new information" look like?
Posted by: RumraketR on Mar. 04 2016,07:29

Quote (OgreMkV @ Feb. 10 2016,18:22)

---------------------QUOTE-------------------


Quote (Otangelo @ Feb. 10 2016,17:57)
Not only i can't understand it. The whole scientific community can't.
---------------------QUOTE-------------------


I can. The whole community of evolutionary biology understands it.

Quote (Otangelo @ Feb. 10 2016,17:57)
For obvious reasons. The cell is irreducible complex.
---------------------QUOTE-------------------


It is an observational fact that irreducibly complex systems routinely evolve.

If there were no irreducibly complex systems in existence, then the theory of evolution would be false, because they are unambigously predicted to result from the evolutionary process. We even know HOW IC systems evolve. They start by NOT being indispensible, but become gradually incorporated into systems and structures that were themselves ALSO once upon a time, dispensible, but have since become indispensible by the same process.


Quote (Otangelo @ Feb. 10 2016,17:57)
If even one protein, like topoisomerase is missing, the cell dies.
---------------------QUOTE-------------------


This is actually false as Larry Moran PROVED to you on this blog with references.

Topoisomerases originated before genomes were so large that DNA winding was a lethal problem, and gradually co-evolved with the expansion of the winding stretches of the genome.

Quote (Otangelo @ Feb. 10 2016,17:57)
Abiogenesis is impossible to the extreme.
---------------------QUOTE-------------------


Impossibility is a binary property. Something is either impossible or it is not. There is no degree of impossibility. Besides, there is absolutely zero evidence that abiogenesis is impossible and in fact there is evidence from physics that abiogenesis IS possible. According to statistical mechanics, living organisms are just another unlikely microstate of matter. Which means that, statistically speaking, they are still possible, just very very unlikely to arise spontaneously.

But unlikely =/= (that sign means "does not equal") impossible.

I'll repeat for the benefit of your subnormal encephalization:
Unlikely =/= impossible
Unlikely does not equal impossible
Unlikely is not equal to impossible
What is unlikely is not impossible

Abiogenesis by spontaneous generation is only unlikely, it is not impossible.

There are many options that are much much more likely than spontaneous generation. Likelihood depends on already occupied microstates. There could be a gradual progression of microstates from the unliving to the living states. This is strictly speaking also possible according to statistical mechanics.

All of science refutes the assertion that the origin of life is impossible. The origin of life is NOT impossible, the origin of life is possible.

Quote (Otangelo @ Feb. 10 2016,17:57)
But since a creator does not fit your wished world view without God
---------------------QUOTE-------------------


I would like for there to be a god. I really wish God existed, because I don't want to die. I also want to meet again, long lost and much loved family members. I do not believe in God because I don't want to, I do not believe in God becuase the intellectual and evidential case for the existence of God is too weak to be believed rationally.

Quote (Otangelo @ Feb. 10 2016,17:57)
no matter what, the evidence is rejected and neglected.
---------------------QUOTE-------------------


But you have not brought any evidence. All your arguments suffer form fundamental logical flaws and fallacies. The reason your are failing to produce God-belief in any of us is that your arguments and your evidence is insufficient to justify rational belief.
Posted by: NoName on Mar. 04 2016,07:31

Some other things for Otangelo to consider and provide input on [as if]:
What is the opposite of design?  What is the alternative to design as an 'explanation' for the existence of new things?

Design as it is usually taken is quite distinct from manufacture.  It is trivially true that many things are designed but never created.  It is equally true that many things are created but not designed in advance.
Thus the question -- how is it proper to speak of design as a mechanism that produces anything but designs?  

IOW, 'Design'?  You keep using that word but I don't think you know what it means.  Precision in terminology and thought is critically important.
What, specifically, do you mean by 'design'?
Posted by: RumraketR on Mar. 04 2016,07:35

Quote (Otangelo @ Mar. 03 2016,16:26)
Quote (jeffox @ Feb. 15 2016,11:56)
Some loser quipped, "  

---------------------QUOTE-------------------
Keep your self delusion. The cell is too complex to be re-created by man. And to say that the most compex factory on earth does not require a mind to make it, is irrational to the extreme.
---------------------QUOTE-------------------



And, yet, that's exactly what the evidence shows.  Going against the evidence is irrational.  Show us god, then show us god did it.  Otherwise, you fail.
---------------------QUOTE-------------------


Show me nothing did it. Otherwise, you fail.
---------------------QUOTE-------------------


I don't believe that "nothing" did anything. As such, there is a serious issue with you asking us to demonstrate "nothing" doing anything, because you are asking us to evidentially support a proposition none of us hold.

You should learn logic before you engage in debate.
Posted by: RumraketR on Mar. 04 2016,07:36

Quote (Otangelo @ Mar. 03 2016,17:22)
Where Do Complex Organisms Come From?

< http://reasonandscience.heavenforum.org/t2316-w....me-from >
---------------------QUOTE-------------------


They evolved gradually.

http://www.talkorigins.org/faqs....RL=http
Posted by: k.e.. on Mar. 05 2016,10:07

Quote (Otangelo @ Mar. 04 2016,01:22)
Where Do Complex Organisms Come From?

< http://reasonandscience.heavenforum.org/t2316-w....me-from >
---------------------QUOTE-------------------


Is that the best you can do?

Link to a foreskin collection site?

< You sir are laboring under an illusion. >


Posted by: Otangelo on Mar. 12 2016,22:16

Quote (RumraketR @ Mar. 04 2016,07:29)
It is an observational fact that irreducibly complex systems routinely evolve.
---------------------QUOTE-------------------


Its a observational fact that you never learn.
Posted by: Otangelo on Mar. 12 2016,22:18

Quote (RumraketR @ Mar. 04 2016,07:35)
I don't believe that "nothing" did anything.
---------------------QUOTE-------------------


Learn your own position before you engage.
Posted by: Otangelo on Mar. 12 2016,22:19

Quote (RumraketR @ Mar. 04 2016,07:36)
They evolved gradually.

<a href="http://www.talkorigins.org/faqs/comdesc/< http://www.talkorigins.org/faqs.......comdesc >" target="_blank">http://www.talkorigins.org/faqs....RL=http</a>
---------------------QUOTE-------------------


Its stupid, that hurts......
Posted by: OgreMkV on Mar. 12 2016,22:56

Oh goody. It's back right before I leave on vacation. I bet I miss a great Friday meltdown too.

I'm really glad that you know our position on topics better than we do.

Perhaps, you should look up at the top of this page and answer the dozen or so outstanding questions you refuse to deal with.
Posted by: Cubist on Mar. 12 2016,23:31

Quote (Otangelo @ Mar. 12 2016,22:16)
 
Quote (RumraketR @ Mar. 04 2016,07:29)
It is an observational fact that irreducibly complex systems routinely evolve.
---------------------QUOTE-------------------


Its a observational fact that you never learn.
---------------------QUOTE-------------------


Hello, Otangelo! I see that you have, once again, overlooked my two as-yet-unanswered questions. Let's see if making them larger will help you see them:

Do you have any evidence that "intelligent agents" other than human beings have created "information-rich systems"?

What does "new information" look like?

Posted by: Otangelo on Mar. 13 2016,10:54

Quote (Cubist @ Mar. 12 2016,23:31)
Quote (Otangelo @ Mar. 12 2016,22:16)
   
Quote (RumraketR @ Mar. 04 2016,07:29)
It is an observational fact that irreducibly complex systems routinely evolve.
---------------------QUOTE-------------------


Its a observational fact that you never learn.
---------------------QUOTE-------------------


Hello, Otangelo! I see that you have, once again, overlooked my two as-yet-unanswered questions. Let's see if making them larger will help you see them:

Do you have any evidence that "intelligent agents" other than human beings have created "information-rich systems"?

What does "new information" look like?

---------------------QUOTE-------------------


Its enough to infer that  "intelligent agents" other than human beings have created "information-rich systems, based on the facts, that ONLY INTELLIGENT AGENTS ARE ABLE TO CREATE INFORMATION RICH, COMPLEX, SPECIFIED CODES. Since DNA stores that kind of information, and evidently it were not humans creating it, that there is other intelligence around beside us. Much more intelligent agents, btw.
Posted by: NoName on Mar. 13 2016,11:53

Quote (Otangelo @ Mar. 13 2016,11:54)
Quote (Cubist @ Mar. 12 2016,23:31)
Quote (Otangelo @ Mar. 12 2016,22:16)
   
Quote (RumraketR @ Mar. 04 2016,07:29)
It is an observational fact that irreducibly complex systems routinely evolve.
---------------------QUOTE-------------------


Its a observational fact that you never learn.
---------------------QUOTE-------------------


Hello, Otangelo! I see that you have, once again, overlooked my two as-yet-unanswered questions. Let's see if making them larger will help you see them:

Do you have any evidence that "intelligent agents" other than human beings have created "information-rich systems"?

What does "new information" look like?

---------------------QUOTE-------------------


Its enough to infer that  "intelligent agents" other than human beings have created "information-rich systems, based on the facts, that ONLY INTELLIGENT AGENTS ARE ABLE TO CREATE INFORMATION RICH, COMPLEX, SPECIFIED CODES. Since DNA stores that kind of information, and evidently it were not humans creating it, that there is other intelligence around beside us. Much more intelligent agents, btw.
---------------------QUOTE-------------------


Asserts facts unsupported by evidence.
The best you've been able to do is show you do not understand probability.
Incredibly improbable things happen All the time.
Improbable does not equal impossible.  Ever.
Posted by: Woodbine on Mar. 13 2016,13:26

Quote (Otangelo @ Mar. 13 2016,16:54)
Since DNA stores that kind of information, and evidently it were not humans creating it, that there is other intelligence around beside us. Much more intelligent agents, btw.
---------------------QUOTE-------------------


Can these agents levitate stuff? (asking for a friend)
Posted by: fnxtr on Mar. 13 2016,13:32

Also, otangelo, your ignorance is not evidence. Ever.
Posted by: Texas Teach on Mar. 13 2016,13:53

Quote (fnxtr @ Mar. 13 2016,13:32)
Also, otangelo, your ignorance is not evidence. Ever.
---------------------QUOTE-------------------


It's evident, just not evidence.
Posted by: Otangelo on Mar. 13 2016,14:11

Quote (NoName @ Mar. 13 2016,11:53)
Incredibly improbable things happen All the time.
Improbable does not equal impossible.  Ever.
---------------------QUOTE-------------------


Asserts facts unsupported by evidence.
Posted by: stevestory on Mar. 13 2016,15:27

Asserts basic understanding of probability.
Posted by: NoName on Mar. 13 2016,17:09

Quote (Otangelo @ Mar. 13 2016,15:11)
Quote (NoName @ Mar. 13 2016,11:53)
Incredibly improbable things happen All the time.
Improbable does not equal impossible.  Ever.
---------------------QUOTE-------------------


Asserts facts unsupported by evidence.
---------------------QUOTE-------------------


Really?
You truly have no clue about statistics and probability then.
Probability 0 is impossible.  Any other probability can, by definition, occur.
Improbable does not equal impossible.  Go ahead, provide some evidence that this is wrong.
I present the entire universe and all things in it as evidence of the truth of my claim.  I stand by it until and unless one of you hopeless cretins comes up with some evidence.

Consider a standard contract bridge hand.  Calculate the odds of getting any given hand, in the given order.
You'll be amazed.
Then consider the odds of all the atoms that make up your body actually being the molecules that make up your body rather than any of the other molecules in existence.
Again, you'll be amazed.

What you have to show, and cannot, is that there is some chemical or physical transition in living beings that is impossible, not just improbable.
But there's no magic there.  There's just physics and chemistry.  They suffice.
No matter how incredulous you are, you have quite literally nothing other than your incredulity to support your tawdry little fantasies.
Posted by: Cubist on Mar. 14 2016,18:43

Quote (Otangelo @ Mar. 13 2016,10:54)
   
Quote (Cubist @ Mar. 12 2016,23:31)
   
Quote (Otangelo @ Mar. 12 2016,22:16)
       
Quote (RumraketR @ Mar. 04 2016,07:29)
It is an observational fact that irreducibly complex systems routinely evolve.
---------------------QUOTE-------------------


Its a observational fact that you never learn.
---------------------QUOTE-------------------


Hello, Otangelo! I see that you have, once again, overlooked my two as-yet-unanswered questions. Let's see if making them larger will help you see them:

Do you have any evidence that "intelligent agents" other than human beings have created "information-rich systems"?

What does "new information" look like?

---------------------QUOTE-------------------


Its enough to infer that  "intelligent agents" other than human beings have created "information-rich systems, based on the facts, that ONLY INTELLIGENT AGENTS ARE ABLE TO CREATE INFORMATION RICH, COMPLEX, SPECIFIED CODES.
---------------------QUOTE-------------------


Hold it. How do you know that "ONLY INTELLIGENT AGENTS ARE ABLE TO CREATE INFORMATION RICH, COMPLEX, SPECIFIED CODES"? If you're going by what we humans have actual evidence for… and up to now, you have been, explicitly, going by what we humans have actual evidence for… that evidence is not about the unspecific general class 'intelligent agents'; rather, that evidence is about one fairly specific instance of the general class 'intelligent agents', said instance being human beings. So, if you are, indeed, going by what we have actual evidence for, you're saying "ONLY [HUMAN BEINGS] ARE ABLE TO CREATE INFORMATION RICH, COMPLEX, SPECIFIED CODES".

If, on t'other hand, you're not going by what we humans have actual evidence for, you've got some 'splaining to do.

 

---------------------QUOTE-------------------
Since DNA stores that kind of information,
---------------------QUOTE-------------------


So far, so good…

 

---------------------QUOTE-------------------
and evidently it were not humans creating it,
---------------------QUOTE-------------------


Yes…

 

---------------------QUOTE-------------------
[we can infer] that there is other intelligence around beside us.
---------------------QUOTE-------------------


Wrong-o, Zombie Lips! If a given thing cannot have been created by human beings, we can infer that whatever-it-is must have been created by something else; absent any information about the nature of that "something else", we cannot infer that that "something else" was an intelligent agent.

So… your answer to "Do you have any evidence that 'intelligent agents' other than human beings have created 'information-rich systems'?" is Nope, I sure don't have any such evidence. Okay, I won't ask you that question again unless you retract your answer.

Alas, still no answer to the question "What does 'new information' look like?"
Posted by: Henry J on Mar. 14 2016,22:15

Maybe it's like old information, but with a "wet paint" sign?
Posted by: Otangelo on May 03 2016,19:18

The key process that produces oxygen in the atmosphere is due to the oxygen-evolving complex (OEC) , which splits water molecules and subsequently releases molecular oxygen. This process, which occurs in photosystem II (PSII), is driven by the conversion of visible light to chemical energy. Electrons oxidize water, which leads to the evolution of molecular oxygen and the release of protons into the thylakoid lumen. This proton gradient is a major contributor to the proton motive force used to biosynthesize ATP from ADP via ATP synthase.

The OEC is composed of a cluster of manganese, calcium and chloride ions bound to extrinsic proteins. In plants there are four (PsbO, PsbP, PsbQ and PsbR). Maintenance of the highly dynamic Mn4CaO5 cluster also requires the delivery of a constant supply of the proper levels of Mn2+ and Ca2+. The mechanism of water oxidation has remained virtually unchanged between green plants and cyanobacteria, and is similar in all higher plants. Simpler mechanisms are unknown.

Each of the extrinsic proteins of plants are ESSENTIAL, and each was tested upon mutated form, and the mechanism was found inefficient, and compromising the OEC function. Furthermore, a water network around the Mn4CaO5 cluster, and D1 protein subunit of PSII are also absolutely necessary. Each protein and the Mn4CaO5 cluster has no function by its own, only, if duly embedded and working in the whole mechanism. It could therefore not provide any survival advantage to the organism, unless everything is set up. Its the same as to ask what good a piston motor would be by its own ? It has no function , unless duly mounted and well matched inside the motor block.

There is no ignorance, but based on the scientific evidence of mutation experiments WE DO KNOW OEC absolutely requires each protein and a precisely arranged Mn4CaO5 cluster fully evolved and set up.

1. High information content (or specified complexity) and irreducible complexity constitute strong indicators or hallmarks of (past) intelligent design.
2. Biological systems have a high information content (or specified complexity) and utilize subsystems that manifest irreducible complexity.
3. Naturalistic mechanisms or undirected causes do not suffice to explain the origin of information (specified complexity) or irreducible complexity.
4. Therefore, intelligent design constitutes the best explanations for the origin of information and irreducible complexity in biological systems.
Posted by: NoName on May 03 2016,19:37

We know with certainty that improbable does not mean impossible.
We know with certainty that highly complex systems can evolve from simpler beginnings.
We know with certainty that all you have are special pleading , dishonesty, and misunderstanding.

Weren't you going away?
Posted by: sparc on May 04 2016,01:26

Quote (NoName @ May 03 2016,19:37)
We know with certainty that improbable does not mean impossible.
We know with certainty that highly complex systems can evolve from simpler beginnings.
We know with certainty that all you have are special pleading , dishonesty, and misunderstanding.

Weren't you going away?
---------------------QUOTE-------------------


He had to turn over to the Sandwalk where Larry is having fun with him.
Posted by: RumraketR on May 04 2016,06:36

Quote (Otangelo @ May 03 2016,19:18)
The key process that produces oxygen in the atmosphere is due to the oxygen-evolving complex (OEC) , which splits water molecules and subsequently releases molecular oxygen. This process, which occurs in photosystem II (PSII), is driven by the conversion of visible light to chemical energy. Electrons oxidize water, which leads to the evolution of molecular oxygen and the release of protons into the thylakoid lumen. This proton gradient is a major contributor to the proton motive force used to biosynthesize ATP from ADP via ATP synthase.

The OEC is composed of a cluster of manganese, calcium and chloride ions bound to extrinsic proteins. In plants there are four (PsbO, PsbP, PsbQ and PsbR). Maintenance of the highly dynamic Mn4CaO5 cluster also requires the delivery of a constant supply of the proper levels of Mn2+ and Ca2+. The mechanism of water oxidation has remained virtually unchanged between green plants and cyanobacteria, and is similar in all higher plants. Simpler mechanisms are unknown.

Each of the extrinsic proteins of plants are ESSENTIAL, and each was tested upon mutated form, and the mechanism was found inefficient, and compromising the OEC function. Furthermore, a water network around the Mn4CaO5 cluster, and D1 protein subunit of PSII are also absolutely necessary. Each protein and the Mn4CaO5 cluster has no function by its own, only, if duly embedded and working in the whole mechanism. It could therefore not provide any survival advantage to the organism, unless everything is set up. Its the same as to ask what good a piston motor would be by its own ? It has no function , unless duly mounted and well matched inside the motor block.

There is no ignorance, but based on the scientific evidence of mutation experiments WE DO KNOW OEC absolutely requires each protein and a precisely arranged Mn4CaO5 cluster fully evolved and set up.

1. High information content (or specified complexity) and irreducible complexity constitute strong indicators or hallmarks of (past) intelligent design.
2. Biological systems have a high information content (or specified complexity) and utilize subsystems that manifest irreducible complexity.
3. Naturalistic mechanisms or undirected causes do not suffice to explain the origin of information (specified complexity) or irreducible complexity.
4. Therefore, intelligent design constitutes the best explanations for the origin of information and irreducible complexity in biological systems.
---------------------QUOTE-------------------


< Larry Moran on this gibberish >

Otangelo: Always wrong all the time.
Posted by: RumraketR on May 04 2016,07:10

Quote (Otangelo @ Mar. 13 2016,14:11)
Quote (NoName @ Mar. 13 2016,11:53)
Incredibly improbable things happen All the time.
Improbable does not equal impossible.  Ever.
---------------------QUOTE-------------------


Asserts facts unsupported by evidence.
---------------------QUOTE-------------------


That is possibly the dumbest post on the internet. Quite literally.

What amazing bluffoonery. Improbable does not equal impossible.

Improbable directly translates into 'unlikely'. Which is just less likely than 'likely'. Which just means it doesn't happen often, but instead infrequently. But it still happens.  

If something happens 1 in 10 times, then it happens one out of ten times. If it happens a million times less often, it happens one in ten million times. If it happens a trillion trillion trillion trillion times less often, it happens once in every 10 million trillion trillion trillion trillion times. BUT IT STILL HAPPENS.

If it happens one in a quattuorvigintillion googolplex times, then it still happens. Once in every quattuorvigintillion googolplex times.

If it is impossible, then it NEVER happens. It CANNOT happen. In any way.
Posted by: NoName on May 04 2016,07:23

Quote (RumraketR @ May 04 2016,08:10)
Quote (Otangelo @ Mar. 13 2016,14:11)
Quote (NoName @ Mar. 13 2016,11:53)
Incredibly improbable things happen All the time.
Improbable does not equal impossible.  Ever.
---------------------QUOTE-------------------


Asserts facts unsupported by evidence.
---------------------QUOTE-------------------


That is possibly the dumbest post on the internet. Quite literally.

What amazing bluffoonery. Improbable does not equal impossible.

Improbable directly translates into 'unlikely'. Which is just less likely than 'likely'. Which just means it doesn't happen often, but instead infrequently. But it still happens.  

If something happens 1 in 10 times, then it happens one out of ten times. If it happens a million times less often, it happens one in ten million times. If it happens a trillion trillion trillion trillion times less often, it happens once in every 10 million trillion trillion trillion trillion times. BUT IT STILL HAPPENS.

If it happens one in a quattuorvigintillion googolplex times, then it still happens. Once in every quattuorvigintillion googolplex times.

If it is impossible, then it NEVER happens. It CANNOT happen. In any way.
---------------------QUOTE-------------------


Oh, I agree, completely.
It is so profoundly stupid, displays such a mind-boggling prejudicial close-mindedness as to leave one stunned.  Arrogant in its ignorance, and authoritarian right along with it.

Clearly, this fool knows the meaning of none of the nouns involved:
Improbable
Impossible
Facts
Evidence
Posted by: midwifetoad on May 04 2016,12:15

Two things:

There really are levels of improbability that are equivalent to impossible. Levitation via quantum jump of all the molecules in my body, for example.

Then there's things like winning Powerball, that aren't going to happen to me, but will happen to someone.

Living things are in this second category. There is almost no probability that starting from scratch, I would exist, but something would.

Going on about the improbability of things that exist is the Texas Sharpshooter fallacy.
Posted by: NoName on May 04 2016,12:23

Quote (midwifetoad @ May 04 2016,13:15)
Two things:

There really are levels of improbability that are equivalent to impossible. Levitation via quantum jump of all the molecules in my body, for example.

Then there's things like winning Powerball, that aren't going to happen to me, but will happen to someone.

Living things are in this second category. There is almost no probability that starting from scratch, I would exist, but something would.

Going on about the improbability of things that exist is the Texas Sharpshooter fallacy.
---------------------QUOTE-------------------


Ah, the subtle joys of equality versus equivalence ;-)

I think one of the ramifications that's important against Otangelo's point is that even for things equivalent to impossible, we have methodological naturalism at hand to explain the incredibly improbable occurrence.

He's trying to go for ontological or logical impossibility, and improbability won't get him there.

Nor will it get him away from methodological naturalism.
Least of all due to the complete lack of explanatory power of any other proposed explanation.
Posted by: Otangelo on May 05 2016,21:39

The interdependet pathway of photosynthesis

< http://reasonandscience.heavenforum.org/t1637-e....nthesis >

A gasoline engine "comes to life" only when many different independent conditions are met at the same time. Take away the spark plug, and it will not run at all. Leave out the pistons, and it will not run. Without oil or gasoline, it will not run. The list of interdependent conditions goes on and on. Even if all other conditions are met, it must be given an initial crank in order to start. Likewise, living creatures have inter-dependent characteristics which determine their very existence. Photosynthesis does not work without the conversion of energy into enzymatic and dark reaction cicle activity.

Compared to photosynthesis, a gasoline engine is extremely primitive. In order for photosynthesis to arise spontaneously, the sum of the parts of enzymes, genes, proteins , and protein complexes would have to come together intact in order to function, and the chemical reactions which would produce glucose would have to be started all at once. Each of the enzymes and protein complexes need complex biosynthesis pathways to be produced ( with several enzymes and proteins in the pathway working in a stepwise fashion , and if one step is missed , the final product is not produced )
How and why would evolution produce for example  the oxygen evolving complex, if by its own it would not have any function ? The enzymes and protein complexes do have only function, if working like in a car engine, each contributing to the final goal. And most of these parts  would have no other function, than only in photosynthesis.

Essential parts of oxygenic photosynthesis

The light reactions

1. Lipid bilayer membranes are critical to the early stages of energy storage, such that photosynthesismust be viewed as a process that is at heart membrane-based. 4
2. Chlorophyll is an essential component of photosynthesis, which helps plants get energy from light. 1
3. The light harvesting complexes, also called antenna complexes,  are essential for collecting sunlight and regulating photosynthesis 2
4. Photosystem II (PSII) is a key component of photosynthesis 2
4a.The reaction center is the key component for the primary events in the photochemical conversion of light into chemical energy. 19
5. The oxygen evolving is responsible for catalyzing the oxidation of water to molecular oxygen in plants, algae, and cyanobacteria. 3
6. Of these essential redox components, tyrosine, P680, pheophytin, QA, and Qj have been shown to be bound to two key polypeptides (Dl and D2) 8
7. If the oxidation of plastoquinone takes place in the cytochrome b6 f complex that is located in the stroma, then the plastoquinone must diffuse within the lipid bilayer from the   grana membranes to the stromal membranes. In
   either case, a long-distance diffusion process is necessary to complete the traversal of the electron transport chain.
8  The cytochromeb6 f complex  is an essential player in noncyclic and cyclic electron flow 4
9) Plastocyanin is an essential member of photosynthetic electron transport and functions near PS I.  5
10  PSI is necessary to provide the energy to reduce NADP+ to NADPH  6
10a.The reaction center is the key component for the primary events in the photochemical conversion of light into chemical energy. 19
11) Ferredoxin (Fd) proteins are required for the electron transfer process  from the bound Fe–S centers in the Photosystem I reaction center to NADP+. 4
12) Ferredoxin—NADP(+) reductase same as 9
13) ATP synthase is essential in plants for solar energy conversion and carbon fixation.

The dark or light independent reactions

14) Rubisco  is essential for the photosynthetic process.
15) Phosphoglycerate kinase is required to catalyse the phosphorylation of 3-PGA by ATP 10
16) Glyceraldehyde-3-phosphate dehydrogenase (NADP+) (phosphorylating) is essential to catalyse the reduction of 1,3BPGA by NADPH 10
17) Triosephosphate isomerase is needed to catalyze  the reversible interconversion of the triose phosphate isomers dihydroxyacetone phosphate and D-glyceraldehyde 3-phosphate. 11
18) Fructose-bisphosphate aldolase is a key enzyme to catalyze a reversible reaction that splits the aldol, fructose 1,6-bisphosphate, into the triose phosphates dihydroxyacetone phosphate (DHAP) and glyceraldehyde 3-phosphate (G3P). 12
19) Transketolase catalyzes  the conversion of sedoheptulose-7-P and glyceraldehyde-3-P to pentoses, the aldose D-ribose-5-P and the ketose D-xylulose-5-P. 13
20) Aldolase performs an aldol reaction (creating an aldol) or its reverse (cleaving an aldol). 14
21) Sedoheptulose-bisphosphatase catalyzes the removal of a phosphate group from sedoheptulose 1,7-bisphosphate to produce sedoheptulose 7-phosphate. 15
22) Transketolase catalyzes the reverse reaction, the conversion of sedoheptulose-7-P and glyceraldehyde-3-P to pentoses, the aldose D-ribose-5-P and the ketose D-xylulose-5-P. 16
23) Ribose-5-phosphate isomerase (Rpi) is an enzyme that catalyzes the conversion between ribose-5-phosphate (R5P) and ribulose-5-phosphate (Ru5P). 17
24) Phosphoribulokinase catalyzes the chemical reaction ATP + D-ribulose 5-phosphate \rightleftharpoons ADP + D-ribulose 1,5-bisphosphate
Posted by: OgreMkV on May 05 2016,22:24

"In order for photosynthesis to arise spontaneously"

Well, there's your mistake right there.
Posted by: Otangelo on May 22 2016,08:37

Irreducible complexity is a undeniable FACT.

< http://reasonandscience.heavenforum.org/t1468-i....ty#2133 >

Irreducible complexity keeps being a unsurmountable problem for the ones that propose unguided evolution and natural mechanisms to explain  the origin of life and biodiversity in general. No attempt to refute and successfully debunk the argument has been brought forward so far. Eyery attempt, no exception, has failed. Why ? Because IC is a undeniable FACT, no matter what. And this FACT becomes obvious to the unbiased mind  when we envision biological systems as complex molecular machines, that operate similar to man made machines, but far far more complex. Individual parts have no function by themself. This is a important point to highlight. What use does the wing of a airplaine  have alone? None. The engineer has to envision a function for the wing, used as essential part of the design of the airplane as a whole in order to fly, and its use once the airplane is fully built with all parts in place.  The wing must be made with the right specifications, size, materials, form, and placed and mounted at the right place in the right way. And the wing itself requires complex machines to be made. The right materials must be transported to the building site. Often these materials in their raw form are unusable. Other complex machines come into play to transform the raw materials into usable form.  All this requires specific information.   The precise same thing happens in biological systems. Even the most simple cell useses inumerous parts, that have no use by their own. For what reason would natural mechanisms create these parts , if there were no use for them individually ? This is a problem that stretches through all biology, from the simplest to the most complex. Biological systems do only achieve specific tasks, once a number of individual parts are made upon  specific complex instructions, frequently through other specific machines or even factories and assembly lines, that have no other tasks than to build these specific parts, and all this through the instructions of the  blueprint in the genome, and then other specific instructions provide the information of how, when , and where to mount the parts to form the complex machine. Same as done when building human made machines. And all these processes must be strictly controlled, with error check and feedback mechanisms, and if something is not build upon the right specification, complex repair machines fix the problem. These checking and repair systems must be fully operational from day one, otherwise, the organism dies. And energy in usable form must also be provided ,and the make of energy requires also complex machinery which by itself requires energy to be made ( chicken-egg problem ). Furthermore, internal and external communication networks must be established.  Also all these machines are made to self replicate , which adds a hudge amount of further complexity into the picture. Self replication is far from simple. It demands the most complex molecular machinery, which works in a astonishing , beautyful, orchestrated , regulated and controlled manner. Why at all would natural unguided, non-intelligent chemical reactions have the need to produce living biological systems, and keep them existing through self replication?
Posted by: NoName on May 22 2016,09:01

Lies make baby Jesus cry.

Have you learned statistics yet or do you still think improbable is the same as impossible?
Posted by: rossum on May 22 2016,12:06

[quote=Otangelo,May 22 2016,08:37][/quote]


---------------------QUOTE-------------------
Irreducible complexity is a undeniable FACT.
---------------------QUOTE-------------------



Correct.  Irreducibly complex systems exist.



---------------------QUOTE-------------------
Irreducible complexity keeps being a unsurmountable problem for the ones that propose unguided evolution and natural mechanisms to explain  the origin of life and biodiversity in general.
---------------------QUOTE-------------------



False.  IC systems can and do evolve.  Even Professor Behe has agreed that IC systems can evolve.  He was correct to say that IC systems cannot evolve by direct paths, but he was incorrect to say that they cannot evolve by indirect paths.

The various indirect paths are covered by Thornhill and Ussery (2000).  An actual path, given mutation by mutation, is shown by Lenski (2003).  Behe himself has calculated some probabilities of simple IC systems evolving in Behe and Snoke (2004)

IC systems can and do evolve in reasonable timescales, about 20,000 years in the examples treated in Behe and Snoke.
Posted by: Woodbine on May 22 2016,12:08

Quote (Otangelo @ May 22 2016,14:37)
Irreducible complexity is a undeniable FACT.

< http://reasonandscience.heavenforum.org/t1468-i....ty#2133 >

Irreducible complexity keeps being a unsurmountable problem for the ones that propose unguided evolution and natural mechanisms to explain  the origin of life and biodiversity in general. No attempt to refute and successfully debunk the argument has been brought forward so far. Eyery attempt, no exception, has failed. Why ? Because IC is a undeniable FACT, no matter what. And this FACT becomes obvious to the unbiased mind  when we envision biological systems as complex molecular machines, that operate similar to man made machines, but far far more complex. Individual parts have no function by themself. This is a important point to highlight. What use does the wing of a airplaine  have alone? None. The engineer has to envision a function for the wing, used as essential part of the design of the airplane as a whole in order to fly, and its use once the airplane is fully built with all parts in place.  The wing must be made with the right specifications, size, materials, form, and placed and mounted at the right place in the right way. And the wing itself requires complex machines to be made. The right materials must be transported to the building site. Often these materials in their raw form are unusable. Other complex machines come into play to transform the raw materials into usable form.  All this requires specific information.   The precise same thing happens in biological systems. Even the most simple cell useses inumerous parts, that have no use by their own. For what reason would natural mechanisms create these parts , if there were no use for them individually ? This is a problem that stretches through all biology, from the simplest to the most complex. Biological systems do only achieve specific tasks, once a number of individual parts are made upon  specific complex instructions, frequently through other specific machines or even factories and assembly lines, that have no other tasks than to build these specific parts, and all this through the instructions of the  blueprint in the genome, and then other specific instructions provide the information of how, when , and where to mount the parts to form the complex machine. Same as done when building human made machines. And all these processes must be strictly controlled, with error check and feedback mechanisms, and if something is not build upon the right specification, complex repair machines fix the problem. These checking and repair systems must be fully operational from day one, otherwise, the organism dies. And energy in usable form must also be provided ,and the make of energy requires also complex machinery which by itself requires energy to be made ( chicken-egg problem ). Furthermore, internal and external communication networks must be established.  Also all these machines are made to self replicate , which adds a hudge amount of further complexity into the picture. Self replication is far from simple. It demands the most complex molecular machinery, which works in a astonishing , beautyful, orchestrated , regulated and controlled manner. Why at all would natural unguided, non-intelligent chemical reactions have the need to produce living biological systems, and keep them existing through self replication?
---------------------QUOTE-------------------


Irreducible Paragraphity.
Posted by: Otangelo on May 22 2016,14:48

Quote (rossum @ May 22 2016,12:06)
False.  IC systems can and do evolve.  
---------------------QUOTE-------------------


Michael Behe's "Evolutionary" Definition — "An irreducibly complex evolutionary pathway is one that contains one or more unselected steps (that is, one or more necessary-but-unselected mutations).  The degree of irreducible complexity is the number of unselected steps in the pathway."  (A Response to Critics of Darwin's Black Box, 2002)

" An irreducibly complex system cannot be produced gradually by slight, successive modifications of a precursor system, since any precursor to an irreducibly complex system is by definition nonfunctional. Since natural selection requires a function to select, an irreducibly complex biological system, if there is such a thing, would have to arise as an integrated unit for natural selection to have anything to act on. It is almost universally conceded that such a sudden event would be irreconcilable with the gradualism Darwin envisioned."


In the quote above, Behe notes that there is a fundamental quality of any irreducibly complex system in that, "any precursor to an irreducibly complex system that is missing a part is by definition nonfunctional.” Behe elaborates upon this definition saying  "An irreducibly complex evolutionary pathway is one that contains one or more unselected steps (that is, one or more necessary-but-unselected mutations). The degree of irreducible complexity is the number of unselected steps in the pathway."

On the one side you have a intelligent agency based system of irreducible complexity of tight integrated , information rich functional systems which have ready on hand energy directed  for such, that routinely generate the sort of phenomenon being observed.  And on the other side imagine a golfer, who has played a golf ball through an 12 hole course. Can you imagine that  the ball could also play itself around the course in his absence ? Of course, we could not discard, that natural forces, like wind , tornadoes or rains or storms  could produce the same result, given enough time.  the chances against it however are so immense, that the suggestion implies that the non-living world had an innate desire to get through the 12 hole course.
Posted by: rossum on May 22 2016,15:35

Quote (Otangelo @ May 22 2016,14:48)
Michael Behe's "Evolutionary" Definition — "An irreducibly complex evolutionary pathway is one that contains one or more unselected steps (that is, one or more necessary-but-unselected mutations).  The degree of irreducible complexity is the number of unselected steps in the pathway."  (A Response to Critics of Darwin's Black Box, 2002)
---------------------QUOTE-------------------



This is Behe's second definition of IC -- note that it is from his "Response to Critics..."  It was this definition that he was using in his 2004 paper, which showed that IC systems could evolve.  In the example he used in the paper, a simple IC system evolved in about 20,000 years.



---------------------QUOTE-------------------
"An irreducibly complex system cannot be produced gradually by slight, successive modifications of a precursor system, since any precursor to an irreducibly complex system is by definition nonfunctional. Since natural selection requires a function to select, an irreducibly complex biological system, if there is such a thing, would have to arise as an integrated unit for natural selection to have anything to act on. It is almost universally conceded that such a sudden event would be irreconcilable with the gradualism Darwin envisioned."
---------------------QUOTE-------------------



This is Behe's first definition of IC.  It was shown to be partly incorrect by Lenski and others.  Behe is right that IC systems cannot evolve directly, however they can evolve indirectly.

To make it clearer, Behe's first hypothesis said: "IC systems cannot evolve."  This was shown to be incorrect.  Behe then amended his hypothesis to read: "IC systems are unlikely to evolve, and can only do so by indirect paths."  His 2004 paper was an example of calculating just how unlikely those indirect paths were.

You are mixing up Behe's two different hypotheses.
Posted by: Cubist on May 23 2016,02:38

Quote (Otangelo @ May 22 2016,08:37)
Irreducible complexity is a undeniable FACT.

< http://reasonandscience.heavenforum.org/t1468-i....ty#2133 >

Irreducible complexity keeps being a unsurmountable problem for the ones that propose unguided evolution and natural mechanisms to explain  the origin of life and biodiversity in general.
---------------------QUOTE-------------------


False. In point of fact, the notion of "irreducible complexity" dates back to 34 years before Michael Behe was born, and was conceived by a scientist who showed how "irreducibly complex" systems could be produced by means of evolutionary processes. I am, of course, referring to Hermann J Muller's paper < Genetic Variablity, Twin Hybrids and Constant Hybrids, in a Case of Balanced Lethal Factors >, which appeared in Genetics, Vol 3, No 5, Sept 1918, pp 422-499. Muller doesn't actually use the specific character string "irreducible complexity", but the notion Muller describes under the name "interlocking complexity" is exactly and precisely what Behe describes under the name "irreducible complexity".


---------------------QUOTE-------------------
No attempt to refute and successfully debunk the argument has been brought forward so far.
---------------------QUOTE-------------------


If "the argument" is Behe's argument, in his book Darwin's Black Box, that an irreducibly complex system cannot be produced by what Behe defines as "direct Darwinian pathways", "the argument" is indeed one that cannot be refuted—but it also doesn't support the conclusion you want it to.

As for Behe's post-DBB "irreducibly complex pathway" notion, my initial reaction is okay, fine, this is a well-defined class of possible evolutionary pathways. So what? Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?

Oh, and let's not forget one question you haven't answered: What does "new information" look like—that is, how can you recognize "new information" when you see it?
Posted by: Otangelo on May 23 2016,06:27

Quote (Cubist @ May 23 2016,02:38)
So what? Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?
---------------------QUOTE-------------------


There are many. A list of irreducible complex systems

< http://reasonandscience.heavenforum.org/t2166-a....systems >
Posted by: OgreMkV on May 23 2016,07:17

Quote (Otangelo @ May 23 2016,06:27)
Quote (Cubist @ May 23 2016,02:38)
So what? Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?
---------------------QUOTE-------------------


There are many. A list of irreducible complex systems

< http://reasonandscience.heavenforum.org/t2166-a....systems >
---------------------QUOTE-------------------


This is what you are saying...

Otangelo: Cars are complex.

Everyone else: Yes, yes they are.

Otangelo: Here's a list of cars.

Everyone else: OK, right. That is, indeed, a list of cars.

Otangelo: You think cars can't exist.

Everyone else: Nope, pretty sure I have a car. Bought and paid for. I personally replaced the headlights on Saturday.
Posted by: Quack on May 23 2016,09:37

Here is something I saved from ARN a long time ago:
(The ARN link is long time dead)

 

---------------------QUOTE-------------------
It seems to me that Behe still is harping on the same sterile theme: Things are so complex they must have been designed. He also insists that ID is a science that should be taught.

< http://www.arn.org/cgi-bin....=000261 >

From a transcript made at the DDD3 conference in 2002:

Question from the audience: I’d be interested in hearing you tell us a little bit about what your theory of intelligent design is, as opposed to what evolution isn’t.

Behe replies: Well, that’s a great question, and I know folks on the other side who are sceptical of intelligent design often get frustrated, but I try to be as conservative as I can and I don’t go out beyond what the data can support because I think overreaching is the bane of theories of design. You say that flagellum looks designed so everything is designed, or that everything that looks complex was designed, or something like that.

I think the short answer to your question is, for all of those things, I don’t know.

There not enough data. For the elephant, we have primelephus, the ancestral elephant of the Asian and African elephant, and mammoth. Well, could that happened by random mutation and natural selection? My instinctive answer is sure - it sure looks like it. It doesn’t look like any big deal.

The more careful answer, the actual answer, is I don’t know - cause I don’t know what’s involved in making one versus the other. I don’t know what molecular changes are necessary to make the small anatomical differences in those different species.

Suppose one believed that those things could have happened by natural selection, but maybe the origination of mammals needed some extra information - how would that have happened - how would the designer have done that? Would it have been, say, information embedded into nature at the big bang, or whenever nature started, or might it have been manipulations along the way, or some sort of input along the way?

The short answer is “I don’t know.”

It seems to me that teaching intelligent design is like teaching ‘We don’t know’ Ought we not also to add: At present, the theory of evolution is the only theory that in a consistent and satisfactory manner account for the facts and the evidence that we have. We have no reason to believe that forces outside of nature have been intervening in the natural unfolding of events on this planet.

Taking this a little further, I wonder about how Behe propose that the design process has been performed. Since Behe likes to use banal metaphors like clockwork and mousetraps, things we know are designed and built by man, let us follow that path.

Design as we know it, is performed in a number of steps.

1. Intent and purpose.
2. Drawing board design, laboratory experiments.
3. “2” is repeated as many times as required to reach a viable design.
4. Production, implementation.

It seems to me that Behe has made no attempt whatsoever at detecting any of these activities. Why?

The way I see it, the most serious flaw in his argument is that he refers to ‘design’ almost as if was some magical abracadabra that inserts whatever feature he fancies into a live being.

While the nature of things is, that it is hardly reasonable to think that any designer would insert, say, a flagellum into a bacterium.

What would have to be don is of course, to manipulate the actual genes, to perform whatever processes required on the DNA of the creature in question. Which of course requires intent and purpose. And an incredible amount of knowledge and sophisticated laboratory facilities beyond anything we know would be required!

It demands to much of my imagination, to think that space travellers would have come here, and would have bothered with manipulating DNA.

To me, that seems like thinking that life is evolving, but within limits. There are certain limitations, borders that cannot be crossed, and therefore require intervention by white coated people. Since this seems rather unthinkable, we are left with magic of the kind for which gods are known to be very skilled at.

And not only that – it boggles my mind when I try to think of the amount of work required to create all species, known and unknown, past and present. Millions upon millions of insects, each requiring directed design.

Is it possible to believe that designers have been travelling all over the planet, visiting not only all the continents, but also a vast number of islands to create all the endemic species there? No matter what Behe or the DI says, it simply is not possible that the designer(s) can be anything but omnipotent, omniscient and omnipresent.

Intelligent Design requires a god, it is dishonest to pretend that the ‘designer’ could be anything else.


So is that it? Goddidit?  

---------------------QUOTE-------------------


Posted by: Cubist on May 23 2016,17:12

Quote (Otangelo @ May 23 2016,06:27)
Quote (Cubist @ May 23 2016,02:38)
So what? Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?
---------------------QUOTE-------------------


There are many. A list of irreducible complex systems

< http://reasonandscience.heavenforum.org/t2166-a....systems >
---------------------QUOTE-------------------


You misread my question. It's one thing to say that a system is irreducibly complex; it's something else again to say that a system was produced by means of an irreducibly complex pathway. So I'ma ask my question again, with emphasis on the bit you overlooked or misinterpreted or some damn thing:

Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?

And while you're in the mood to reply to questions, do feel free to explain what "new information" looks like.
Posted by: Otangelo on May 23 2016,19:56

Quote (Cubist @ May 23 2016,17:12)
Quote (Otangelo @ May 23 2016,06:27)
 
Quote (Cubist @ May 23 2016,02:38)
So what? Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?
---------------------QUOTE-------------------


There are many. A list of irreducible complex systems

< http://reasonandscience.heavenforum.org/t2166-a....systems >
---------------------QUOTE-------------------


You misread my question. It's one thing to say that a system is irreducibly complex; it's something else again to say that a system was produced by means of an irreducibly complex pathway. So I'ma ask my question again, with emphasis on the bit you overlooked or misinterpreted or some damn thing:

Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?

And while you're in the mood to reply to questions, do feel free to explain what "new information" looks like.
---------------------QUOTE-------------------


I dont know about critters.

I know imho that certainly the biosynthesis pathway of chlorophyll and hemoglobin is ic.
Posted by: OgreMkV on May 23 2016,22:25

Quote (Otangelo @ May 23 2016,19:56)
Quote (Cubist @ May 23 2016,17:12)
Quote (Otangelo @ May 23 2016,06:27)
 
Quote (Cubist @ May 23 2016,02:38)
So what? Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?
---------------------QUOTE-------------------


There are many. A list of irreducible complex systems

< http://reasonandscience.heavenforum.org/t2166-a....systems >
---------------------QUOTE-------------------


You misread my question. It's one thing to say that a system is irreducibly complex; it's something else again to say that a system was produced by means of an irreducibly complex pathway. So I'ma ask my question again, with emphasis on the bit you overlooked or misinterpreted or some damn thing:

Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?

And while you're in the mood to reply to questions, do feel free to explain what "new information" looks like.
---------------------QUOTE-------------------


I dont know about critters.

I know imho that certainly the biosynthesis pathway of chlorophyll and hemoglobin is ic.
---------------------QUOTE-------------------


IC doesn't mean "not evolved". Once you get past that fundamental misunderstanding, then you'll be a lot better off. Maybe this will help...


Houses, according to your (and intelligent design's) ideas are impossible. That's because you can't put up the roof without walls. You can't put up one wall by itself because it would fall over. You have to put up at least two connecting walls for support. Therefore, according to you (and ID), unless you can create a completed house instantly, they are impossible to build.

Yet, we see millions of houses and we know they are built. How is it possible?

It's called support structures. You can, during construction, even see the remnants of those structures in the house. Once those 2x4s that hold the first wall up aren't needed anymore, the builders remove them. If you go by a house with all the walls up, you might see some cut off 2x4s in weird places and a bunch of nails that don't seem to be doing anything.

But if you were present a little earlier, you would have seen those nails holding a 2x4 to the wall to support the wall while other walls were being built.

So, there are steps to the construction of those otherwise irreducibly complex houses. Yes, if you take 3 of the 4 walls way, that last wall will fall over. But there was other stuff present before that we don't see now.

Same thing with cells and anything else that could be claimed to be irreducibly complex. We only see what the things look like now. We don't see their 3 billion years of genetic history and we sure don't see the structures that were there, but not there now.

You don't need poof. Well, ID and creationism does, you just need support. And the best part is, there's significant evidence that those supports don't have to be a functionally positive system to work. Indeed, some are actually negative, but they were sufficiently non-harmful to stay in the population and provide the scaffolding for future evolution.

I can provide evidence of that in a paper. Would you like to see it?

Of course not. You've been doing this to long to even consider the fact that you might be wrong.

Oh well.
Posted by: Otangelo on May 24 2016,10:23

Quote (OgreMkV @ May 23 2016,22:25)
It's called support structures. You can, during construction, even see the remnants of those structures in the house. Once those 2x4s that hold the first wall up aren't needed anymore, the builders remove them.


If you go by a house with all the walls up, you might see some cut off 2x4s in weird places and a bunch of nails that don't seem to be doing anything.

But if you were present a little earlier, you would have seen those nails holding a 2x4 to the wall to support the wall while other walls were being built.

So, there are steps to the construction of those otherwise irreducibly complex houses. Yes, if you take 3 of the 4 walls way, that last wall will fall over. But there was other stuff present before that we don't see now.

Same thing with cells and anything else that could be claimed to be irreducibly complex. We only see what the things look like now. We don't see their 3 billion years of genetic history and we sure don't see the structures that were there, but not there now.

You don't need poof. Well, ID and creationism does, you just need support. And the best part is, there's significant evidence that those supports don't have to be a functionally positive system to work. Indeed, some are actually negative, but they were sufficiently non-harmful to stay in the population and provide the scaffolding for future evolution.

I can provide evidence of that in a paper. Would you like to see it?

Of course not. You've been doing this to long to even consider the fact that you might be wrong.

Oh well.
---------------------QUOTE-------------------


IC doesn't mean "not evolved".

It means precisely that. BY DEFINITION. If its ic, it did not evolve. if it evolved, its not ic. simple as that.

Michael Behe's "Evolutionary" Definition — "An irreducibly complex evolutionary pathway is one that contains one or more unselected steps (that is, one or more necessary-but-unselected mutations).  The degree of irreducible complexity is the number of unselected steps in the pathway."  (A Response to Critics of Darwin's Black Box, 2002)

" An irreducibly complex system cannot be produced gradually by slight, successive modifications of a precursor system, since any precursor to an irreducibly complex system is by definition nonfunctional. Since natural selection requires a function to select, an irreducibly complex biological system, if there is such a thing, would have to arise as an integrated unit for natural selection to have anything to act on. It is almost universally conceded that such a sudden event would be irreconcilable with the gradualism Darwin envisioned."


In the quote above, Behe notes that there is a fundamental quality of any irreducibly complex system in that, "any precursor to an irreducibly complex system that is missing a part is by definition nonfunctional.” Behe elaborates upon this definition saying  "An irreducibly complex evolutionary pathway is one that contains one or more unselected steps (that is, one or more necessary-but-unselected mutations). The degree of irreducible complexity is the number of unselected steps in the pathway."

Yet, we see millions of houses and we know they are built. How is it possible?

Because intelligent people build them. Nice example of intelligent design. lol.

It's called support structures. You can, during construction, even see the remnants of those structures in the house. Once those 2x4s that hold the first wall up aren't needed anymore, the builders remove them.

So what ? Biological systems produce feedback mechanisms, repair proteins, check mechanisms, production lines through proteins, to make other proteins, that do not have any function, unless fully setup and mounted in the biological machine. So why would evolution produce them in the first place ?

Same thing with cells and anything else that could be claimed to be irreducibly complex. We only see what the things look like now. We don't see their 3 billion years of genetic history

We know the oxygen photosynthesis pathway is today as it was supposedly 2,5 bio years ago. It did not change. Nor are there precursors known. And if you remove any of its protein parts, it ceases to function.....
Posted by: NoName on May 24 2016,12:07

Is the designer irreducibly complex?  Infinite regress.
Is the designer not irreducibly complex?  Then we know irreducible complexity can be created by non-IC entities.

It's really not hard to figure out.
You've shown no reason why the laws of chemistry and physics do not suffice.  Well, other than your own ignorance, prejudicial assumptions, and personal incredulity.  Forgive us if we don't find those compelling.
Posted by: Cubist on May 24 2016,18:32

Quote (Otangelo @ May 23 2016,19:56)
   
Quote (Cubist @ May 23 2016,17:12)
   
Quote (Otangelo @ May 23 2016,06:27)
     
Quote (Cubist @ May 23 2016,02:38)
So what? Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?
---------------------QUOTE-------------------


There are many. A list of irreducible complex systems

< http://reasonandscience.heavenforum.org/t2166-a....systems >
---------------------QUOTE-------------------


You misread my question. It's one thing to say that a system is irreducibly complex; it's something else again to say that a system was produced by means of an irreducibly complex pathway. So I'ma ask my question again, with emphasis on the bit you overlooked or misinterpreted or some damn thing:

Did Behe identify any real, existing-in-at-least-one-contemporary-critter system which was produced by means of an "irreducibly complex pathway"?

And while you're in the mood to reply to questions, do feel free to explain what "new information" looks like.
---------------------QUOTE-------------------


I dont know about critters.

I know imho that certainly the biosynthesis pathway of chlorophyll and hemoglobin is ic.
---------------------QUOTE-------------------


You know that it is your opinion that "the biosynthesis pathway of chlorophyll and hemoglobin is ic", yes. But I didn't ask you about your opinion; rather, I asked you about Behe's opinion, as stated in the stuff Behe has written. I asked you about Behe's opinion because I wanted to see if you actually understood what Behe wrote. When you reply to a what does Behe think question with an I think answer—which is exactly what you just did here—your response is evidence to support the hypothesis that you don't read for comprehension so good.
Posted by: OgreMkV on May 24 2016,19:50



---------------------QUOTE-------------------
IC doesn't mean "not evolved".

It means precisely that. BY DEFINITION. If its ic, it did not evolve. if it evolved, its not ic. simple as that.
---------------------QUOTE-------------------



I think you made a mistake in there somewhere.

IC doesn't mean "not evolved", but it means "not evolved".

Congratulations. Instead of evidence or actual association with reality, you have changed the definitions to suit your argument.

Whatever.
Posted by: OgreMkV on May 24 2016,19:59

You don't get it and I understand that. You can't conceive of anything that you think disrupts your world view. I'm sorry that you cannot be taught.

Fact is, the evolution of those mechanisms you mention is well documented. You disagree, but you never bother to read the evidence. Heck, even Behe disagrees with you. But you're much smarter than he is about biochemistry.
Posted by: Otangelo on May 25 2016,10:50

Quote (OgreMkV @ May 24 2016,19:59)
Heck, even Behe disagrees with you.
---------------------QUOTE-------------------


Does he ? How so ?
Posted by: NoName on May 25 2016,13:34

Quote (Otangelo @ May 25 2016,11:50)
Quote (OgreMkV @ May 24 2016,19:59)
Heck, even Behe disagrees with you.
---------------------QUOTE-------------------


Does he ? How so ?
---------------------QUOTE-------------------


The relevant material, with explanation, is present on the previous page of this thread.
Do you not even read your critics?
Posted by: Otangelo on May 26 2016,15:03

Centriole biogenesis, and the duplication cycle, amazing evidence of design

The  duplication of eukaryotic cells is a all fine-tuned biochemical processes that depends on the precise structural arrangement of the cellular components. Mitotic cell division is the most fundamental task of all living cells. Cells have intricate and tightly regulated machinery to ensure that mitosis occurs with appropriate frequency and high fidelity.

The only way to make a new cell is to duplicate a cell that already exists. A cell reproduces by performing an orderly sequence of events in which it duplicates its contents and then divides in two.  This cycle of duplication and division, known as the cell cycle, is the essential mechanism by which all living things reproduce. Dividing cells must coordinate their growth. A complex network of regulatory proteins  trigger the different events of the cycle.

During the cell cylce, eighteen different regulators are required, which order and coordinate the process. Each of these regulators are absolutely essential. If one is missing, the cell cycle is not completed and, the cell cannot duplicate.  Any of these regulators have only use if fully integrated in the process. They have no use or function by themself. This makes  replication a irreducible , interdependent process.

Centrosomes play a key role in organizing the microtubule network of the cell, most notably the mitotic spindle during cell division .

The choreography of microtubules, centrosomes and chromosomes during mitosis and meiosis is beautifully designed, and uses finely regulated and synchronized movements.

The centrosome is a structure, consisting of a pair of cylindrical microtubule-based organelles called centrioles , embedded in an amorphous network of proteins known collectively as Pericentriolar Material (PCM). Microtubules (MTs) originate from the PCM.  The PCM comprises a porous structural scaffold onto which γ-tubulin and other soluble components from the cytoplasm are loaded. Centrosome growth is an aggregation process of a condensed phase of PCM components, which segregate from the cytosol. The aggregation process leads to a centrosome phase that coexists with the cytosol and does rearrange internally. This implies that the centrosome phase is viscoelastic, such that on long timescales it behaves as a liquid-like material.

Cep192 is a pericentriolar protein that accumulates at centrosomes during mitosis and is required for PCM recruitment, centriole duplication, microtubule nucleation, and centrosome maturation.

Centrioles are among the most beautiful of biological structures. How their highly conserved nine-fold symmetry is generated is a question that has intrigued cell biologists for decades.
Centrioles are present in all eukaryotic species that form cilia and flagella, but are absent from higher plants and higher fungi which do not have cilia.
It seems likely that they have  the primary purpose of growing cilia and flagella, which are important sensory and motile organelles found in almost all cells of the human body.  These organelles have many important functions in cells, and their dysfunction has been linked to a plethora of human pathologies, ranging from cancer to microcephaly to obesity.  Great progress has been made recently in understanding how these proteins interact and how these interactions are regulated to ensure that a new centriole is only formed at the right place and at the right time.

Centriole biogenesis requires thirteen essential molecules. If any of these molecules is missing, centrioles cannot be made.

Centriole assembly is also tightly regulated and abnormalities in this process can lead to developmental defects and cancer. Initiation of centriole duplication is under tight regulation to ensure the control of centriole number. Presumably in centriole initiation, there is some form of cooperativity or positive feedback that results in asymmetric accumulation of the relevant proteins in a symmetric background.

So we have not only the requirement of eighteen proteins required for cell cycle regulation, but also thirteen essential molecules for centriole biogenesis, which by itself is also tighthly regulated, requiring positive feedback.

It appears at the initial stage of the centriole assembly process as the first ninefold symmetrical structure. The cartwheel was first described more than 50 years ago, but it is only recently that its pivotal role in establishing the ninefold symmetry of the centriole was demonstrated.  This is a highly ordered structure that really stands out from the background. Constructed of rod-like microtubules, most centrioles have a nine-fold pattern, nine triplets or doublets evenly spaced at the rim, giving it a "cartwheel" appearance in cross-section.

The comparison to a human made cartwheel is evident, and so that it is intelligently designed. Obviously, the question arises, how could all this emerge gradually ?

Another amazing fact is that Electromagnetics play an important role in cell functioning and especially in cell duplication and division (mitosis).

Recent development in the field of quantum biology highlights that the intracellular electromagnetic field (EMF) of microtubules plays an important role in many fundamental cellular processes such as mitosis. It is an intriguing hypothesis that centrosome functions as molecular dynamo to generate electric flow over the microtubules, leading to the electric excitation of microtubule EMF that is required for spindle body microtubule self-assembly. With the help of motors proteins within the centrosome, centrosome transforms the energy from ATP into intracellular EMF in the living cell that shapes the functions of microtubules. There will be a general impact for the cell biology field to understand the mechanistic function of centrosome for the first time in correlation with its structural features.



The electromagnetic property of microtubule has been reported with both computation modelling and experimental evidences.

To transform the chemical energy in ATP into electric magnetic field within the living cell, cell needs to have a molecular dynamo to transform the mechanistic movement of protein complexes to directional movements of intracellular electrons, leading to the electric excitation of the spindle body microtubules as well as the M phase chromosomes, which is essential for mitosis

Taken together the longitudinal, or axial, vibration of the 13 filaments of an MT and then the 27 MTs making up the centriole barrel produce the electromagnetic field surrounding the centriole . Interestingly, this field is also found to be ferromagnetic. Also of interest, the fundamental vibration frequency of an MT filament is approximately 465 MHz, although this frequency is continually changing due to the ongoing length changing of the filaments. The electropolarity of the centrioles enables them to exert forces at a distance—that is, forces without physical contact.

All this cannot leave us asounded and v   indicates the requirement of forsight to produce all these ingenius mechanisms,and subsequently a intelligent designer.

< http://reasonandscience.heavenforum.org/t2090-c....re#4871 >
Posted by: NoName on May 26 2016,15:15

Amazing misinterpretation and misunderstanding.

To say nothing of an amazing ability to pretend like all the takedowns of your bullshit and all the answers to your questions haven't been provided already.

Your personal incredulity is irrelevant.  And, sadly for you, it's really all you've got.
Posted by: stevestory on May 26 2016,15:18

Maybe this is an experiment. Maybe somebody at Google is testing the AI bot. They set it on "babbling idiot" mode and pipe the output into a comment here and see if we reject its Turing Testosity.
Posted by: ChemiCat on May 29 2016,04:17



---------------------QUOTE-------------------
The only way to make a new cell is to duplicate a cell that already exists. A cell reproduces by performing an orderly sequence of events in which it duplicates its contents and then divides in two.  This cycle of duplication and division, known as the cell cycle, is the essential mechanism by which all living things reproduce. Dividing cells must coordinate their growth. A complex network of regulatory proteins  trigger the different events of the cycle.

---------------------QUOTE-------------------



Stolen from here without reference;

< NCBI >

A dishonest creationist, who would have thought that!
end


Powered by Ikonboard 3.0.2a
Ikonboard © 2001 Jarvis Entertainment Group, Inc.