RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (3) < [1] 2 3 >   
  Topic: Could ID be "science"? (From PT)< Next Oldest | Next Newest >  
lutsko



Posts: 8
Joined: Nov. 2005

(Permalink) Posted: Nov. 14 2005,08:29   

OK, I am here to be crucified. I do not support ID as formulated by Dembski, Behe, etc. but I think some defenders go over board in denying the possibility that ID could ever be a scientifically respectable hypothesis. An example I mentioned on PT was if a long, easily recognized mathematical sequence (like the first hundred digits of pi, or euler's constant or the golden mean or all in sequence) were found encoded in junk DNA. I do not mean any arcane code: suppose each amino acid corresponded to one of the digits from 0 to 3 and the number was coded in base 4.

One could, as suggested on the PT board, conclude that some  unknown physical mechanism was at work, such as produces Fibonnaci sequences in nature, but I think it would be hard to say that an "argument from design" could be ruled out. Note that when **I** use the term "design", I only mean that the design was produced by perfectly natural designers, who themselves probably evolved naturalistically: I am a naturalist and would personally not evoke anything supernatural.

So, is it possible to imagine a world in which "design" was  a scientifically respectable hypothesis? Shouldn't our political activists be careful about categorically ruling design on that basis?

  
Russell



Posts: 1082
Joined: April 2005

(Permalink) Posted: Nov. 14 2005,09:39   

Well, I'm game. IF let's say, pi to a hundred digits in base 4 were found in DNA, I can, at least at this moment, think of no plausible explanation for it. I wouldn't rule out, a priori, the possibility that there was an intelligent agency behind it.

That said, as you point out, this is nothing like the situation being discussed by the current champions of ID.

Also, just to forestall nitpickers, I think you mean nucleotides (of which there are, basically, four) not amino acids (of which there are, basically [acidicly?] twenty). And when you say "golden mean", I presume you mean "golden ratio": (1 + (5)^(1/2))/2.

--------------
Must... not... scratch... mosquito bite.

  
C.J.O'Brien



Posts: 395
Joined: Aug. 2005

(Permalink) Posted: Nov. 14 2005,09:40   

I come in peace. (with no desire to crucify anyone-- it just makes a martyr of 'em)

But the difficulty I see here is similar to one with ID proper: what are we saying happened, and when?

Continuing with the thought experiment, let's say that, yes indeed, the earth was visited by tinkering aliens a square billion years ago, and they "encoded" such a sequence into the genome of a protozoan, had a good laugh, and left, never to return. What is to keep that sequence from further mutating in the intervening billion years? Should we be looking for sequences "near" Pi, within the tolerances of the molecular clock?
To go even further, say we identified a very near sequence that later mutated, without human agency, to be a perfect 100 digits of Pi? What should we conclude about that sequence? Was it (to foist on you a stinker of an ID term) frontloaded? How prescient can we make our aliens without stretching credulity to its limits?
And, perhaps most important, what does contemplation of "near-Pi" sequences do to our calculation of the improbability of such sequences, which, remember, is what's leading us to the "design hypothesis" in the first place?

--------------
The is the beauty of being me- anything that any man does I can understand.
--Joe G

  
lutsko



Posts: 8
Joined: Nov. 2005

(Permalink) Posted: Nov. 14 2005,09:47   

Quote (C.J.O'Brien @ Nov. 14 2005,15:40)
never to return. What is to keep that sequence from further mutating in the intervening billion years? Should we be

I was actually surprised no one on the PT thread raised this point. Of course, if it happened a billion years ago, one would expect a certain amount of drift which could, I suppose, be used to date the intervention. I am a physicist, not a molecular biologist, and do not have the numbers at my fingertips, but i suppose that if the encoded sequence were long enough, enough could survive after a billion years for it to be identified to a high statistical accuracy even though errors would have accrued.

  
C.J.O'Brien



Posts: 395
Joined: Aug. 2005

(Permalink) Posted: Nov. 14 2005,10:05   

Quote
if the encoded sequence were long enough, enough could survive after a billion years for it to be identified to a high statistical accuracy even though errors would have accrued.

But, regarding my last point, wouldn't this "expanded" filter for sequences we will deem improbable enough to even begin considering designed create a situation where essentially random-looking sequences have to be considered too?

This sort of destroys the rationale for the inference in the first place.

--------------
The is the beauty of being me- anything that any man does I can understand.
--Joe G

  
Russell



Posts: 1082
Joined: April 2005

(Permalink) Posted: Nov. 14 2005,10:17   

Quote
I was actually surprised no one on the PT thread raised this point. Of course, if it happened a billion years ago, one would expect a certain amount of drift which could, I suppose, be used to date the intervention.
Well, since the whole scenario is contrary to our experience, what's one tiny increment of implausibility?

But, no. Without some kind of "selective pressure" I don't think there would be enough unmutated Pi to be able to recognize it after a billion years of genetic drift.

That's why if something like that were observed you would have to look for some explanation outside of the current theory of evolution.

Note, incidentally, that this is pretty much parallel to the prime number SETI radio signals in Carl Sagan's fictional work, "Contact". Sagan, being safely dead, is regularly trotted out by Dembski & co. in this context as if validating their project. If Sagan were not dead, I have no doubt he would take strong and eloquent exception to this abuse of his work. As Panda's Thumb has documented, the SETI people have no use for ID. (I'd give you the link, but I'm not that dextrous with this system just yet.)

--------------
Must... not... scratch... mosquito bite.

  
lutsko



Posts: 8
Joined: Nov. 2005

(Permalink) Posted: Nov. 14 2005,10:25   

Russell,
I am not a biologist and cannot claim to provide a bullet-proof example. However, I never said the sequence had to be a billion years old - even so, it would depend on the mutation rate.

The SETI business is a red herring. SETI looks for narrow-band signals and that is not relevant to finding a message in DNA.

So I would claim the challenge remains: a recognizable, simply coded sequence outside the bounds of chance is found embedded in the DNA of some organism: would it be unscientific to allow for design as an explanation?

Just to make it a little bit more juicey: suppose some rich, deluded person gave a group of molecular biologists and computer scientists a load of cash to look for such messages - would that be a valid "scientific" project?

  
C.J.O'Brien



Posts: 395
Joined: Aug. 2005

(Permalink) Posted: Nov. 14 2005,10:52   

Quote (lutsko @ Nov. 14 2005,16:25)
So I would claim the challenge remains: a recognizable, simply coded sequence outside the bounds of chance is found embedded in the DNA of some organism: would it be unscientific to allow for design as an explanation?

Just to make it a little bit more juicey: suppose some rich, deluded person gave a group of molecular biologists and computer scientists a load of cash to look for such messages - would that be a valid "scientific" project?

My answers: no, and no.

No, it would not be categorically "unscientific" to posit the design of (sme part of) a genome. After all, xenobiologists from Mars would be incorrect if they did not attribute the genomes of genetically engineered organisms to human design.

But, the search, absent a priori reasons to believe design occured, would be about as productive as an intensive search of pre-Cambrian strata looking for Haldane's rabbit. (That is, not very.)

--------------
The is the beauty of being me- anything that any man does I can understand.
--Joe G

  
Russell



Posts: 1082
Joined: April 2005

(Permalink) Posted: Nov. 14 2005,11:43   

Oh dear. I'm afraid we don't have a very stimulating argument here, because I'm afraid I agree. As I said before: No, I would not rule out "design" in the case described.

Much in the same sense that I would be hard pressed to rule out just about any bizarre explanation if, when Neil Armstrong stepped onto the moon, it turned out it was made of green cheese.

Now, lest I've just inadvertantly created a monster, I want to make it clear that high school science classes should not spend any time on the green-cheese-moon theory.

(Just for fun, though, when I have a moment I'll work through some of the math on the Pi in DNA scenario.)

--------------
Must... not... scratch... mosquito bite.

  
sir_toejam



Posts: 846
Joined: April 2005

(Permalink) Posted: Nov. 14 2005,15:33   

and back the the title of the thread..

as i was trying to present in the original post on PT, arguing whether this is science or not is summed up nicely by CJ, though i tended to ramble on a bit in the original PT discussion.

"But, the search, absent a priori reasons to believe design occured, would be about as productive as an intensive search of pre-Cambrian strata looking for Haldane's rabbit. (That is, not very.)"

it all boils down to what those a priori reasons would be based on, and as far as i can see, currently those are all subjective when we are discussing anything other than ourselves.

it doesn't rule out that there might appear objective evidence that would then give us a priori reasons in the future, but those don't exist now.

  
sir_toejam



Posts: 846
Joined: April 2005

(Permalink) Posted: Nov. 14 2005,15:45   

Quote
suppose some rich, deluded person gave a group of molecular biologists and computer scientists a load of cash to look for such messages - would that be a valid "scientific" project?


uh, correct me if I'm wrong, but didn't you in the same post claim that SETI was a red herring?

why not just simplify the argument and let's discuss whether SETI itself is a truly scientific endeavor.

  
normdoering



Posts: 287
Joined: July 2005

(Permalink) Posted: Nov. 14 2005,17:29   

Quote (lutsko @ Nov. 14 2005,14:29)
... I think some defenders go over board in denying the possibility that ID could ever be a scientifically respectable hypothesis. ...

I doubt you'll ever have an  ID hypothesis that points at  God for one simple reason: I don't think there is a God.

However, in the future, law makers and governments may want to  know if virii and germs are evolved or designed so  they know when a crime or an act of war has been committed.

They may want to tell genetic doping from naturally occuring differences between people.

In those cases  the things to look for would be:

1) A lack of similar enough ancestors. (too big an evolutionary jump for to few generations)
2) Lack of junk DNA (though it might be faked)
3) Motive for design.

Anyone add more?

  
Hyperion



Posts: 31
Joined: June 2005

(Permalink) Posted: Nov. 14 2005,19:58   

In the same vein as similar ancestors, I'd add genetic diversity.  One of the few leads in the anthrax cases a few years back was that scientists determined that the spores were all of the Ames strain from Ft. Detrick's labs.  Bioweapons would presumably be genetically homogeneous, whereas a wildtype epidemic would have much variation.  Look at the multiple strains of ebola, HIV, and influenza that exist in nature.

Genetic homogeneity is a good sign of design.  Conversely, genetic diversity is a hallmark of evolved systems.

  
Tim Hague



Posts: 32
Joined: Nov. 2005

(Permalink) Posted: Nov. 14 2005,20:55   

How long would it take for a genetically engineered 'bioweapon' virus or bacteria to start showing diversity once it's released?  Not long, I would think.  

Also, someone engineering bioweapons would probably create more than one similar strain, specifically to avoid a single vaccine being effective.

   
sir_toejam



Posts: 846
Joined: April 2005

(Permalink) Posted: Nov. 14 2005,21:13   

Quote
Genetic homogeneity is a good sign of design


in a lab, maybe.  in the field don't forget the effect of bottlenecks.

for example, california sea otters have a very high degree of homogeneity.  does that mean they were designed?

nope, it means they were hunted to the point where there were only one or two mating pairs left that served as the nucleus for most of the otters now existing off the coast.

same with elephant seals iirc, and many populations of african lions (tho in that case it was mostly due to a disease).

  
Tim Hague



Posts: 32
Joined: Nov. 2005

(Permalink) Posted: Nov. 14 2005,21:41   

Quote
A lack of similar enough ancestors. (too big an evolutionary jump for to few generations)


The problem with that is that big changes sometimes do happen - particularly with transposons or retrotransposons.  Or frame shift mutations.  Or even symbiogenesis.  

I think overall there is a problem with detecting design.  This is the same problem encountered by the ID proponents - their 'design detection mechanisms' have been shown to be useless over and over again.

I realise that what they are trying to show is 'supernatural' design, but I think the same problems occur when trying to demonstrate human design as well.  

This was one of the points I was making on the original thread - if hypothetically some (well funded) IDist splices a whale gene into a bacterium and claims it was found in the wild (therefore 'blowing evolution out of the water' yadda yadda) - how do you show it was designed - and specifically how do you show it was designed by a human and not some unspecified supernatural designer?

   
claw



Posts: 3
Joined: Nov. 2005

(Permalink) Posted: Nov. 15 2005,00:00   

Dear Lutsko

Thanks for coming over to the Bar. Others have already said most of what I wanted to already. If you want to take this further, you mught want to have a crack at the questions I asked in the other thread.

1. What sequence of pi could not be explained by known genetic events?

2. What sequence of pi could not be explained by as-yet-unknown naturalistic processes?

3. What is more likely, 100 binary places of pi or 1700 consecutive GAA triplets on a chromosome?
See http://www.ich.ucl.ac.uk/cmgs/neuro99.htm

4. How far into pi does your phone number occur?
See http://www.angio.net/pi/piquery

5. What are the chances of finding self-referential loop sequences in transcendental numbers? Would this be evidence for design?
See http://www.angio.net/pi/piquery

  
PaulK



Posts: 37
Joined: June 2004

(Permalink) Posted: Nov. 15 2005,01:36   

Intelligent design could, in principle, be scientific.  But I don't beleive that a single data point - no matter how puzzling - is enough.

What it would take in my view is the production of fruitful design hypotheses.  That is constructing hypotheses about what the Designer would do that lead to predictions about what we will find.

  
Wesley R. Elsberry



Posts: 4880
Joined: May 2002

(Permalink) Posted: Nov. 15 2005,02:27   

Back in 1997 at the first DI CRSC conference, we critics were asked to say that ID either was scientific or could, in principle, be scientific. We asked what would an ID hypothesis look like, and how would it be tested. We were told that would follow in the fullness of time.

Time seems to be getting fuller and fuller, but so far that specification of an ID hypothesis and means of testing it remains firmly backordered.

ID advocates need to tell us what must be true if their conjecture is true. So far, all we get is Paleyist "looks designed to me" stuff and "evolution doesn't explain X".

As for design detection, try out The Advantages of Theft Over Toil. Then go on to Information Theory, Evolutionary Computation, and Dembski’s Complex Specified Information.

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
Russell



Posts: 1082
Joined: April 2005

(Permalink) Posted: Nov. 15 2005,06:08   

ooh ooh ooh! can I play?

Quote
1. What sequence of pi could not be explained by known genetic events?
None, of course. What would seem to call for an explanation is the remarkable coincidence that such a sequence should occur in a genome. To wit: 100 nucleotides of a pre-specified sequence having no conceivable (or at least no conceived of as yet) connection to the biology, chemistry or physics of DNA, should occur by chance about once in every 4^100, or 1.6x10^60 sites examined. H. sapiens, for example, has about 3x10^9 sites to examine, so the odds of finding it by chance would be around 2x10^-51. Examine a million or so more completely independent genomes (of course, they don't exist, due to common descent, but just for the sake of argument...) you've only increased the chances to 2x10^-45. In other words, finding it would so defy the odds it would seem to call for some explanation. But now include the possibility of finding either pi, or 'e', or the Golden Ratio, or any of about 3 billion more irrational numbers, and your chance of finding oneof them is pretty good. (This is essentially what Dembski does.)

Quote
2. What sequence of pi could not be explained by as-yet-unknown naturalistic processes?
None, of course.

Quote
3. What is more likely, 100 binary places of pi or 1700 consecutive GAA triplets on a chromosome?
The latter, since they can arise by known mechanisms of polymerase "stuttering" and homologous recombination.

Quote
4. How far into pi does your phone number occur?
Don't know, but it should be on the order of 10,000,000 decimal places (16,666,667 DNA base pairs) - not including the area code. I.e it has a good chance of being found at least a hundred times in the human genome. In fact, I think that might be where the telemarketers found it.

--------------
Must... not... scratch... mosquito bite.

  
DaveRAFinn



Posts: 15
Joined: April 2005

(Permalink) Posted: Nov. 15 2005,06:33   

One of the main reasons that ID has a bad reputation is that the proponents confuse the concepts of intelligent creator and god. The two are quite distinct and indeed incompatible - an intelligent creator is, by definition, working within rules to achieve an effect, a god, presumably, is above rules and operates by whim.

An example of a scientific intelligent creator theory can be obtained by noting that any gravitationally dominated universe is unstable (see Einstein). A stable universe can only be obtained by use of a feedback system. One may offer the theory that since the universe is highly chaotic (in the technical sense), contains black holes (which affect curvature) and has intelligent life it has the necessary components of a feedback system (detector, amplifier, corrective effect) and may eventually acquire one once we have learnt how to play our part. The theory that the universe is optimised for this condition is an ID theory. It is testable - the optimisation can be checked and proved (or more probably disproved). Within any physical theory of this type the optimisation formula is the only representation of ID - essentially the formula is the ID, anything else is speculation and the ID would have a similar function to any other natural law. The only difference being that it is intentional in the sense that it is goal directed - the effect precedes the cause.

  
lutsko



Posts: 8
Joined: Nov. 2005

(Permalink) Posted: Nov. 15 2005,07:25   

"1. What sequence of pi could not be explained by known genetic events? Etc."

I think good answers to these questions were given a few posts up. One interesting question asked was "what are the odds if you consider all the possible irrational numbers one might look for"? Here, I think it necessary to step back and consider: why would a designer embed such a message in the genome. Clearly, it is **because** he wants to leave a signiture. Being a super-capable genetic engineer, I suppose he would know how many base pairs there were, etc. and would make the message unmistakeable, which i take to be ridiculously outside the bounds of chance. Whether that means pi to 100 digits or euler's constant to 10,000 i don't know but it wouldn't make sense otherwise.

[I have no trouble with this sort of speculation. The ID'ers wouldn't like it because it requires "reading the mind of God". God would of course leave a signal just ambigous enough to be explainable by chance but convincing to the ID'ers - like he always does.]

  
Hyperion



Posts: 31
Joined: June 2005

(Permalink) Posted: Nov. 15 2005,09:00   

I think that it becomes obvious pretty quickly, reading through our hypotheses, that one cannot know what evidence would point to a designer without first knowing the identity, or at least abilities and constraints, of the designer.

Since the ID camps has pretty much refused to state anything about their hypothetical designer, and in many cases their Fellows have implied that their "theory" does not describe the designer at all and never will, then there is simply no method of knowing what might constitute evidence for design.

No ID hypothesis or theory can be considered even testable unless it defines the "designer," and describes its methods, as I think our little exercise in hypotheticals here has shown quite well.

  
Russell



Posts: 1082
Joined: April 2005

(Permalink) Posted: Nov. 15 2005,09:04   

I think Lutsko is on to something here! Far more useful than any of the games they're playing now, the ID crowd should immediately drop everything else and begin scouring the genetic databanks for any of the 3 or 4 most obvious irrational numbers. If and when they find any of them to at least 100 basepairs, using any of the 24 possible 1 to 1 nucleotide to base-4 digit assignment schemes, they will earned some attention. Until then, their demands for attention are just a nuisance.

--------------
Must... not... scratch... mosquito bite.

  
Bulman



Posts: 8
Joined: Nov. 2005

(Permalink) Posted: Nov. 15 2005,10:57   

I feel a strong urge to bring up the "poker response".  A royal flush is a highly unlikely hand to get, but given that you were dealt five cards, any hand you could possibly hold has the exact same odds of occuring.  

"Junk DNA" carried out to a hundred digits assigning the numbers 1-4 (arbitrarily to each nucleotide) will consist of a hundred digits.  Getting Pi would be nothing more than "neat".  Maybe even "neat-o".

Although numerology can be fun, and is a science according to Behe (SATB), it should be used for entertainment only.

  
Russell



Posts: 1082
Joined: April 2005

(Permalink) Posted: Nov. 15 2005,12:26   

Bulman: you're right, the odds of getting a royal flush are the same as the odds of getting any hand of 5 cards. But the odds of saying: "The next hand I am dealt will be 2H,QD,JS,5H,KC" - and then getting it, in that order no less - would be a truly remarkable coincidence, or demand a nonchance explanation.

So, yes, finding any sequence of 100 nucleotides corresponding to an irrational number would be no more than "neat". But saying, in advance, that you're going to find one in particular - like Pi - and then actually finding it. Well, that would be impressive.

Dembski & co. are right if they say that finding such a thing would deserve more than a passing "neat-o" (provided, as I stipulated above, that (1) we know what we're looking for, and (2) define our "translation algorithm" before we start looking, and (3) what we're looking for has no plausible mechanism - like polymerase stuttering and homologous recombination to explain it in advance). But they're dead wrong in claiming that anything seen in any genome to date does anything like that.

--------------
Must... not... scratch... mosquito bite.

  
Bulman



Posts: 8
Joined: Nov. 2005

(Permalink) Posted: Nov. 15 2005,12:42   

"But the odds of saying: "The next hand I am dealt will be 2H,QD,JS,5H,KC" - and then getting it, in that order no less - would be a truly remarkable coincidence, or demand a nonchance explanation."

You're right, that does change things quite a bit from the regular poker argument.  I will admit that your argument is better.  However, I must succumb to the tempting practice of changing the argument when faced with valid refutation:

Lottery numbers are picked (or randomly generated) prior to drawings, and in the "PowerBall" versions the sequence does play a role.

**Edit**  But probability-wise, let them go on a merry chase and perhaps it will advance science by serendipity.

  
WayneFrancis



Posts: 4
Joined: Nov. 2005

(Permalink) Posted: Nov. 15 2005,19:31   

From the original poster
"I do not mean any arcane code: suppose each amino acid corresponded to one of the digits from 0 to 3 and the number was coded in base 4."

First amino acids are base 22 in DNA.  What you are talking about is nucleotides.

And even at that simple level we are left with 24 different combinations we would have to search for.  Which is far better then the 1,124,000,727,777,607,680,000 different combinations we would have to search for if we worked at the amino acid level.

Add to this the arbitrary selection of what "constant" we should look for along with the arbitrary "precision" we would look for said constant makes this search useless.

Hundreds or even thousands of constants to choose from, the vast range of precisions we could look for in each constants multiplied by 24 different translations of the base 4 leaves you with a very good chance that you will find some constant of some significant precision in some genome of some individual.  

We should also not expect an ID to put PI into any genome.  This is because PI can not be represented digitally accurately for 2 reasons
1) digital systems can not represent irrational numbers
2) digital systems need an agreed upon standard to translate real, rational and irrational, numbers into a digital format.  
This means we have to know how many digits are used to represent a standard number and how many of those digits represent the scale of said number.

Most of our computer systems use the following for a double precision floating point number (ie 64 bit).
Sign Bit = 1 bit
Exponent = 11 bits
Fraction = 52 bits
there is some serious logic in the use of floats.  The standards took a lot of work before it was agreed upon and I don't expect anyone that is not familiar with the IEEE 754 standard to be able to look at

11110000 11001100 10101010 00001111

and tell me what that binary number represents.
Just as I could not expect any scientist to look at

GCAGGTTAACAAGGAGTTTGCTAGAT

and tell me what number that represents.  Without a documented standard you would have no hope.

Do you have God's, I mean the Intelligent Designers, standards handy?

  
WayneFrancis



Posts: 4
Joined: Nov. 2005

(Permalink) Posted: Nov. 15 2005,19:39   

Quote
Whether that means pi to 100 digits or euler's constant to 10,000 i don't know but it wouldn't make sense otherwise.


so you do not know something but you know it makes sense?  

Please hand me over the "super-capable genetic engineer"'s standards for storing real numbers in a base 4 digital storage system.  Since you "know" it to be a sign of the "super-capable genetic engineer" then you must "know" the standards said "super-capable genetic engineer" uses.  Without said standards we have bucklies of finding this "unmistakeable message" left behind for us.

  
Tim Hague



Posts: 32
Joined: Nov. 2005

(Permalink) Posted: Nov. 16 2005,22:16   

Quote
ooh ooh ooh! can I play?

1. What sequence of pi could not be explained by known genetic events? None, of course.  


You are wrong unfortunately.  

Assuming some standard of coding was agreed on there is no particular reason why a human scientist couldn't manufacture a DNA sequence representing pi and splice it into a living organism.  

Which would class as a known genetic event.

   
  60 replies since Nov. 14 2005,08:29 < Next Oldest | Next Newest >  

Pages: (3) < [1] 2 3 >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]