RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (17) < [1] 2 3 4 5 6 ... >   
  Topic: Otangelo's thread< Next Oldest | Next Newest >  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,11:01   

Quote (OgreMkV @ July 27 2015,11:56)
Kirk Dunstan has an amazing case of hypocrisy.

He posts about whether we should have faith in science here: http://www.evolutionnews.org/2015.......51.html

Of course, he completely fails to mention that ID fails all of the tests he mentions.

Quote
Of course, he completely fails to mention that ID fails all of the tests he mentions.


Does it ? Could you provide a list of ID predictions that failed ?

In my book, the picture looks  different

http://reasonandscience.heavenforum.org/t1659-c....ictions

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,14:48   

Quote (Otangelo @ Nov. 15 2015,11:01)
 
Quote (OgreMkV @ July 27 2015,11:56)
Kirk Dunstan has an amazing case of hypocrisy.

He posts about whether we should have faith in science here: http://www.evolutionnews.org/2015.......51.html

Of course, he completely fails to mention that ID fails all of the tests he mentions.

   
Quote
Of course, he completely fails to mention that ID fails all of the tests he mentions.


Does it ? Could you provide a list of ID predictions that failed ?

In my book, the picture looks  different

http://reasonandscience.heavenforum.org/t1659-c....ictions

ID hasn't made any predictions that are exclusive to "Design".  Every claimed ID prediction is actually a postdiction of events that are attributable to natural evolutionary processes.  Every.  Last.  One.

IDiots love to play at science.  They got tired of having no peer reviewed science articles so they created their own bogus IDiot journal, Bio-Complexity, so they could claim peer review.  They got tired of having no predictions so they made some simple observations and claimed they are predicted by ID.  Most are of the form "ID predicts the sky will be blue so a blue sky supports ID" worthless stupidity.

The simple fact is ID can't make any testable predictions unless and until they define the capabilities and limitations of their "Designer".  Of course they never will because their "Designer" is their omnipotent God who literally could produce anything.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,15:07   

Quote (Otangelo @ Nov. 15 2015,11:01)
Quote (OgreMkV @ July 27 2015,11:56)
Kirk Dunstan has an amazing case of hypocrisy.

He posts about whether we should have faith in science here: http://www.evolutionnews.org/2015.......51.html

Of course, he completely fails to mention that ID fails all of the tests he mentions.

Quote
Of course, he completely fails to mention that ID fails all of the tests he mentions.


Does it ? Could you provide a list of ID predictions that failed ?

In my book, the picture looks  different

http://reasonandscience.heavenforum.org/t1659-c....ictions

Complex systems can't evolve: Behe 1996
Of course, he's changed his mind and said that SOME complex system can't evolve. Of course, he's wrong.

More than two positive mutations in one gene are nearly impossible (also Behe). Failed. At least one example I know of shows that 4 clusters of positive mutations evolved in a single ribozyme in less than 72 hours.

If you will look very carefully, you will discover (as I have) that there is no mention of Junk DNA by any ID proponent until well after biologists have given evidence for it. Even further, they don't explain WHY ID predicts junk DNA... or no junk DNA.

Mutations cause organisms to degrade (many ID proponents). Total failure. It's trivial to show that many mutations are positive.

etc. etc. etc.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,18:18   

Quote (Occam's Aftershave @ Nov. 15 2015,14:48)
Quote (Otangelo @ Nov. 15 2015,11:01)
their "Designer" is their omnipotent God who literally could produce anything.


Of course not.

Most people would say that part of God’s omnipotence is that he can “do anything.” But that’s not really true. It’s more precise to say that he has the power to do all things that power is capable of doing. Power can’t make an illogical statement logical; it can’t create, for example, a square circle. And while an omnipotent Creator can make beings who possess free will, he can’t do that while at the same time controlling their behavior. This would be a contradiction that “power” cannot overcome. In other words, God could prevent all wrongdoing from occurring, or even most of it, but he couldn’t do so without blocking or limiting or overriding our free will.

Furthermore, precisely the opposite of what evolution predicts, ID does. That is :

A vast amount of complex and specified information encoded in a biochemical language;
A computer-like system of commands and codes that processes the information.
Molecular machines and multi-machine systems.
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.

Quote (Otangelo @ Nov. 15 2015,11:01)
their "Designer" is their omnipotent God who literally could produce anything.


Of course not.

Most people would say that part of God’s omnipotence is that he can “do anything.” But that’s not really true. It’s more precise to say that he has the power to do all things that power is capable of doing. Power can’t make an illogical statement logical; it can’t create, for example, a square circle. And while an omnipotent Creator can make beings who possess free will, he can’t do that while at the same time controlling their behavior. This would be a contradiction that “power” cannot overcome. In other words, God could prevent all wrongdoing from occurring, or even most of it, but he couldn’t do so without blocking or limiting or overriding our free will.

Furthermore, precisely the opposite of what evolution predicts, ID does. That is :

A vast amount of complex and specified information encoded in a biochemical language;
A computer-like system of commands and codes that processes the information.
Molecular machines and multi-machine systems.
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,18:26   

Quote (OgreMkV @ Nov. 15 2015,15:07)
[quote=OgreMkV,July 27 2015,11:56]

If you will look very carefully, you will discover (as I have) that there is no mention of Junk DNA by any ID proponent until well after biologists have given evidence for it. Even further, they don't explain WHY ID predicts junk DNA... or no junk DNA.

Mutations cause organisms to degrade (many ID proponents). Total failure. It's trivial to show that many mutations are positive.

etc. etc. etc.

Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? Or where are the transitional fossils prior the Cambrian explosion ? Or that genes and functional parts would  be re-used in different unrelated organisms ? Where are the millions of intermediate forms that should be there ? Did it predict that DNA repair mechanisms would be found ? Or that adaptation to the environment, aka micro change, would be a built in mechanism in the genome ?

These findings are all in line with what we expect to find if a intelligent creator were in play.... and we did.

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,18:38   

Quote (Otangelo @ Nov. 15 2015,18:26)
[quote=OgreMkV,Nov. 15 2015,15:07]
Quote (OgreMkV @ July 27 2015,11:56)


If you will look very carefully, you will discover (as I have) that there is no mention of Junk DNA by any ID proponent until well after biologists have given evidence for it. Even further, they don't explain WHY ID predicts junk DNA... or no junk DNA.

Mutations cause organisms to degrade (many ID proponents). Total failure. It's trivial to show that many mutations are positive.

etc. etc. etc.

Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? Or where are the transitional fossils prior the Cambrian explosion ? Or that genes and functional parts would  be re-used in different unrelated organisms ? Where are the millions of intermediate forms that should be there ? Did it predict that DNA repair mechanisms would be found ? Or that adaptation to the environment, aka micro change, would be a built in mechanism in the genome ?

These findings are all in line with what we expect to find if a intelligent creator were in play.... and we did.

Let me explain something to you. Meyer is a liar. If you think that Precambrian fossils don't exist then you are ignorant of reality. The only question becomes, "Are you willing to learn?"

I personally spent about 9 months digging into the issue you mention in response to writings by ID proponent Meyer. Do you know what I found? Not that he was wrong, but that he purposefully lied in his book about what science says on those subjects.

How do I know he lied? Because that is only possible explanation for having so many papers misrepresented to be the exact opposite of what they actually said.

Now, here's the question again. Are you willing to learn?

I can provide you with about 25,000 words and about 75 peer-reviewed research papers that show that there are plenty of Pre-cambrian fossils, that explains the origin of the body plans (which are pre-cambrian, the millions of intermediate forms that you think don't exist, and what evolution actually is.

Do you want them, will you read them, and will you admit that you are wrong afterwards?

Finally, I would like to point out that you are demanding information, very specific information, when you cannot respond in kind about intelligent design.

Tell us, in detail, what does ID predict about DNA repair enzymes? Why? What part of ID results in that prediction?

You tell us, in detail, where does information in the ID paradigm come from? What evidence do you have that such a source exists? (And, please say "the design". Because circular logic is so much fun to play with.)

So, the ball is in your court. If you are willing to learn, I will happily explain to you, in detail, where ID proponents have lied to you. Are you tough enough to handle it? And can you respond to the same level of detail about your own pet notions?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,18:39   

Quote (Otangelo @ Nov. 15 2015,18:26)
These findings are all in line with what we expect to find if a intelligent creator were in play.... and we did.

Really? You've found an intelligent creator?

What is it? What did it do? When? When was the most recent time it acted? What tools does it use?

How do you know all of the above?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,19:40   

Quote (OgreMkV @ Nov. 15 2015,18:38)

Quote (OgreMkV @ Nov. 15 2015,15:07)

It's trivial to show that many mutations are positive.


ah yah ? how so ? please explain.

Quote

Let me explain something to you. Meyer is a liar. If you think that Precambrian fossils don't exist then you are ignorant of reality. The only question becomes, "Are you willing to learn?"

I personally spent about 9 months digging into the issue you mention in response to writings by ID proponent Meyer. Do you know what I found? Not that he was wrong, but that he purposefully lied in his book about what science says on those subjects.

How do I know he lied? Because that is only possible explanation for having so many papers misrepresented to be the exact opposite of what they actually said.

Now, here's the question again. Are you willing to learn?

I can provide you with about 25,000 words and about 75 peer-reviewed research papers that show that there are plenty of Pre-cambrian fossils, that explains the origin of the body plans (which are pre-cambrian, the millions of intermediate forms that you think don't exist, and what evolution actually is.

Do you want them, will you read them, and will you admit that you are wrong afterwards?


I have read Meyer's book only partially. I know precambrian fossils exist. That is a non-issue. What does not exist, however, i repeat, are millions of intermediate fossils that should show a clear gradative increase of complexity in order to get to the cambrian fossils.

THESE DO NOT EXIST. Refute my claim, if you think i am wrong.

Example ? Show me the precursors of the Trilobite, and the trilobite eye.


Quote

Finally, I would like to point out that you are demanding information, very specific information, when you cannot respond in kind about intelligent design.

Tell us, in detail, what does ID predict about DNA repair enzymes? Why? What part of ID results in that prediction?

You tell us, in detail, where does information in the ID paradigm come from? What evidence do you have that such a source exists? (And, please say "the design". Because circular logic is so much fun to play with.)


Post-diction's, or adaptation of a theory, is common in science ==>> see the Big bang theory.

Truth being told, nobody really predicted DNA repair mechanisms.

The relevant question about them is : How are they best explained, through Design, or the ToE, or natural mechanisms ? ( since they had to emerge prior to life, since life depends on them, evolution is not even a viable option to explain their origin.

In my view, they are best explained through design.

I have a lengthy topic at my virtual library about the issue :

DNA repair mechanisms, designed with special care in order to provide integrity of DNA, and  essential for living organisms of all domains.


http://reasonandscience.heavenforum.org/t2043-d....ir#3475

Maintaining the genetic stability that an organism needs for its survival requires not only an extremely accurate mechanism for replicating DNA, but also mechanisms for repairing the many accidental lesions that occur continually in DNA.

DNA damage is an alteration in the chemical structure of DNA, such as a break in a strand of DNA, a base missing from the backbone of DNA, or a chemically changed base.  Naturally occurring DNA damages arise more than 60,000 times per day per mammalian cell.   DNA damage appears to be a fundamental problem for life. DNA damages are a major primary cause of cancer. DNA damages give rise to mutations and epimutations. The mutations, if not corrected,  would be propagated throughout subsequent cell generations. Such a high rate of random changes in the DNA sequence would have disastrous consequences for an organism

Different pathways for DNA repair exists, Nucleotide excision repair (NER),  Base excision repair (BER),  DNA mismatch repair (MMR),  Repair through alkyltransferase-like proteins (ATLs) amongst others.

Its evident that the repair mechanism is essential for the cell to survive. It could not have evolved after life arose, but must have come into existence before. The mechanism is highly complex and elaborated, as consequence, the design inference is justified and seems to be the best way to explain its existence.

Base excision repair (BER)  involves a category of enzymes  known as  DNA-N-glycosylases.

One example of DNA's  automatic error-correction utilities are enough to stagger the imagination.  There are dozens of repair mechanisms to shield our genetic code from damage; one of them was portrayed in Nature  in terms that should inspire awe.

From Nature's article :
Structure of a repair enzyme interrogating undamaged DNA elucidates recognition of damaged DNA 11

How DNA repair proteins distinguish between the rare sites of damage and the vast expanse of normal DNA is poorly understood. Recognizing the mutagenic lesion 8-oxoguanine (oxoG) represents an especially formidable challenge, because this oxidized nucleobase differs by only two atoms from its normal counterpart, guanine (G).  The X-ray structure of the trapped complex features a target G nucleobase extruded from the DNA helix but denied insertion into the lesion recognition pocket of the enzyme. Free energy difference calculations show that both attractive and repulsive interactions have an important role in the preferential binding of oxoG compared with G to the active site. The structure reveals a remarkably effective gate-keeping strategy for lesion discrimination and suggests a mechanism for oxoG insertion into the hOGG1 active site.

Of the four bases in DNA (C, G, A, and T) cytosine or C is always supposed to pair with guanine, G, and adenine, A, is always supposed to pair with thymine, T.  The enzyme studied by Banerjee et al. in Nature is one of a host of molecular machines called BER glycosylases; this one is called human oxoG glycosylase repair enzyme (hOGG1), and it is specialized for finding a particular type of error: an oxidized G base (guanine).  Oxidation damage can be caused by exposure to ionizing radiation (like sunburn) or free radicals roaming around in the cell nucleus.  The normal G becomes oxoG, making it very slightly out of shape.  There might be one in a million of these on a DNA strand.  While it seems like a minor typo, it can actually cause the translation machinery to insert the wrong amino acid into a protein, with disastrous results, such as colorectal cancer.  12

The machine latches onto the DNA double helix and works its way down the strand, feeling every base on the way.  As it proceeds, it kinks the DNA strand into a sharp angle.  It is built to ignore the T and A bases, but whenever it feels a C, it knows there is supposed to be a G attached.  The machine has precision contact points for C and G.  When the C engages, the base paired to it is flipped up out of the helix into a slot inside the enzyme that is finely crafted to mate with a pure, clean G.  If all is well, it flips the G back into the DNA helix and moves on.  If the base is an oxoG, however, that base gets flipped into another slot further inside, where powerful forces yank the errant base out of the strand so that other machines can insert the correct one.

Now this is all wonderful stuff so far, but as with many things in living cells, the true wonder is in the details.  The thermodynamic energy differences between G and oxoG are extremely slight – oxoG contains only one extra atom of oxygen – and yet this machine is able to discriminate between them to high levels of accuracy.

The author, David, says in the Nature article :

Structural biology:  DNA search and rescue

DNA-repair enzymes amaze us with their ability to search through vast tracts of DNA to find subtle anomalies in the structure. The human repair enzyme 8-oxoguanine glycosylase (hOGG1) is particularly impressive in this regard because it efficiently removes 8-oxoguanine (oxoG), a damaged guanine (G) base containing an extra oxygen atom, and ignores undamaged bases.

Natural selection cannot act without accurate replication, yet the protein machinery for the level of accuracy required is itself built by the very genetic code it is designed to protect.  Thats a catch22 situation.  It would have been challenging enough to explain accurate transcription and translation alone by natural means, but as consequence of UV radiation, it  would have quickly been destroyed through accumulation of errors.  So accurate replication and proofreading are required for the origin of life. How on earth could proofreading enzymes emerge, especially with this degree of fidelity, when they depend on the very information that they are designed to protect?  Think about it....  This is one more prima facie example of chicken and egg situation. What is the alternative explanation to design ? Proofreading DNA by chance ?  And a complex suite of translation machinery without a designer?

I enjoy to learn about the wonder of these incredible mechanisms. If the apostle Paul could understand that creation demands a Creator as he wrote in Romans chapter one 18, how much more we today with all the revelations about cell biology and molecular machines?

Quote

So, the ball is in your court. If you are willing to learn, I will happily explain to you, in detail, where ID proponents have lied to you. Are you tough enough to handle it? And can you respond to the same level of detail about your own pet notions?


I am always keen to learn. It depends however, from who, and if i regard the information given as trust worthy, and the inferences drawn of the evidence compelling.

The same question goes to you. Are you willing to permit the evidence to lead wherever it is ? Even if it is towards the oposit direction that you wish ?

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,20:12   

Quote (Otangelo @ Nov. 15 2015,18:18)
       
Quote (Occam's Aftershave @ Nov. 15 2015,14:48)
 their "Designer" is their omnipotent God who literally could produce anything.
Of course not.


Then describe for us the powers and limitations of your Designer.  Tell us what discoveries would falsify the claim "A Designer did it".

Quote
Furthermore, precisely the opposite of what evolution predicts, ID does. That is :


Why do those things fall out of your ID claims when you admit you have no idea how a Designer would do things?  If we saw the exact opposite you'd claim the Designer did it too.

Quote
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.


Making analogies between human designed things and terms with naturally occurring objects isn't evidence for ID. Creationist FAIL.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,20:23   

Quote (Otangelo @ Nov. 15 2015,19:40)

I have read Meyer's book only partially. I know precambrian fossils exist. That is a non-issue. What does not exist, however, i repeat, are millions of intermediate fossils that should show a clear gradative increase of complexity in order to get to the cambrian fossils.

THESE DO NOT EXIST. Refute my claim, if you think i am wrong.


Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.

Fossilization is extremely rare and gets even more rare the farther back in time you go.  Why do you IDiots think we should have a complete fossil record for events and creatures that existed around a billion years ago?  

 
Quote
The relevant question about them is : How are they best explained, through Design, or the ToE, or natural mechanisms ? ( since they had to emerge prior to life, since life depends on them, evolution is not even a viable option to explain their origin.

In my view, they are best explained through design.


The usual argument from personal incredulity.  "Gee, this is so complex I can't imagine how it evolved, therefore it must be designed".  Before you bore us even more do you have anything not based on your own ignorance or personal incredulity?  Any positive evidence for ID at all?

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,20:45   

Quote (Occam's Aftershave @ Nov. 15 2015,20:12)

Quote (Otangelo @ Nov. 15 2015,18:18)
 Then describe for us the powers and limitations of your Designer.  Tell us what discoveries would falsify the claim "A Designer did it".


I have explained that the designer cannot only tell the truth, and lie at the same time. Or create a square circle. He cannot do illogical things.

For instance, in order to top design, proponents of naturalism would have to be able to provide BETTER explanations in regard of all relevant questions of origins. So far, they have miserably failed.

For example:

http://reasonandscience.heavenforum.org/t1279-a....le#1772

The total lack of any kind of experimental evidence leading even to re-creation of life; not to mention spontaneous emergence of life… is the most humiliating embracement to the evolutionists and the whole so-called “scientific establishment” around it…

One good start would be to be able to come up with a highly likely scenario of abiogenesis....

Quote

Why do those things fall out of your ID claims when you admit you have no idea how a Designer would do things?  If we saw the exact opposite you'd claim the Designer did it too.


Who told you i have no idea ?

How exactly did God create things ? what process was involved ?

http://reasonandscience.heavenforum.org/t1794-h....nvolved

Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.

Quote
Making analogies between human designed things and terms with naturally occurring objects isn't evidence for ID. Creationist FAIL.


Why is it fail ? because you wish so ?

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,20:46   

Quote (Otangelo @ Nov. 15 2015,19:40)
I am always keen to learn. It depends however, from who, and if i regard the information given as trust worthy, and the inferences drawn of the evidence compelling.

The same question goes to you. Are you willing to permit the evidence to lead wherever it is ? Even if it is towards the oposit direction that you wish ?

Define a trustworthy source? Do you consider Nature trustworthy? You must since you used it.


Let me ask you a question. Name one ancestor in the maternal line from between 60 and 100 generation prior to yourself. If you can't, then how do you know you are human?

I guess we can be happy that you didn't cut and paste the entire FORUM POST. Tell, us, what is the nature article that is referred to in that post? Have you read it? Or is "Admin" a trustworthy source? If so, why?

Please explain, in your own words, how this article supports an ID inference.

OK, hit us with the evidence. Do what no ID proponent has ever done, hit us with the evidence.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,20:56   

Since you like Nature:
http://www.nature.com/nature....a0.html
The Late Precambrian fossil Kimberella is a mollusc-like bilaterian organism

Indeed, here's one of my blog posts with 19 references to precambrian fossils.  http://www.skepticink.com/smilodonsretreat/2013/10/22/a-survey-of-precambrian-animals/

Since 2012, Google Scholar reports 4000+ hits on Precambrian and fossils.

For example, here’s a new  Ediacaran organism that represents the oldest multielement organism with structural support through either biomineralization or chitin. http://geology.gsapubs.org/content....7.short

Here’s some prokaryote and eukaryote cells preserved in one billion year old lake sediments. http://geology.gsapubs.org/content....7.short

Here’s a new tubular Ediacaran fossil from India. http://onlinelibrary.wiley.com/doi....d=false

A discussion of the origin of Athropods, with 4 reference papers: http://www.skepticink.com/smilodo....-part-2

Here's an excellent discussion on the lengths that ID authors go to ignore certain parts of a paper that would directly refute them if they read the whole thing: http://www.skepticink.com/smilodo....er-mine

Your turn. Explain, in detail, what you think ID is, how it works, and how you know so.

Now I expect a minimum of 25 peer-reviewed papers that you have read and can explain in your own words that support the ID notion that you accept.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,20:58   

Quote (Occam's Aftershave @ Nov. 15 2015,20:23)

Quote
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.


Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ? If they were not, why do proponents of evolution not change their mind ? maybe, because their position is not scientific, but rather religious after all ? What evidence would you accept that the ToE is false ? A cambrian rabbit ?

Michael Denton stated:

“It is still, as it was in Darwin's day, overwhelmingly true that the first representatives of all the major classes of organisms known to biology are already highly characteristic of their class when they make their initial appearance in the fossil record. This phenomenon is particularly obvious in the case of the invertebrate fossil record. At its first appearance in the ancient paleozoic seas, invertebrate life was already divided into practically all the major groups with which we are familiar today

anthropologist Edmund Ronald Leach stated:

“ Missing links in the sequence of fossil evidence were a worry to Darwin. He felt sure they would eventually turn up, but they are still missing and seem likely to remain so

One of the most famous proponents of evolution was the late Harvard paleontologist Stephen Jay Gould. But Gould admitted,

"The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology. We fancy ourselves as the only true students of life’s history, yet to preserve our favored account of evolution by natural selection, we view our data as so bad that we never see the very process we profess to study.

In a 1977 paper titled "The Return of Hopeful Monsters", Gould wrote:

"All paleontologists know that the fossil record contains precious little in the way of intermediate forms; transitions between major groups are characteristically abrupt.

Quote

Fossilization is extremely rare and gets even more rare the farther back in time you go.  Why do you IDiots think we should have a complete fossil record for events and creatures that existed around a billion years ago?  


Does the ToE also predict that we should find non-permineralized fossils, and collagen, and proteins preserved in fossils ? And carbon through C14 dating methods ? And if we find such things, is it not obvious and indicative that the dating methods are all bollocks, and fossils are rather young ?? Does that evidence not add to all the other, and provide a BIG blow to deep time nonsense assertions ?

http://reasonandscience.heavenforum.org/t1767-c....e-young

Quote
The usual argument from personal incredulity.  "Gee, this is so complex I can't imagine how it evolved, therefore it must be designed".  Before you bore us even more do you have anything not based on your own ignorance or personal incredulity?  Any positive evidence for ID at all?


Argument from incredulity

http://reasonandscience.heavenforum.org/t1724-a....ty#2738

Incredulity is based on human experience and on what we actually know. For example, the belief in abiogenesis can be strongly doubted, one can be skeptical of it, because it has never been observed and all proposals have lead to a dead end so far. So its more than rational to look somewhere else.  What has been observed is biogenesis, life coming from life. What we know is that the complexity in the natural world of living organisms is similar to, in fact much greater than, the complexity of intelligently created devices, such as the clock or the computer. You might implie that incredulity is an unreasonable position, but it is in fact a foundation for all critical thought. Sensible people do not believe things without evidence. Consider the opposite, credulity; there is no context in which that is not a pejorative word! Considering what atheists are willing to believe, can indeed be classed as credulous.

It is also quite proper for a person of one religion or philosophy to be skeptical of the beliefs of another one. The religion of naturalism, which is the basis of evolution, can properly be rejected by a biblical theist. The evolutionist system may be dominant in some parts of the world, but that says nothing about whether it is true. Many have looked at it and found it inadequate; they have found good reasons to be skeptical of it, especially since theism better explains very many features of the natural world.

When i say that something is unbelievable or inconceivable,  i give good reasons. If my whole argument were simply an unsupported statement of unbelief, you would have a good point; to say something is unbelievable without giving a reason is not a good argument. But the problem is that you oversimplify; you do not address the reasons for incredulity.

Incredulity is an argument of scepticism about a certain point of view, and the evolutionist and atheist are not innocent of using such an argument. Incredulity, doubt and scepticism about God and special creation, are implicit in every naturalistic explanation  about abiogenesis and many other facets of their  view points.

This kind of arguments are frequent :

 how can a perfect deity create such a messed up world? (translation: it is inconceivable that a perfect deity could create such a messed up world, therefore, since evolution is a theory of messed-up, random natural forces and actions, it must be true)
 how can (a certain part of a living organism, e.g., the human eye) be designed when it has this mistake or that problem? (translation: it is inconceivable that an intelligent divine designer could create that supposedly malfunctioning part of the living organism; therefore it must have been formed through random, unintelligent, natural forces, i.e. evolution)

All of these arguments could be accurately classed as arguments of incredulity. If no reason is given, any argument from incredulity is weak.


When a person accuses opposing arguments of
incredulity when they are actually guilty of it themselves, (disbelieving and
being skeptical of what is true and repeatedly proven) and they make attempts
to evade the current evidence and observation instead of dealing with alleged
evidence by refuting it and acknowledging that it exists.
IOW, my argument is not in disbelieving what is objectively factual, it is
actually your argument that is doing this in the face of what we DO observe.

Quote
 Any positive evidence for ID at all?


http://reasonandscience.heavenforum.org/t1983-i....norance

We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems: we have positive experience-based knowledge of a cause that is sufficient to generate new specified information, namely, intelligence. We are not ignorant of how information arises. We know from experience that conscious intelligent agents can create informational sequences and systems. To quote Quastler again, "The creation of new information is habitually associated with conscious activity."2 Experience teaches that whenever large amounts of specified complexity or information are present in an artifact or entity whose causal story is known, invariably creative intelligence—intelligent design—played a role in the origin of that entity. Thus, when we encounter such information in the large biological molecules needed for life, we may infer—based on our knowledge of

established cause-and-effect relationships—that an intelligent cause operated in the past
to produce the specified information necessary to the origin of life.

For this reason, the design inference defended here does not constitute an argument from ignorance. Instead, it constitutes an "inference to the best explanation" based upon our best available knowledge. To establish an explanation as best, a historical scientist must cite positive evidence for the causal adequacy of a proposed cause. Indeed, unlike an argument from ignorance, an inference to the best explanation does not assert the adequacy of one causal explanation merely on the basis of the inadequacy of some other causal explanation. Instead, it asserts the superior explanatory power of a proposed cause based upon its proven—its known—causal adequacy and
based upon a lack of demonstrated efficacy among the competing proposed causes.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,21:05   

Quote (OgreMkV @ Nov. 15 2015,20:46)
Quote (Otangelo @ Nov. 15 2015,19:40)
I am always keen to learn. It depends however, from who, and if i regard the information given as trust worthy, and the inferences drawn of the evidence compelling.

The same question goes to you. Are you willing to permit the evidence to lead wherever it is ? Even if it is towards the oposit direction that you wish ?

Define a trustworthy source? Do you consider Nature trustworthy? You must since you used it.


Let me ask you a question. Name one ancestor in the maternal line from between 60 and 100 generation prior to yourself. If you can't, then how do you know you are human?

I guess we can be happy that you didn't cut and paste the entire FORUM POST. Tell, us, what is the nature article that is referred to in that post? Have you read it? Or is "Admin" a trustworthy source? If so, why?

Please explain, in your own words, how this article supports an ID inference.

OK, hit us with the evidence. Do what no ID proponent has ever done, hit us with the evidence.

[/quote]Or is "Admin" a trustworthy source? If so, why?[/quote]

Just to clarify, i am the Admin of reasonandscience, which is my personal virtual library.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,21:09   

Quote (Otangelo @ Nov. 15 2015,20:58)

   
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.

Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ?


Science has hundreds of well documented transitional sequences in the fossil record, far more than enough to confirm macroevolution.  Only an IDiot would demand that every last fossil in every last lineage be discovered.

(snip the Creationist IDiot quotes, the blatant quote-mining of Gould, the same stupid YEC PRATT claims about dino soft tissue and C-14 dating)

Do you have anything to add besides the usual ID-Creationist C&Ped stupidity?

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,21:14   

Quote (OgreMkV @ Nov. 15 2015,20:56)

Quote
Indeed, here's one of my blog posts with 19 references to precambrian fossils.  http://www.skepticink.com/smilodonsretreat/2013/10/22/a-survey-of-precambrian-animals/


I said previously, the problem is not the inexistence of precambrian fossils, but the missing intermediate ones.

Quote

Here’s some prokaryote and eukaryote cells preserved in one billion year old lake sediments. http://geology.gsapubs.org/content....7.short


Cool. Now explain to me how biomass can remain preserved for 1bio years, LOL........

Quote

A discussion of the origin of Athropods, with 4 reference papers: http://www.skepticink.com/smilodo....-part-2


It would be interesting if you were able to explain on a molecular level, how you think new body parts, like legs, fins, wings etc emerged.

I wrote recently about the origin of tetrapods...

" Tetrapods evolved " . Really ?  

http://reasonandscience.heavenforum.org/t2219-t....trapods

Recently i saw following youtube video : https://www.youtube.com/watch?v....vHYbZ9w



I thought  how much brainpower was required to program and make these robots. In the natural world , according to proponents of naturalism, the required coordination and invention of new limbs was due just to random natural processes. That made me have a closer look what mainstream scientific papers have to say about the subject. How did the first limbs  of tetrapods emerge ? What mechanism is required to grow body parts like legs, and how do proponents of evolution explain the arise of tetrapods ?

According to proponents of evolution, tetrapods arose from a lineage of fish. This kind of dramatic change over time is called macroevolution.
The transition from life in water to life on land would have necessitated dramatic structural changes of the whole body to withstand the increased effects of gravity, amongst other new requirements.
Many aspects of tetrapod origins remain elusive. Its supposed evolution has generated great interest, but the earliest phases of their history are poorly understood. Recent studies have questioned long-accepted hypotheses about the origin of the pentadactyl limb, the phylogeny of tetrapods and the environment in which the first tetrapods lived.
The ‘earliest’ known tetrapods with feet and legs are now thought to have been aquatic animals; proponents of evolution  therefore argue that feet and legs evolved in a shallow water environment and were only later co-opted for use on the land.

Most discussions of the topic concentrate to elucidate if the fossil record permits to find transitional forms that permit infer a water to land transition. Not only are there hudge gaps, but the idea bears big problems conceptually, and as a whole.

http://reasonandscience.heavenforum.org/t1808-t....ht=land

Moreover, as Behe explained nicely : In order to say that some function is understood, every relevant step in the process must be elucidated. The relevant steps in biological processes occur ultimately at the molecular level, so a satisfactory explanation of a biological phenomenon such as the arise of tetrapods must include  how the transition occurred on a molecular explanation. It is no longer sufficient  for an ‘evolutionary explanation’ of that power to invoke only the anatomical structures of whole eyes, as Darwin did in the 19th century and as most popularizers of evolution continue to do today. Anatomy is, quite simply, irrelevant. So is the fossil record. It does not matter whether or not the fossil record is consistent with evolutionary theory, any more than it mattered in physics that Newton’s theory was consistent with everyday experience. The fossil record has nothing to tell us about, say, whether or how the interactions of 11-cis-retinal with rhodopsin, transducin, and phosphodiesterase could have developed step-by-step. Neither do the patterns of biogeography matter, or of population genetics, or the explanations that evolutionary theory has given for rudimentary organs or species abundance.

So rather than stick to anatomy comparisons of fossils that might bear some similarity that could be interpreted as intermediates and evolution of tetrapod limbs from fish fins , let us try to elucidate how significant the  functional and morphological shift was it in terms of the underlying genetic mechanisms . The fossil record provides insight into supposed  morphological changes. However, to understand the underlying mechanisms, we must peer into the gene regulatory networks of living vertebrates.

Do new anatomical structures arise de novo, or do they evolve from pre-existing structures? Advances in developmental genetics, palaeontology and evolutionary developmental biology have recently supposedly  shed light on the origins of  the structures that most intrigued Charles Darwin, including  tetrapod limbs. According to proponents of evolution, structures arose by the modification of pre-existing genetic regulatory circuits.

The genetic program instructs how to make new structures, but that program must be precisely programmed, and  the genetic regulatory circuits need also to be programmed . That is, two separate programs need to emerge, that is 1. the program which defines the physical form and structure, and 2. the program which instructs  where to find the genetic information in the genome, and when to express is during development, that is in the right sequence. That are different layers of information, which must exist fully developed in order to make the new anatomical parts  in question.

The instructions that control when and where a gene is expressed are written in the sequence of DNA bases located in the regulatory region of the gene. These instructions are written in a language that is often called the ‘gene regulatory code’. This code is read and interpreted by proteins called transcription factors that bind to specific sequences of DNA (or ‘DNA words’) and increase or decrease gene expression. Changes in gene expression between species could therefore be due to changes in the transcription factors and/or changes in the instructions within the regulatory regions of specific genes.

In order for communication to happen, 1. The sequence of DNA bases located in the regulatory region of the gene is required , and 2. transcription factors that read the code. If one of both is missing, communication fails, the gene that has to be expressed, cannot be encountered, and the whole procedure of gene expression fails. This is a irreducible complex system. The gene regulatory code could not arise in a step-wise manner either, since if that were the case, the code has only the right significance if fully developed.  Thats a example par excellence of intelligent design.

http://reasonandscience.heavenforum.org/t2220-s....rmation

During vertebrate limb development, Hoxd genes are transcribed in two temporal phases; an early wave controls growth and polarity up to the forearm and a late wave patterns the digits. In this issue of Developmental Cell, Tarchini and Duboule (2006) report that two opposite regulatory modules direct early collinear expression of Hoxd genes.

Question : how could natural mechanisms have programmed and directed the right temporal phases of gene transcription of the right genes,  and early wave control ? Furthermore, the limbs develop at the right place, the right coordinates and positional information is required, they could develop anywhere on the body. Did natural mechanisms find out about the right place by trial and error ? There were myriads of positions possible to add the limb. How could the right and precise coordination of axial position be achieved by mutations ?

The problem is that nature has too many options and without design couldn’t sort them all out. Natural mechanisms are too unspecific to determine any particular outcome. Mutation and natural selection could theoretically form a new complex morphological feature like a  leg or a limb with the right size and form , and arrange to find out the right body location to grow them , but it could  also produce all kinds of other new body forms, and grow and attach them anywhere on the body, most of which have no biological advantage or are most probably deleterious to the organism. Natural mechanisms have no constraints, they could produce any kind of novelty. Its however that kind of freedom that makes it extremely unlikely that mere natural developments provide new specific evolutionary arrangements that are advantageous to the organism.  Nature would have to arrange almost a infinite number of trials and errors until getting a new positive  arrangement. Since that would become a highly  unlikely event, design is a better explanation.

Going over through several mainstream scientific papers, i have not come across one of them, that were able to provide a detailed description how exactly the morphological transition could have occurred through evolution.

Some biologists have also envisioned special mutations in regulatory homeobox or "Hox" genes, where simple mutations might be able to make large developmental changes in an organism which might case a radically different phenotype. However, manipulating "Hox" genes does little to solve the problem of generating novel functional biostructures, for making large changes in phenotype are rarely beneficial. Hox gene mutations may be a more simple mechanism for generating large change, but they also do not escape the problem of the "hopeful monster":"The drawback for scientists is that nature's shrewd economy conceals enormous complexity. Researchers are finding evidence that the Hox genes and the non-Hox homeobox genes are not independent agents but members of vast genetic networks that connect hundreds, perhaps thousands, of other genes. Change one component, and myriad others will change as well--and not necessarily for the better. Thus dreams of tinkering with nature's toolbox to bring to life what scientists call a "hopeful monster"- such as a fish with feet--are likely to remain elusive."Furthermore, many biologists forget when invoking Hox gene mutations that Hox genes can only re-arrange parts which are already there--they cannot create truly novel structures.

Casey Luskin : Hox mutations will never create new "body part genes", and thus cannot add truly new phenotypic functions into the genome, and at best we are left with the quandaries associated with "pre-adaptation". The majority of evolutionary change must take place through evolving new "body part genes", which Hox mutations cannot do. One reviewer in Nature recognizes this fact:"Schwartz ignores the fact that homeobox genes are selector genes. They can do nothing if the genes regulated by them are not there. It is these genes that specify in detail the adaptive structure of the organs. To be sure, turning on a homeobox gene at the wrong place can result in the appearance of an ectopic organ, but only if the genes for that organ are present in the same individual. It is totally wrong to imply that an eye could be produced by a macromutation when no eye was ever present in the lineage before.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,21:15   

Quote (Otangelo @ Nov. 15 2015,21:05)
Just to clarify, i am the Admin of reasonandscience, which is my personal virtual library.

I had a quick look through it.  Seems like you collected every last Creationist/IDiot bit of anti-science nonsense and outright lies posted on the web in the last decade.  It's the mother of all PRATT lists.  Heck, I bet it would even make the YEC C&P King Philip Cunningham (batshit77) envious.  :D

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,21:22   

Quote (Occam's Aftershave @ Nov. 15 2015,21:09)

Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Science has hundreds of well documented transitional sequences in the fossil record, far more than enough to confirm macroevolution.


I don't think so.

“In Chen’s view, his evidence supports a history of life that runs opposite to the standard evolutionary tree diagrams, a progression he calls top-down evolution.”
Jun-Yuan Chen is professor at the Nanjing Institute of Paleontology and Geology
http://www.fredheeren.com/boston.....ton.htm

The following quote is part of a personal letter from Colin Patterson to Luther Sunderland:

      "I fully agree with your comments on the lack of direct illustration of evolutionary transitions in my book. If I knew of any, fossil or living, I would certainly have included them. . .I will lay it on the line, There is not one such fossil for which one might make a watertight argument."

      Dr. Colin Patterson, senior paleontologist at the British Museum of Natural History. The quote is from a personal letter dated 10th April 1979 from Dr. Patterson to creationist Luther D. Sunderland and is referring to Dr. Patterson's book "Evolution" (1978, Routledge & Kegan Paul Ltd.).


More, Louis T. [late Professor of Physics, University of Cincinnati, USA], "The Dogma of Evolution," Princeton University Press: Princeton NJ, 1925, Second Printing, p.160.

"The more one studies palaeontology, the more certain one becomes that evolution is based on faith alone; exactly the same sort of faith which it is necessary to have when one encounters the great mysteries of religion."

[QUOTE][(snip the Creationist IDiot quotes, the blatant quote-mining of Gould, the same stupid YEC PRATT claims about dino soft tissue and C-14 dating)/QUOTE]

If soft tissue  and non permineralized fossils, beside carbon C14 dating is not evidence for young fossils, then i don't know what is.....

Beside this :

The relevant steps in biological processes occur ultimately at the molecular level

http://www.uncommondescent.com/intelli....details

In order to say that some function is understood, every relevant step in the process must be elucidated. The relevant steps in biological processes occur ultimately at the molecular level, so a satisfactory explanation of a biological phenomenon such as sight, or digestion, or immunity, must include a molecular explanation. It is no longer sufficient, now that the black box of vision has been opened, for an ‘evolutionary explanation’ of that power to invoke only the anatomical structures of whole eyes, as Darwin did in the 19th century and as most popularizers of evolution continue to do today. Anatomy is, quite simply, irrelevant. So is the fossil record. It does not matter whether or not the fossil record is consistent with evolutionary theory, any more than it mattered in physics that Newton’s theory was consistent with everyday experience. The fossil record has nothing to tell us about, say, whether or how the interactions of 11-cis-retinal with rhodopsin, transducin, and phosphodiesterase could have developed step-by-step. Neither do the patterns of biogeography matter, or of population genetics, or the explanations that evolutionary theory has given for rudimentary organs or species abundance.

The point which Professor Behe makes for vision applies equally to macroevolution as a whole. The relevant steps in macroevolutionary processes occur ultimately at the molecular level, so a satisfactory explanation of macroevolution must include a molecular explanation.

If, for some reason, certain macroevolutionary transitions appear to be highly improbable from a chemical standpoint, then that in itself is a good reason to be skeptical of the view that Darwin’s theory of evolution is an all-inclusive theory of biology.

(Why Evolution Is True. 2009. Oxford University Press, Glossary, pp. 268-269).

Macroevolution has also been defined by Professor Jerry Coyne as “large changes in body form or the evolution of one type of plant or animal from another type”

Evolutionary change occurs on different scales: ‘microevolution’ is generally equated with events at or below the species level whereas ‘macroevolution’ is change above the species level, including the formation of species.

http://www.evolutionnews.org/2014....61.html

In nature, evolution occurs at the molecular level of specific, individual mutations, so it is there we must look to evaluate possible evolutionary paths. Studies with less detail can say very little on the topic.

Behe, Darwins Black Box, pg.38:
Other ages have been unable to answer many questions that interested them. Furthermore, because we can't yet evaluate the question of eye evolution or beetle evolution does not mean we can't evaluate Darwinism's claims for any biological structure. When we descend from the level of a whole animal (such as a beetle) or whole organ (such as an eye) to the molecular level, then in many cases we can make a judgment on evolution because all of the parts of many discrete molecular systems are known.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,21:25   

Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,21:26   

Quote (Occam's Aftershave @ Nov. 15 2015,21:15)

Quote
I had a quick look through it.


Thats a good way to form a prejudice.

Rather than simply copy others say, i mostly educate myself in regard of how specially molecular biological systems work through mainstream books like Molecular biology of the cell, of Bruce Alberts, and from there on infer what best explains their origins.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,21:29   

Quote (Otangelo @ Nov. 15 2015,21:22)

     
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Science has hundreds of well documented transitional sequences in the fossil record, far more than enough to confirm macroevolution.


I don't think so.

No one gives a shit what you think.  The transitional fossils sequences exist and all the C&Ped quote-mined quotes and IDiot denials in the world won't change that.  If you don't have a better explanation for the physical evidence you've got nothing.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,21:30   

Quote (Occam's Aftershave @ Nov. 15 2015,21:25)

Quote
Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?


I copy from my library, and i copy what i elaborated and inferred from the scientific evidence i am encountering .......

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,21:34   

Quote (Occam's Aftershave @ Nov. 15 2015,21:29)

Quote
The transitional fossils sequences exist


1. Similarities does not support evolution. It does prove they look similar.
Similarities has nothing to do with evolution, because it does not prove they came from a the same biological descendant. Because they look similar means they look similar, it does not mean they evolved from simpler life forms.

2. The very fossil evidence that you claim as an evidence in support of evolution in fact defies lending a support. palentologists say that not a single fossil supports the evolution of a single species. Only three prominent sequences. (!) whale (2) horse (3) elephant are said to have been verified through fossils. But each of these sequences have been seriously questioned in literature. The fossils DO NOT SHOW a nearly continous gradation of change over long span of years. but fully developed organisms appear in the fossils entirely discrete and unique with minimal links. No explanations to the mechanism behind the morphological changes that are needed to convert a land trotting mammal to a LIVING SUBMARINE-LIKE WHALE. Questions are galore that the theory of evolution cannot answer or even explain with suiffcient evidence. 

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,21:35   

Quote (Otangelo @ Nov. 15 2015,21:30)
 
Quote (Occam's Aftershave @ Nov. 15 2015,21:25)
Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?


I copy from my library, and i copy what i elaborated and inferred from the scientific evidence i am encountering .......

I take it your answer is no, you can't manage a coherent argument with support from the primary scientific literature.

What a surprise.  ;)

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,21:46   

Quote (Otangelo @ Nov. 15 2015,20:58)
Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ? If they were not, why do proponents of evolution not change their mind ? maybe, because their position is not scientific, but rather religious after all ? What evidence would you accept that the ToE is false ? A cambrian rabbit ?

Actually, they have been found. Quite a bit of them. But you won't find that in creationist literature.

Of course, one thing that evolution does do, is make predictions. For example, the location, time period, and type of fossils that might be found there. Which, not only has been done dozens of times, but there are some excellent stories written for the casual writer... for example, Shubin's "Your Inner Fish".

Name a time when ID or creationism was used to predict the location, time period, and type of fossil.
 
Quote


Michael Denton stated:

“It is still, as it was in Darwin's day, overwhelmingly true that the first representatives of all the major classes of organisms known to biology are already highly characteristic of their class when they make their initial appearance in the fossil record. This phenomenon is particularly obvious in the case of the invertebrate fossil record. At its first appearance in the ancient paleozoic seas, invertebrate life was already divided into practically all the major groups with which we are familiar today

Oh good. Argument by authority. Sadly, I disagree with Denton. Just out of curiosity, do you refer to biochemists for all your paleontology research?

Anyway. This thinking is completely backward. All the major groups were invented by Linneaus and, as far as I'm concerned, is a terrible idea. It's like we have defined styles of cars now, but now we have to try and fit the Cugnot Steam Trolley into our modern classification system. Is it an F1, SUV, sedan?
 
Quote


anthropologist Edmund Ronald Leach stated:

“ Missing links in the sequence of fossil evidence were a worry to Darwin. He felt sure they would eventually turn up, but they are still missing and seem likely to remain so


What the hell does Darwin have to do with anything?

Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution. None of which support any notion of ID. These papers are as far beyond Darwin could even imagine as my cell phone is to a Victorian detective.
 
Quote


One of the most famous proponents of evolution was the late Harvard paleontologist Stephen Jay Gould. But Gould admitted,

"The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology. We fancy ourselves as the only true students of life’s history, yet to preserve our favored account of evolution by natural selection, we view our data as so bad that we never see the very process we profess to study.


Seriously? Your going to use one of the world's most famous evolutionary biologists and paleontologists to attack evolution. The guy who literally wrote the book on it?

You aren't too bright are you?

Of course, you might continue with the rest of the quote. I hate quoteminers and you seem to be doing a smashing job so far.

The rest of the quote
 
Quote
Darwin's argument still persists as the favored escape of most paleontologists from the embarrassment of a record that seems to show so little of evolution [directly]. In exposing its cultural and methodological roots, I wish in no way to impugn the potential validity of gradualism (for all general views have similar roots). I only wish to point out that it is never "seen" in the rocks.

Paleontologists have paid an exorbitant price for Darwin's argument. We fancy ourselves as the only true students of life's history, yet to preserve our favored account of evolution by natural selection we view our data as so bad that we never see the very process we profess to study.

For several years, Niles Eldredge of the American Museum of Natural History and I have been advocating a resolution to this uncomfortable paradox. We believe that Huxley was right in his warning [1]. The modern theory of evolution does not require gradual change. In fact, the operation of Darwinian processes should yield exactly what we see in the fossil record. [It is gradualism we should reject, not Darwinism.]


 
Quote


In a 1977 paper titled "The Return of Hopeful Monsters", Gould wrote:

"All paleontologists know that the fossil record contains precious little in the way of intermediate forms; transitions between major groups are characteristically abrupt.


Again, another quote mine. You might want to continue the quote...
 
Quote

But all theories of discontinuous change are not anti-Darwinian, as Huxley pointed out nearly 120 years ago. Suppose that a discontinuous change in adult form arises from a small genetic alteration. Problems of discordance with other members of the species do not arise, and the large, favorable variant can spread through a population in Darwinian fashion. Suppose also that this large change does not produce a perfected form all at once, but rather serves as a "key" adaptation to shift its possessor toward a new mode of life. Continued success in this new mode may require a large set of collateral alterations, morphological and behavioral; these may arise by a more traditional, gradual route once the key adaptation forces a profound shift in selective pressures.


 
Quote


 
Quote

Fossilization is extremely rare and gets even more rare the farther back in time you go.  Why do you IDiots think we should have a complete fossil record for events and creatures that existed around a billion years ago?  


Does the ToE also predict that we should find non-permineralized fossils, and collagen, and proteins preserved in fossils ? And carbon through C14 dating methods ? And if we find such things, is it not obvious and indicative that the dating methods are all bollocks, and fossils are rather young ?? Does that evidence not add to all the other, and provide a BIG blow to deep time nonsense assertions ?

[URL=http://reasonandscience.heavenforum.org/t1767-carbon-14-dated-dinosaur-bones-and-non-permineralized-soft-tissue-evidences-fossils-



are-young]http://reasonandscience.heavenforum.org/t1767-c....e-young[/URL]


Let me guess... "triceratops horns" that come from strata with bison horns and actually look a lot like bison horns. sigh
 
Quote


 
Quote
The usual argument from personal incredulity.  "Gee, this is so complex I can't imagine how it evolved, therefore it must be designed".  Before you bore us even more do you have anything not based on your own ignorance or personal incredulity?  Any positive evidence for ID at all?


Argument from incredulity

http://reasonandscience.heavenforum.org/t1724-a....ty#2738

Incredulity is based on human experience and on what we actually know. For example, the belief in abiogenesis can be strongly doubted, one can be skeptical of it, because it has never been observed and all proposals have lead to a dead end so far.


Wrong. Abiogenesis is an extremely well studied subject. One in which every single molecule and system needed for life has been observed to occur without an intelligent agent given the right conditions.

Of course, I'll just add, how hypocritical of you this particular thing is... since you demand life from scratch, yet have utterly failed to even begin to support the idea of ID.

Here's a hint. Even if you were to prove evolution 100% totally wrong, right now... it still doesn't make ID true. Only positive supporting evidence can do that and you don't have any. I know that because if you did, you would have published it and have gotten the Nobel prize.

BTW: Are you also GIBHOR, banned from the international skeptics forum? If not, then you are plagiarizing him and that's not right either.

Are you also GodExists, banned from the thethinkingatheist forum? If not, then you are plagiarizing him too.

 
Quote


So its more than rational to look somewhere else.  What has been observed is biogenesis, life coming from life.


That's true. But that has nothing to do with before there was life on Earth does it? We know that there a period with no life. And we know there was a period with life. We know that a large variety of chemical reactions results in concentrations of chemicals that can self-assemble into complex long chain structures, that even have the ability to self-reproduce.

What's your explanation and what is the evidence for it.

Just because something is complex doesn't mean it needs a designer. That's an anthropomorphic assumption on your part and it's a false assumption that you are NOT THINKING CRITICALLY about.
 
Quote


What we know is that the complexity in the natural world of living organisms is similar to, in fact much greater than, the complexity of intelligently created devices, such as the clock or the computer.

You might implie that incredulity is an unreasonable position, but it is in fact a foundation for all critical thought. Sensible people do not believe things without evidence. Consider the opposite, credulity; there is no context in which that is not a pejorative word! Considering what atheists are willing to believe, can indeed be classed as credulous.


You are absolutely correct. SO, provide the evidence for your claims that ID is valid. We're all waiting.

So far, I've shown that your claims are very much not correct. Therefore, you claims about evolution are not valid. This is supported by evidence (ignoring the actual fossil record, purposefully misquoting people, etc).
 
Quote


It is also quite proper for a person of one religion or philosophy to be skeptical of the beliefs of another one. The religion of naturalism, which is the basis of evolution, can properly be rejected by a biblical theist. The evolutionist system may be dominant in some parts of the world, but that says nothing about whether it is true. Many have looked at it and found it inadequate; they have found good reasons to be skeptical of it, especially since theism better explains very many features of the natural world.


You can reject naturalism all you want. Hypocrite.

But if you do, then you should be living in a cave, eating carrion and rotten fruit. But you aren't. You're enjoying the results of all that naturalistic thinking all the while complaining about it.
 
Quote



When i say that something is unbelievable or inconceivable,  i give good reasons. If my whole argument were simply an unsupported statement of unbelief, you would have a good point; to say something is unbelievable without giving a reason is not a good argument. But the problem is that you oversimplify; you do not address the reasons for incredulity.

Incredulity is an argument of scepticism about a certain point of view, and the evolutionist and atheist are not innocent of using such an argument. Incredulity, doubt and scepticism about God and special creation, are implicit in every naturalistic explanation  about abiogenesis and many other facets of their  view points.


Great. Provide the evidence that god exists and I will accept him. But it'll take a lot of evidence.

SNIP

Here's the deal. No one here cares about your god. And, if you use god as a basis for your science, then it can never be taught in a school. Thanks for that own goal, BTW/

 
Quote


We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems: we have positive experience-based knowledge of a cause that is sufficient to generate new specified information, namely, intelligence.

So what?
 
Quote

We are not ignorant of how information arises. We know from experience that conscious intelligent agents can create informational sequences and systems.

So what?
 
Quote

To quote Quastler again, "The creation of new information is habitually associated with conscious activity."

But not ALL the time and that's where the entire argument fails.
 
Quote

Experience teaches that whenever large amounts of specified complexity

Define this term. Use math.
 
Quote


or information


Define this term. Use math.
 
Quote


are present in an artifact or entity whose causal story is known, invariably creative intelligence—intelligent design—played a role in the origin of that entity. Thus, when we encounter such information in the large biological molecules needed for life, we may infer—based on our knowledge of established cause-and-effect relationships—that an intelligent cause operated in the past
to produce the specified information necessary to the origin of life.


And that's the leap that cause the entire argument to fail.

Just because intelligence CAN do so, doesn't mean that intelligence is REQUIRED to do so.

Further we need evidence that an intelligence CAN do so is required, because no known intelligence can do that.

Quote


For this reason, the design inference defended here does not constitute an argument from ignorance. Instead, it constitutes an "inference to the best explanation" based upon our best available knowledge. To establish an explanation as best, a historical scientist must cite positive evidence for the causal adequacy of a proposed cause. Indeed, unlike an argument from ignorance, an inference to the best explanation does not assert the adequacy of one causal explanation merely on the basis of the inadequacy of some other causal explanation. Instead, it asserts the superior explanatory power of a proposed cause based upon its proven—its known—causal adequacy and based upon a lack of demonstrated efficacy among the competing proposed causes.

And it's all so much bullshit.

But thanks for recycling an argument that has been defunct for over a century now.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,21:47   

Quote (Occam's Aftershave @ Nov. 15 2015,21:35)
Quote (Otangelo @ Nov. 15 2015,21:30)
 
Quote (Occam's Aftershave @ Nov. 15 2015,21:25)
Oh and Otangelo, you can knock off the CopyPasta-fest.  No one and I do mean no one is interested in reading mountains of steaming bullshit from IDiots like Behe and Luskin.

Pick one narrow topic, argue it in your own words.  Support your argument with evidence from the primary scientific literature, not quote-mines and unsupported over-the-top claims from ID-Creationists crap sites.  

Think you can manage that?


I copy from my library, and i copy what i elaborated and inferred from the scientific evidence i am encountering .......

I take it your answer is no, you can't manage a coherent argument with support from the primary scientific literature.

What a surprise.  ;)

Quote

I take it your answer is no, you can't manage a coherent argument with support from the primary scientific literature.

What a surprise.  ;)


Feel free to substantiate your assertion.

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,21:47   

"Cool. Now explain to me how biomass can remain preserved for 1bio years, LOL........"

If you think minerilization doesn't occur, you really need to learn some stuff before even attempting this.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,21:48   

Quote (Otangelo @ Nov. 15 2015,21:34)

1. Similarities does not support evolution. It does prove they look similar.
Similarities has nothing to do with evolution, because it does not prove they came from a the same biological descendant. Because they look similar means they look similar, it does not mean they evolved from simpler life forms.


The morphological similarities combined with the physical /temporal distribution of the fossils create a distinct phylogenetic tree.  This same phylogenetic tree also emerges from the genetic record of extant animals.  Taken together they're conclusive evidence for macroevolution over deep time.

Quote
2. The very fossil evidence that you claim as an evidence in support of evolution in fact defies lending a support. palentologists say that not a single fossil supports the evolution of a single species. Only three prominent sequences. (!) whale (2) horse (3) elephant are said to have been verified through fossils. But each of these sequences have been seriously questioned in literature.


What a crock.  We've got sequences for the sirenians, and for the giraffidae, and felidae, and canidae, and dozens of other well known families.  Your credibility is zero.

Quote
The fossils DO NOT SHOW a nearly continous gradation of change over long span of years. but fully developed organisms appear in the fossils entirely discrete and unique with minimal links.


(facepalm) what would a half-developed animal look like?

Quote
No explanations to the mechanism behind the morphological changes that are needed to convert a land trotting mammal to a LIVING SUBMARINE-LIKE WHALE.


Of course we know of the evolutionary mechanisms and have even mapped most of the major genetic changes.  Where are you getting this nonsense?

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,21:52   

Quote (Otangelo @ Nov. 15 2015,21:47)
Feel free to substantiate your assertion.

That you can't manage a coherent argument with support from the primary scientific literature?

That's easy enough.  I'll just wait here while you sputter and bluster and C&P more Creationist crap without ever once making a coherent argument with support from the primary scientific literature.   You'll demonstrate for me.  :)

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 15 2015,21:58   

Quote (Otangelo @ Nov. 15 2015,21:34)
[quote=Occam's Aftershave,Nov. 15 2015,21:29][/quote]
Quote
The transitional fossils sequences exist


1. Similarities does not support evolution. It does prove they look similar.
Similarities has nothing to do with evolution, because it does not prove they came from a the same biological descendant. Because they look similar means they look similar, it does not mean they evolved from simpler life forms.

2. The very fossil evidence that you claim as an evidence in support of evolution in fact defies lending a support. palentologists say that not a single fossil supports the evolution of a single species. Only three prominent sequences. (!) whale (2) horse (3) elephant are said to have been verified through fossils. But each of these sequences have been seriously questioned in literature. The fossils DO NOT SHOW a nearly continous gradation of change over long span of years. but fully developed organisms appear in the fossils entirely discrete and unique with minimal links. No explanations to the mechanism behind the morphological changes that are needed to convert a land trotting mammal to a LIVING SUBMARINE-LIKE WHALE. Questions are galore that the theory of evolution cannot answer or even explain with suiffcient evidence. 

You really don't understand how this works do you?

I once had an ID proponent try to argue that moles and certain insect could be related because the looked similar. They both have big claws on the front used for digging. Yes, let's completely ignore the VAST array of evidence that doesn't support relatedness (reproduction method, growth method, non-digging anatomy, biochemical structures, etc. etc. etc.). Let's just focus on that one thing.

Dude, the people who do this work aren't looking at a dinosaur and a bird and saying "They look similar so they must be related". There is a significant amount of work that goes into a claim like that... with significant amounts of evidence. But don't let that change your mind. I'd hate for you to actually think about evidence.

I will continue to note that you have not responded in a positive way to any of the questions I've asked.

If you need a list, I will provide it.

But again, how can you prove you are human if you don't know any of your ancestors 60 generations ago? Without that, you can't know that you aren't the result of aliens, monkeys, neanderthals, or whatever.

Yes, it's a stupid argument... and you are using the exact same argument.

About whales. Answer this question... What defines a cetacean?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,22:09   

Quote (OgreMkV @ Nov. 15 2015,21:46)

Quote
Wrong. Abiogenesis is an extremely well studied subject. One in which every single molecule and system needed for life has been observed to occur without an intelligent agent given the right conditions.


haha. Thats precious...


Quote
Here's a hint. Even if you were to prove evolution 100% totally wrong, right now... it still doesn't make ID true.


A Positive, Testable Case for Intelligent Design

http://www.evolutionnews.org/2011....11.html

Quote

BTW: Are you also GIBHOR, banned from the international skeptics forum? If not, then you are plagiarizing him and that's not right either.

Are you also GodExists, banned from the thethinkingatheist forum? If not, then you are plagiarizing him too.  


Yes, i am both.

Quote

That's true. But that has nothing to do with before there was life on Earth does it? We know that there a period with no life. And we know there was a period with life. We know that a large variety of chemical reactions results in concentrations of chemicals that can self-assemble into complex long chain structures, that even have the ability to self-reproduce.


No, we do not know that.

No evidence that RNA molecules ever had the broad range of catalytic activities

http://reasonandscience.heavenforum.org/t2024-t....fe#3415

OOL theorist Leslie Orgel notes that

an "RNA World" could only form the basis for life, "if prebiotic RNA had two properties not evident today: a capacity to replicate without the help of proteins and an ability to catalyze every step of protein synthesis." The RNA world is thus a hypothetical system behind which there is little positive evidence, and much materialist philosophy: "The precise events giving rise to the RNA world remain unclear … investigators have proposed many hypotheses, but evidence in favor of each of them is fragmentary at best. The full details of how the RNA world, and life, emerged may not be revealed in the near future.

The best claimed evidence of an "RNA World" includes the fact that there are RNA enzymes and genomes, and that cells use RNA to convert the DNA code into proteins. However, RNA plays only a supporting role in the cell, and there is no known biochemical system completely composed of RNA.

RNA experts have created a variety of RNA molecules which can perform biochemical functions through what is commonly termed "test tube evolution." However, "test tube evolution" is just a description for what is in reality nothing more than chemical engineering in the laboratory employing Darwinian principles; that does not imply that there is some known pathway through which these molecules could arise naturally.

In order a molecule to be a self replicator , it has to be a homopolymer, of which the backbone must have the same repetitive units; they must be identical. On the prebiotic world, the generation of a homopolymer was however impossible.

Steven A. Benner, Ph.D. Chemistry, Harvard, prominent origin-of-life researcher and creator of the Foundation for Applied Molecular Evolution, was posted on Huffington Post on December 6, 2013.  In it he said,

"We have failed in any continuous way to provide a recipe that gets from the simple molecules that we know were present on early Earth to RNA."

That lead Leslie Orgel to say :

It would take a miracle if a strand of RNA ever appeared on the primitive Earth.

(Dover, 1999, p. 218).

I would have thought it relevant to point out for biologists in general that not one self-replicating RNA has emerged to date from quadrillions (1024) of artificially synthesized, random RNA sequences

How  could the first living cells with DNA-based molecular biology have originated by spontaneous chemical processes on the prebiotic Earth? Primordial DNA synthesis would have required the presence of specific enzymes, but how could these enzymes be synthesized without the genetic information in DNA and without RNA for translating that information into the amino acid sequence of the protein enzymes? In other words, proteins are required for DNA synthesis and DNA is required for protein synthesis.

This classic "chicken-and-egg" problem made it immensely difficult to conceive of any plausible prebiotic chemical pathway to the molecular biological system. Certainly no such chemical pathway had been demonstrated


Quote

What's your explanation and what is the evidence for it.

Just because something is complex doesn't mean it needs a designer. That's an anthropomorphic assumption on your part and it's a false assumption that you are NOT THINKING CRITICALLY about.


For instance, thats not how we formulate our arguments.

What type of biological system could not be formed by “numerous successive, slight modifications?” Well, for starters, a system that is irreducibly complex.

By irreducibly complex I mean a single system composed of several well-matched interacting parts that contribute to the basic function, wherein the removal of any one of the [core] parts causes the system to effectively cease functioning.


But today, there are many such cases observed in nature.

High information content machine-like irreducibly complex and interdependent structures,  of which photosynthesis, the eye, the human body, nitrogenase, the ribosome, the cell, rubisco, photosystem II, the oxygen evolving complex etc. are prime examples, are commonly found in nature.
Since Evolution is unable to  provide a advantage of adaptation in each evolutionary step, and is unable to select it,  1) Darwinism’s prediction is falsified; 2) Design’s prediction is confirmed.

Premise One: Despite a thorough search, no material causes have been discovered that demonstrate the power to produce large amounts of specified information, irreducible and interdependent biological systems.
Premise Two: Intelligent causes have demonstrated the power to produce large amounts of specified information, irreducible and interdependent systems of all sorts.
Conclusion: Intelligent design constitutes the best, most causally adequate, explanation for the information and irreducible complexity in the cell, and interdependence of proteins, organelles, and bodyparts, and even of animals and plants, aka moths and flowers, for example.  
 
Quote

You an reject naturalism all you want. Hypocrite.


you can namecall me as much as you want. That does not make your position become more true. Provide better explanations for origins, and we talk.

Quote

But if you do, then you should be living in a cave, eating carrion and rotten fruit. But you aren't. You're enjoying the results of all that naturalistic thinking all the while complaining about it.


I dont think its the moment to elucidate the consequences of your world view on humanity.

Quote

Great. Provide the evidence that god exists and I will accept him. But it'll take a lot of evidence.


What evidence do you expect ?


Quote

Here's the deal. No one here cares about your god. And, if you use god as a basis for your science, then it can never be taught in a school. Thanks for that own goal, BTW/


Well, i believe God certainly cares about you and has shown his love to you, too. And he has proven it.... But it might come a time, when he will not care about you either, anymore, since you rejected him. But then it will be too late.  

Quote

But not ALL the time and that's where the entire argument fails.


1. The pattern in DNA is a code.

2. All codes we know the origin of are designed.

3. Therefore we have 100% inference that DNA is designed and 0% inference that it is not.

Provide one, just ONE example of coded information arising by natural mechanisms, without intelligence involved, and you top my proof. Just one.

Code, by definition, implies intelligence and the genetic code is real code, mathematically identical to that of language, computer codes etc. all of which can only arise by intelligent convention of symbologies. The genome contains meta information and there is now evidence of meta-programming as well. Meta info is information on information and we now know the genome contains such structures. But meta information cannot arise without knowledge of the original information.Meta programming is even more solid evidence of intelligence at work.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,22:13   

Quote (OgreMkV @ Nov. 15 2015,21:47)

Quote
"Cool. Now explain to me how biomass can remain preserved for 1bio years, LOL........"

If you think minerilization doesn't occur, you really need to learn some stuff before even attempting this.


Indeed. In these cases, it did not occur.

Soft tissue cannot remain non-permineralized for  millions of years. That adds to the C14 carbon dating evidence. The best explanation is in my view that the fossils are younger than thought for a long time.

Troy Lawrence Before the global flood, the canopy of water that once surrounded the atmosphere, shielded the atmosphere from UV and other high energy cosmic rays. Thus, the conversion of N2 to C14 was blocked, therefore, the atmosohere had trace amounts of C14 before the flood. And for this reason, C14 dating makes a dead creature that died with trace C14 appear much older than reality.

Organic preservation of fossil musculature with ultracellular detail

http://www.ncbi.nlm.nih.gov/pmc....2842642

SEM images of organically preserved muscle fibres in fossils from Grube Messel.
The muscle is preserved organically, in three dimensions, and with the highest fidelity of morphological preservation yet documented from the fossil record.

All specimens are from the collections of the Forschungsinstitut Senckenberg, Frankfurt. Samples were picked from fossils under a binocular microscope, mounted on SEM stubs, gold-coated and examined with a Hitachi S-3500N variable pressure microscope equipped with an EDAX Genesis energy dispersive spectrometer.

Microspectroscopic Evidence of Cretaceous Bone Proteins

Low concentrations of the structural protein collagen have recently been reported in dinosaur fossils based primarily on mass spectrometric analyses of whole bone extracts. However, direct spectroscopic characterization of isolated fibrous bone tissues, a crucial test of hypotheses of biomolecular preservation over deep time, has not been performed. Here, we demonstrate that endogenous proteinaceous molecules are retained in a humerus from a Late Cretaceous mosasaur (an extinct giant marine lizard).

http://journals.plos.org/plosone....0019445

MICROSTRUCTURE AND BIOGEOCHEMISTRY OF THE ORGANICALLY PRESERVED EDIACARAN METAZOAN SABELLIDITES

Journal of Paleontology, 88(2), 2014, p. 224–239
MAŁGORZATA MOCZYDŁOWSKA,1 FRANCES WESTALL,2 AND FRE´ DE´RIC FOUCHER2

http://www.monash.edu/.......4-e.pdf

The remains of marine worms ‘dated’ at 550 million years old found in Russia have been examined by a team of researchers led by Professor Małgorzata Moczydłowska (pronounced approx. “mou-go-ZHAH-ta mo-chid-WOF-ska”) of Uppsala University, Sweden.3

The tube of S. cambriensis was flexible, as shown by its soft deformation and preservation—Moczydłowska et al., Journal of Paleontology, 2014
They found that the tube casings of the seabed worm Sabellidites cambriensis were still soft and flexible. After comprehensive laboratory analysis, the researchers assessed the seabed worm’s remains to be still composed of the original organic compounds. They ruled out the possibility of modern contaminants and of preservation by various means of mineralization. In the researchers’ own words (from their Journal of Paleontology paper):

“The Sabellidites organic body is preserved without permineralization. Minerals have not replicated any part of the soft tissue and the carbonaceous material of the wall is primary, preserving the original layering of the wall, its texture, and fabrics.”3

And:

“The tube of S. cambriensis was flexible, as shown by its soft deformation and preservation, and composed of fibers perfect in habit and parallel arranged in sheets, and then sheets in layers.”

Within days they were covered by sediment, perhaps stirred up by a storm—Professor Małgorzata Moczydłowska

Accompanying electron microscope photographs showed these ‘perfect in habit’ fibres to be less than half a thousandth of a millimetre wide. Yet these delicate fibres are still soft after supposedly half a billion years!?

The researchers were even able to chemically tease the fibres apart for further examination, and concluded that the structure of the fossil worm tube casing is “consistent with the ß chitin tubes of siboglinid animals”.3 In other words, the same as seabed dwelling worms such as beard worms today (see photo above). Why has there been no evolution in all that (supposed) time?

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,22:17   

Quote (Occam's Aftershave @ Nov. 15 2015,21:48)

Quote

Of course we know of the evolutionary mechanisms and have even mapped most of the major genetic changes.  Where are you getting this nonsense?


haha. the crowd here makes some funny assertions.

EVEN PROPONENTS OF EVOLUTION  ADMIT TO NOT KNOWING HOW EVOLUTION SUPPOSEDLY WORKS:

“Although the vast majority of research in evolutionary biology is focused on adaption, a general theory for the population-genetic mechanisms by which complex adaptations are acquired remains to be developed.”
Proceedings of the National Academy of Sciences of the U.S., “Scaling expectations for the time to establishment of complex adaptations”, September 7, 2010, doi:10.1073/pnas.1010836107.
http://www.pnas.org/content....bstract
“Students should realize that although virtually all scientists accept the general concept of evolution of species, scientists do have different opinions on how fast and by what mechanisms evolution proceeds.”
The American Association for the Advancement of Science, Educational Benchmarks, (F) Evolution of Life
http://www.project2061.org/publica....5.htm#F
“Scientists are still uncovering the specifics of how, when, and why evolution produced the life we see on Earth today.”
Smithsonian’s National Museum of Natural History’s website, “Foundational Concepts: Evolution” page
http://www.nmnh.si.edu/paleo....e3.html
“But they are trying to figure out how evolution happens, and that’s not an easy job.”
University of California Museum of Paleontology and the National Center for Science Education
http://evolution.berkeley.edu/evolibr....0
“Much of the recent experimental work on natural selection has focused on three goals: determining how common it is, identifying the precise genetic changes that give rise to the adaptations produced by natural selection, and assessing just how big a role natural selection plays in a key problem of evolutionary biology—the origin of new species.”
Scientific American Magazine, “The Evolution of Evolution: Testing Natural Selection with Genetics”, December 18, 2008.
http://www.sciam.com/article....nt=true

http://www.discovery.org/a....443

microbiologist James Shapiro of the University of Chicago declared in National Review that "There are no detailed Darwinian accounts for the evolution of any fundamental biochemical or cellular system, only a variety of wishful speculations." (Shapiro 1996)
In Nature University of Chicago evolutionary biologist Jerry Coyne stated,
"There is no doubt that the pathways described by Behe are dauntingly complex, and their evolution will be hard to unravel. . . . We may forever be unable to envisage the first proto-pathways." (Coyne 1996)

In a particularly scathing review in Trends in Ecology and Evolution Tom Cavalier-Smith, an evolutionary biologist at the University of British Columbia, nonetheless wrote, "For none of the cases mentioned by Behe is there yet a comprehensive and detailed explanation of the probable steps in the evolution of the observed complexity.

Evolutionary biologist Andrew Pomiankowski agreed in New Scientist, "Pick up any biochemistry textbook, and you will find perhaps two or three references to evolution. Turn to one of these and you will be lucky to find anything better than 'evolution selects the fittest molecules for their biological function.'" (Pomiankowski 1996)

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 15 2015,22:19   

Quote (Occam's Aftershave @ Nov. 15 2015,21:52)
Quote (Otangelo @ Nov. 15 2015,21:47)
Feel free to substantiate your assertion.

That you can't manage a coherent argument with support from the primary scientific literature?

That's easy enough.  I'll just wait here while you sputter and bluster and C&P more Creationist crap without ever once making a coherent argument with support from the primary scientific literature.   You'll demonstrate for me.  :)

Quote

That you can't manage a coherent argument with support from the primary scientific literature?

That's easy enough.  I'll just wait here while you sputter and bluster and C&P more Creationist crap without ever once making a coherent argument with support from the primary scientific literature.   You'll demonstrate for me.  :)


ahh. So a baseless assertion after all. Thought so.... ???

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,22:22   

Quote (Otangelo @ Nov. 15 2015,22:09)

1. The pattern in DNA is a code.


Only in that it's a physical process that maps the inputs to the outputs.  It doesn't use arbitrary symbols to abstractly represent other values like communication codes do.  There is more than one definition of "code".

Quote
2. All codes we know the origin of are designed.


False.  We know many natural processes that encode information with no need of external intelligence.  

Quote
3. Therefore we have 100% inference that DNA is designed and 0% inference that it is not.


Since 2 is false so is your conclusion.

Quote
Provide one, just ONE example of coded information arising by natural mechanisms, without intelligence involved, and you top my proof. Just one.


I'll give you two.  Tree ring widths encode data about the rainfall conditions in the year of their formation.  The spectral lines in starlight encode data on the chemical composition of the star that produced them.

Creationist FAIL again.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 15 2015,22:25   

Quote (Otangelo @ Nov. 15 2015,22:19)
ahh. So a baseless assertion after all. Thought so

LOL!  You're demonstrating my point with every blithering idiotic Creationist C&Ped word you post.  There's not an original thought in sight.  :D

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Quack



Posts: 1959
Joined: May 2007

(Permalink) Posted: Nov. 16 2015,02:41   

Patterns in nature.

Are not atoms, every single one of them, in addition to being what they are, also a 'code'?

A configuration of nuclear particles, i.e. Neutrons and Protons, and a number of Electrons corresponding to the configuration of the nucleus? That is the code, the code that allow us to determine their properties. But they are not Newtonian balls of matter.

If my understanding is correct, atoms are quantum physical objects. That they "obey the laws of QM" may be an exaggeration, There ain't no such thing as Quantum Law, is there?

But when atoms assemble, create molecules, the bigger they grow, the less they appear as QM objects, and above a certain (blurrred?) level, molecules attain full membership in the Newtonian world?

The world would be a better world without the ID camp and their obsession with codes.

I am only speculating but I am not finished studying yet.

I want to know everything but realize there's a limit to what I can master. After so many years, I still am not comfortable with relativity

--------------
Rocks have no biology.
              Robert Byers.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,05:31   

Quote (Occam's Aftershave @ Nov. 15 2015,22:22)

Quote (Otangelo @ Nov. 15 2015,22:09)

1. The pattern in DNA is a code.


Only in that it's a physical process that maps the inputs to the outputs.  It doesn't use arbitrary symbols to abstractly represent other values like communication codes do.  There is more than one definition of "code".[/quote]

Thats PRECISELY what the DNA code does. It represents YOU for example.

Quote

 Tree ring widths encode data about the rainfall conditions in the year of their formation.  The spectral lines in starlight encode data on the chemical composition of the star that produced them.

Creationist FAIL again.


Thats correct. But they do not represent something else, like the DNA code does. Thats the salient thing about it. The DNA provides a codified representation as a book, a morse code, or a compunter code does.

Feel free to try again.

Fail AGAIN ? AGAIN ?? lol...... . i don

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,05:34   

Quote (Occam's Aftershave @ Nov. 15 2015,22:25)

Quote
 There's not an original thought in sight.  :D


Would you not have just superficially skipped over my answers, you would have discovered the contrary.....

  
Cubist



Posts: 493
Joined: Oct. 2007

(Permalink) Posted: Nov. 16 2015,06:08   

Quote (Otangelo @ Nov. 15 2015,20:58)
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.

Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ?

No. What ToE predicts is that "these transitional fossils" actually did exist at some time in the past. ToE is silent on the question of whether or not "these transitional fossils" should still exist in the present day; it neither mandates their present-day existence, nor forbids their present-day existence.

If you're genuinely interested in the question of what factors influence the survival of a once-living specimen over time, you should look into the scientific field of study called "taphonomy". If you are, instead, only interested in citing lack-of-surviving-fossils as a killer 'gotcha' argument against evolution… well, feel free to keep on treading the mendacious road you're already on.

Quote
Does the ToE also predict that we should find non-permineralized fossils, and collagen, and proteins preserved in fossils ?

No. Once again, you're attempting to fault evolution for its failure to provide answers to questions which are addressed by the scientific field called taphonomy.

Quote
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…

We "know from broad and repeated experience" that human agents "can and do produce information-rich systems", yes. To the best of my knowledge, we have no experience whatsoever of "information-rich systems" being produced by "intelligent agents" other than humans. Perhaps you'd care to cite some evidence of "information-rich systems" being produced by "intelligent agents" other than humans?

  
Cubist



Posts: 493
Joined: Oct. 2007

(Permalink) Posted: Nov. 16 2015,06:19   

Quote (Otangelo @ Nov. 15 2015,22:09)
1. The pattern in DNA is a code.

By at least one definition of the word, sure.

Quote
2. All codes we know the origin of are designed.

More specifically: All codes we know the origin of are designed by human beings. If you have any example of a code whose origin is known, and that origin is not a human being (or group thereof), please do cite that example.

Quote
3. Therefore we have 100% inference that DNA is designed…

More specifically: We have 100% inference that DNA is designed by human beings.

Quote
Provide one, just ONE example of coded information arising by natural mechanisms, without intelligence involved, and you top my proof.

Provide one, just ONE example of coded information arising from any source other than human beings.

  
Cubist



Posts: 493
Joined: Oct. 2007

(Permalink) Posted: Nov. 16 2015,06:26   

Quote (Otangelo @ Nov. 15 2015,22:13)
Troy Lawrence Before the global flood, the canopy of water that once surrounded the atmosphere, shielded the atmosphere from UV and other high energy cosmic rays.

Vapor canopy, eh? Interesting. YEC organization Answers in Genesis has rejected the 'vapor canopy' model; perhaps you might want to get in touch with AiG and let them know that the vapor canopy is, too, a viable candidate for the source of the Floodwaters.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,08:43   

Quote (Otangelo @ Nov. 16 2015,05:31)

Thats PRECISELY what the DNA code does. It represents YOU for example.

Only in the same way tree ring widths represent rainfall amounts and spectral absorption lines in starlight represent elements.  
Quote
Thats correct. But they do not represent something else, like the DNA code does. Thats the salient thing about it. The DNA provides a codified representation as a book, a morse code, or a compunter code does.

No, it does not.  The key here is abstraction.  Intelligently designed codes (i.e Morse) all use abstraction where arbitrary symbols (dots, dashes) represents some other quantity in order to pass a message.  There is zero abstraction in DNA --> protein.  It's an unguided, unintelligent chemical process.  There is no sender or receiver, no message passed using symbols.

Sorry, the "DNA is a code, therefore ID" argument has been dead for a decade.  Find some new stupidity to copypasta.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 16 2015,08:50   

Quote (Otangelo @ Nov. 15 2015,23:13)
...
Troy Lawrence Before the global flood, the canopy of water that once surrounded the atmosphere, shielded the atmosphere from UV and other high energy cosmic rays. ...

This is physically impossible for a variety of reasons.
The most telling may be the energy impacts of such a 'canopy of water' falling to earth for 40 days and 40 nights, to such a depth that the mountains were covered.
That volume of water, falling over that time period, would release energy equivalent to multi-megaton nuclear explosions on every square meter of the planet every second over the duration of the flood.

It would be worth your while to calculate the amount of water it would take to shield the atmosphere from UV and high energy cosmic rays sufficiently to affect the N2 to C14 conversion.
Calculate the difference between that volume of water and the amount of water currently on earth.
Then calculate the energy effect of that volume of water falling over the span of the flood.

  
sparc



Posts: 1977
Joined: April 2007

(Permalink) Posted: Nov. 16 2015,08:55   

Doesn't EN&V deserve its exclusive thread anymore?
I don't want to read Otangelo's BS when I am looking for DI's ID BS.
Thus, I suggest a separate zhread for Otangelo like those we have for Gary Gaulin and Edgar Postrado or, ideally, a common thread for the three of them to allow for some entertaining interactions.
You may move my post to the bathroom wall if it should not be appropriate.

--------------
"[...] the type of information we find in living systems is beyond the creative means of purely material processes [...] Who or what is such an ultimate source of information? [...] from a theistic perspective, such an information source would presumably have to be God."

- William Dembski -

   
Quack



Posts: 1959
Joined: May 2007

(Permalink) Posted: Nov. 16 2015,10:04   

Quote (sparc @ Nov. 16 2015,08:55)
Doesn't EN&V deserve its exclusive thread anymore?
I don't want to read Otangelo's BS when I am looking for DI's ID BS.
Thus, I suggest a separate zhread for Otangelo like those we have for Gary Gaulin and Edgar Postrado or, ideally, a common thread for the three of them to allow for some entertaining interactions.
You may move my post to the bathroom wall if it should not be appropriate.

A common thread? IMO a good idea, might produce some of the entertainment presently lacking from those threads.

--------------
Rocks have no biology.
              Robert Byers.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,12:03   

Quote (Cubist @ Nov. 16 2015,06:08)

Quote (Occam's Aftershave @ Nov. 15 2015,20:23)

No. What ToE predicts is that "these  fossils" actually did exist at some time in the past. ToE is silent on the question of whether or not "these  fossils" should still exist in the present day; it neither mandates their present-day existence, nor forbids their present-day existence.


thats like putting the horse in front of the cart. So the ToE would be making absolute claims, and be  true, no matter if there is evidence to support its assertions,  or not....

Quote

If you're genuinely interested in the question of what factors influence the survival of a once-living specimen over time, you should look into the scientific field of study called "taphonomy". If you are, instead, only interested in citing lack-of-surviving-fossils as a killer 'gotcha' argument against evolution… well, feel free to keep on treading the mendacious road you're already on.


You might explain how taphonomy supports the idea that non permineralized fossils, and soft tissue, can remain preserved for millions if not hundreds of millions of years.....

Quote
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…
We "know from broad and repeated experience" that human agents "can and do produce information-rich systems", yes. To the best of my knowledge, we have no experience whatsoever of "information-rich systems" being produced by "intelligent agents" other than humans. Perhaps you'd care to cite some evidence of "information-rich systems" being produced by "intelligent agents" other than humans?


Neither do we have experience that non - intelligence has EVER produced codified information..... We have imho plenty of evidence that spirits can exist without a body, which gives support to the inference that a non physical intelligent designer created the living beings on earth.

http://reasonandscience.heavenforum.org/t1284-n....dualism

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,12:17   

Quote (Occam's Aftershave @ Nov. 16 2015,08:43)

Quote

Only in the same way tree ring widths represent rainfall amounts and spectral absorption lines in starlight represent elements.  


I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.

In human language, symbols are arbitrary. In DNA they are fixed by chemistry. This is a very big difference. By that criteria many other things are codes too: The spatial distribution of the sizes of pebbles below a rapids, the pattern and orientation of sand dunes, the layers inside a hailstone, and tree rings. All contain the transformation of one representation (time, for example) into another (tree rings). Tree rings also encode information about local climate in their varying widths. Mr. Marshall must give a formal definition of “code” rather than a series of examples that conceal significant differences.
The definition of code I have provided is sufficient and applies whether the code is arbitrary or not. Again, I define “Coded Information” as a system of symbols used by an encoding and decoding mechanism, which transmits a message representing an idea or plan.
If there are pebbles below a rapids, there are pebbles below a rapids. There is no coded information associated with them – unless you measure their size, in which case you have created information to describe the pebbles, based on your chosen symbols and units of measurement. Same with orientation of sand dunes, layers of hailstone. Those objects represent only themselves; there is no encoding and decoding mechanism within these material objects, such as there is in DNA. If someone says the layers of a hailstone are an encoding mechanism, I reply that there is no convention of symbols, nor is there a decoding mechanism.
The information in DNA is independent of the communication medium insofar as every strand of DNA in your body represents a complete plan for your body; even though the DNA strand itself is only a sequence of symbols made up of chemicals (A, G, C, T). We could store a CAD drawing of a hard drive on the same model of hard drive, but the medium and the message are two distinctly different things. Such symbolic relationships only exist within the realm of living things; they do not occur naturally.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,12:18   

i forgot to provide the link to the information above :

http://cosmicfingerprints.com/dna-ath....na-code

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 16 2015,12:43   

Quote (Otangelo @ Nov. 16 2015,13:17)
...
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.
...

Paying strict attention to meaning, no, you actually can't.
Giving you the wiggle room to claim that "well, under these and those conditions one can, in principle" yadda yadda yadda, gives us the same amount of room to  claim that the same holds for tree rings.

The genetic 'code' requires a vast complex of chemical 'machinery' to be transcribed.  It is part of a complex chemical system comprised of complex subsystems.  It is non-functional on its own.
Were it not, cloning would be trivial.  Transplantation of cellular nuclei would be trivial.
Genetic disease would be rare.  Transcription errors even rarer.

The claim is absurd on the face of it to all who understand anything about the actual factual nature of genes and cells.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,13:08   

Quote (Otangelo @ Nov. 16 2015,12:17)
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.

Go ahead then.  Make a copy of a genome out of sticks and modeling clay, have it make a stick and modeling clay protein.

Put up or shut up.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,13:09   

Quote (NoName @ Nov. 16 2015,12:43)
Quote (Otangelo @ Nov. 16 2015,13:17)
...
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.
...

Paying strict attention to meaning, no, you actually can't.
Giving you the wiggle room to claim that "well, under these and those conditions one can, in principle" yadda yadda yadda, gives us the same amount of room to  claim that the same holds for tree rings.

The genetic 'code' requires a vast complex of chemical 'machinery' to be transcribed.  It is part of a complex chemical system comprised of complex subsystems.  It is non-functional on its own.
Were it not, cloning would be trivial.  Transplantation of cellular nuclei would be trivial.
Genetic disease would be rare.  Transcription errors even rarer.

The claim is absurd on the face of it to all who understand anything about the actual factual nature of genes and cells.

Quote (Otangelo @ Nov. 16 2015,13:17)
...
I can take the genetic code, and make exact copies through the instructions provided by it. Its like a blueprint. You can't do that with tree rings.
...
Paying strict attention to meaning, no, you actually can't.


Its actually as much coded information, as a alphabet. I can even translate the information written through the alphabet, to the genetic code :

http://dulbrich.is2.byuh.edu/dna....dna


Quote


The genetic 'code' requires a vast complex of chemical 'machinery' to be transcribed.  It is part of a complex chemical system comprised of complex subsystems.  It is non-functional on its own.
Were it not, cloning would be trivial.  Transplantation of cellular nuclei would be trivial.
Genetic disease would be rare.  Transcription errors even rarer.

The claim is absurd on the face of it to all who understand anything about the actual factual nature of genes and cells.


What claim ? What good would the DNA double helix be for without the machinery to transcribe and translate it to make proteins ? So both are required. That constitutes a interdependent system. There is no reason for the DNA double helix to arise by its own. And even IF both were present, the DNA , and the transcription factors / RNA polymerase, you need also the Promoter region, and in eukaryotic cells TATA box, the sequence which provides the signal for initiation of transcription. If it were not at the right place, bye bye ....... How did it get there, and at the right place ? trial and error ?? LOL....

The cell is a gigantic interdependent and irreducible complex system.....

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,13:16   

Quote (Otangelo @ Nov. 16 2015,13:09)
Its actually as much coded information, as a alphabet. I can even translate the information written through the alphabet, to the genetic code :

http://dulbrich.is2.byuh.edu/dna............dna

(facepalm) You can take information written in the English alphabet and save it by spelling words with dog turds too.  That doesn't make dog turds be designed.

Where do the IDiots find these guys?   :D

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,13:22   

Quote (Occam's Aftershave @ Nov. 16 2015,13:16)

Quote (Otangelo @ Nov. 16 2015,13:09)
Its actually as much coded information, as a alphabet. I can even translate the information written through the alphabet, to the genetic code :

http://dulbrich.is2.byuh.edu/dna............dna
(facepalm) You can take information written in the English alphabet and save it by spelling words with dog turds too.  That doesn't make dog turds be designed.

Where do the IDiots find these guys?   :D


Of course. You can take whatever medium you wish to store information. The X of the question is not what material you use, but the special arrangement which constitutes coded information.
The 3 letter codons are genetic words, and constitute genetic information.

Where do the EvoTards ™ find these guys?

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,13:27   

Quote (Otangelo @ Nov. 16 2015,13:22)
Of course. You can take whatever medium you wish to store information. The X of the question is not what material you use, but the special arrangement which constitutes coded information.
The 3 letter codons are genetic words, and constitute genetic information.

Then go ahead and make a genome out of sticks and clay and have it produce a clay protein.  Or use Lego. Or metal bits from an Erector Set.

You claim the codons are arbitrary chosen symbols so any material should work to pass the message, right?

Idiot.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,13:41   

I have my own thread ? Thats cool, haha.

:D

I just want EvoTard's ™ which have no education to stay away, people that cannot debate without resorting to name calling.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,13:45   

Quote (Otangelo @ Nov. 16 2015,13:41)
I just want EvoTard's ™ which have no education to stay away, people that cannot debate without resorting to name calling.

Takes a real IDiot to whine about name calling in the same sentence he name calls.  :p

Talk about a poster boy for Dunning-Kruger.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 16 2015,14:24   

ID creationism predicted that multiple sequential mutations could not happen. Falsified;

"Acceleration of Emergence of Bacterial Antibiotic Resistance in Connected Microenvironments" Qiucen Zhang, Guillaume Lambert, David Liao, Hyunsung Kim, Kristelle Robin,    Chih-kuan Tung, Nader Pourmand, Robert H. Austin, Science 23 September 2011: Vol. 333 no. 6050 pp. 1764-1767

“It is surprising that four apparently functional SNPs should fix in a population within 10 hours of exposure to antibiotic in our experiment. A detailed understanding of the order in which the SNPs occur is essential, but it is unlikely that the four SNPs emerged simultaneously; in all likelihood they are sequential (21–23). The device and data we have described here offer a template for exploring the rates at which antibiotic resistance arises in the complex fitness landscapes that prevail in the mammalian body. Furthermore, our study provides a framework for exploring rapid evolution in other contexts such as cancer (24).

Multi-site mutations, functional mutations, TEN HOURS, why sequential mutations are functional, and more likely, and with medical applications.

ID Creationism insisted that the Cambrian phyla were "fully formed, and that all modern phyla were represented in the Cambrian. Falsified;

Precambrian Ediacaran/Cambrian;

Erwin, Douglas H., James W. Valentine
2013 "The Cambrian Explosion: The Construction of Animal Diversity" New York: Roberts and Company Publishers

Valentine, James W.
2005 “On the Origin of Phyla” University of Chicago Press

A. Yu. Zhuravlev, R. A. Wood, A. M. Penny
"Ediacaran skeletal metazoan interpreted as a lophophorate" Proc. R. Soc. B 2015 282 20151860; DOI: 10.1098/rspb.2015.1860. Published online 4 November 2015.

ID Creationism claimed embryology data that supported evolution was faked, and that embryology falsified evolution and supported ID Creationism. Falsified;

Ossa-Fuentes L, Mpdozis J and Vargas AO (2015). Bird embryos uncover homology and evolution of the dinosaur ankle. Nature Communications. DOI: 10.1038/natcomms9902

Diaz, R. E.,&Trainor, P. A. (2015). Hand/foot splitting and the ‘re-evolution’of mesopodial skeletal elements during the evolution and radiation of chameleons. BMC evolutionary biology, 15(1), 184.

http://www.science20.com/news_ar....-159819

Richards, Robert J.
2008 “The Tragic Sense of Life: Ernst Haeckel and the Struggle over Evolutionary Thought” University of
Chicago Press.

ID Creationism claims that nested hierarchies from DNA are because their god used "common tool kits." Falsified by hierarchies built by silenced pathological genes;

Sverdlov, ED. 2000. Retroviruses and primate evolution. BIOESSAYS Volume: 22 Issue: 2 Pages: 161-171.

Welkin E. Johnson and John M. Coffin
"Constructing primate phylogenies from ancient retrovirus sequences" PNAS 1999 96 (18) 10254-10260; doi:10.1073/pnas.96.18.10254

Heui-Soo Kim, Osamu Takenaka, Timothy J. Crow
"Isolation and phylogeny of endogenous retrovirus sequences belonging to the HERV-W family in primates" J Gen Virol October 1999 vol. 80 no. 10: 2613-2619

ID Creationism claims complex organs cannot have evolved. Falsified by Paley's favorites;

Ivan R Schwab
2011 “Evolution's Witness: How Eyes Evolved”  Oxford University Press

Teaford, Mark F., Moya Meredith Smith, and Mark W.J. Ferguson
2000/2006 “Development, Function and Evolution of Teeth” Cambridge University Press

The fact is that Behe's "irreducible complexity" was neither original, nor an argument against evolution;

Hermann J. Muller,
1918 "Genetic Variability, Twin Hybrids and Constant Hybrids, in a Case of Balanced Lethal Factors", Genetics, Vol 3, No 5: 422-499, Sept 1918.
(This is the real source for a “irreducible complexity" argument only it was the argument for evolution. Behe was apparently unaware it was published).

Edited by Dr.GH on Nov. 16 2015,12:41

--------------
"Science is the horse that pulls the cart of philosophy."

L. Susskind, 2004 "SMOLIN VS. SUSSKIND: THE ANTHROPIC PRINCIPLE"

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,14:53   

Answers at Panda's Thumb

http://www.antievolution.org/cgi-bin....2;st=30

ID creationism predicted that multiple sequential mutations could not happen. Falsified;

"Acceleration of Emergence of Bacterial Antibiotic Resistance in Connected Microenvironments" Qiucen Zhang, Guillaume Lambert, David Liao, Hyunsung Kim, Kristelle Robin,    Chih-kuan Tung, Nader Pourmand, Robert H. Austin, Science 23 September 2011: Vol. 333 no. 6050 pp. 1764-1767

“It is surprising that four apparently functional SNPs should fix in a population within 10 hours of exposure to antibiotic in our experiment. A detailed understanding of the order in which the SNPs occur is essential, but it is unlikely that the four SNPs emerged simultaneously; in all likelihood they are sequential (21–23). The device and data we have described here offer a template for exploring the rates at which antibiotic resistance arises in the complex fitness landscapes that prevail in the mammalian body. Furthermore, our study provides a framework for exploring rapid evolution in other contexts such as cancer (24).

Answer :

The question in demand is not if multiple sequential mutations could or could not  happen.

Mutations cannot produce new information

http://reasonandscience.heavenforum.org/t1664-m....rmation


The development of new functions is the only thing important for evolution. We are not talking about small functional changes, but radical ones. Some organism had to learn how to convert sugars to energy. Another had to learn how to take sunlight and turn it into sugars. Another had to learn how to take light and turn it into an interpretable image in the brain. These are not simple things, but amazing processes that involve multiple steps, and functions that involve circular and/or ultra-complex pathways will be selected away before they have a chance to develop into a working system. For example, DNA with no function is ripe for deletion, and making proteins/enzymes that have no use until a complete pathway or nano-machine is available is a waste of precious cellular resources.

For evolution to work, they have to come up from scratch, they have to be carefully balanced and regulated with respect to other processes, and they have to work before they will be kept. Saying a gene can be copied and then used to prototype a new function is not what evolution requires, for this cannot account for radically new functionality. Thus, gene duplication cannot answer the most fundamental questions about evolutionary history. Likewise, none of the common modes of mutation (random letter changes, inversions, deletions, etc.) have the ability to do what evolution requires.

When discussing whether or not mutations can create new information, evolutionists routinely bring up an overly-simplistic view of mutation and then claim to have solved the problem while waving their hand over the real issue: the antagonism between ultra-complexity and random mutation.

If a four-dimensional genome is hard enough to grasp, there is also a huge amount of ‘meta-information’ in the genome. This is information about the information! This is the information that tells the cell how to maintain the information, how to fix it if it breaks, how to copy it, how to interpret what is there, how to use it, when to use it, and how to pass it on to the next generation. This is all coded in that linear string of letters and life could not exist without it. In fact, life was designed from a top-down perspective, apparently with the meta-information coming first.

protein folds in general are multi-mutation features, requiring many amino acids to be fixed before the assembly provides any functional advantage.

Another study by Axe and Ann Gauger found that merely converting one enzyme into a closely related enzyme -- the kind of conversion that evolutionists claim can easily happen -- would require a minimum of seven simultaneous changes,6exceeding the probabilistic resources available for evolution over the Earth's history. This data implies that many biochemical features are so complex that they would require many mutations before providing any advantage to an organism, and would thus be beyond the "edge" of what Darwinian evolution can do.

ID Creationism insisted that the Cambrian phyla were "fully formed, and that all modern phyla were represernted in the Cambrian. Falsified;

Precambian Edicaran/Cambrian
Erwin, Douglas H., James W. Valentine
2013 "The Cambrian Explosion: The Construction of Animal Diversity" New York: Roberts and Company Publishers

Valentine, James W.
2005 “On the Origin of Phyla” University of Chicago Press

Answer :

http://creation.com/cambria....versity

The Cambrian explosion features such things as the sudden appearance of the phyla, strong discontinuities between the phyla, difficulties in grouping phyla according to evolutionary relationships, and the early appearance of many essentially modern traits. Special creation remains the most parsimonious explanation for the Cambrian explosion.

http://www.trueorigin.org/trilobi....yes.asp

Trilobites  appear suddenly in the fossil record without any transitions. There are no fossils between simple single-cell organisms, such as bacteria, and complex invertebrates, such as trilobites. How do you explain then the appearance of the most sophisticated eye ever observed in nature ?

http://www.peripatus.gen.nz/taxa.......te.html

The big problem with the earliest known trilobites, is that they are trilobites. That is to say, their earliest representatives – from the order Redlichiida and in particular the Fallotaspididae (fig. 2A) – are distinctly and emphatically trilobites, and they do not look like anything else. They provide few clues to which other arthropod groups may be their close relatives, or to their origins.

Although it is true that one or two of the Ediacaran forms such as Spriggina (fig. 2B) superficially resemble early trilobites, to date the detailed case for such an ancestry is far from compelling.

This problem is particularly galling in one respect: it has not escaped the notice of those well-known oxymorons, the creation science brigade. However, those of us with an interest in the origins of things are compensated with a fascinating puzzle.

ID Creationism claims complex organs cannot have evolved. Falsified by Paley's favorites;

Ivan R Schwab
2011 “Evolution's Witness: How Eyes Evolved”  Oxford University Press

Teaford, Mark F., Moya Meredith Smith, and Mark W.J. Ferguson
2000/2006 “Development, Function and Evolution of Teeth” Cambridge University Press

Answer:

Eye / brain is a interdependent and irreducible complex system

http://reasonandscience.heavenforum.org/t1638-e....-system

http://www.detectingdesign.com/humaney....ye.html

the first step in vision is the detection of photons.  In order to detect a photon, specialized cells use a molecule called 11-cis-retinal.  When a photon of light interacts with this molecule, it changes its shape almost instantly.  It is now called trans-retinal.  This change in shape causes a change in shape of another molecule called rhodopsin.  The new shape of rhodopsin is called metarhodopsin II.  Metarhodopsin II now sticks to another protein called transducinforcing it to drop an attached molecule called GDP and pick up another molecule called GTP.  The GTP-transducin-metarhodopsin II molecule now attaches to another protein called phosphodiesterase.  When this happens,phosphodiesterase cleaves molecules called cGMPs.  This cleavage of cGMPs reduces their relative numbers in the cell.  This reduction in cGMP is sensed by an ion channel.  This ion channel shuts off the ability of the sodium ion to enter the cell.  This blockage of sodium entrance into the cell causes an imbalance of charge across the cell's membrane.  This imbalance of charge sends an electrical current to the brain.  The brain then interprets this signal and the result is called vision.

Many other proteins are now needed to convert the proteins and other molecules just mentioned back to their original forms so that they can detect another photon of light and signal the brain.  If any one of these proteins or molecules is missing, even in the simplest eye system, vision will not occur

The question now of course is, how could such a system evolve gradually?  All the pieces must be in place simultaneously.  For example, what good would it be for an earthworm that has no eyes to suddenly evolve the protein 11-cis-retinal in a small group or "spot" of cells on its head?  These cells now have the ability to detect photons, but so what?  What benefit is that to the earthworm?  Now, lets say that somehow these cells develop all the needed proteins to activate an electrical charge across their membranes in response to a photon of light striking them.  So what?!  What good is it for them to be able to establish an electrical gradient across their membranes if there is no nervous pathway to the worm's minute brain?   Now, what if this pathway did happen to suddenly evolve and such a signal could be sent to the worm's brain.  So what?!  How is the worm going to know what to do with this signal?  It will have to learn what this signal means.  Learning and interpretation are very complicated processes involving a great many other proteins in other unique systems.  Now the earthworm, in one lifetime, must evolve the ability to pass on this ability to interpret vision to its offspring.  If it does not pass on this ability, the offspring must learn as well or vision offers no advantage to them.  All of these wonderful processes need regulation.  No function is beneficial unless it can be regulated (turned off and on).  If the light sensitive cells cannot be turned off once they are turned on, vision does not occur.  This regulatory ability is also very complicated involving a great many proteins and other molecules - all of which must be in place initially for vision to be beneficial.

The fact is that Behe's "irreducible complexity" was neither original, nor an argument against evolution;

Hermann J. Muller,
1918 "Genetic Variability, Twin Hybrids and Constant Hybrids, in a Case of Balanced Lethal Factors", Genetics, Vol 3, No 5: 422-499, Sept 1918.
(This is the real source for a “irreducible complexity" argument only it was the argument for evolution. Behe was apparently unaware it was published).



Answer :

It might not be original, but that it is a BIG blow in regard of the ToE. Oh yeah. It is !!

I have described 17 IC systems so far. Feel free to pick any of these, and refute my claim that they are IC.

http://reasonandscience.heavenforum.org/t2166-a....systems

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,14:55   

for better visualisation, you can read my answer here:

http://reasonandscience.heavenforum.org/t2230-a....mb#4370

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,14:59   

Quote (Otangelo @ Nov. 16 2015,14:55)
for better visualisation, you can read my answer here:

http://reasonandscience.heavenforum.org/t2230-a....mb#4370

Gee, a Creationist doing the Gish Gallop with links to all the usual IDiot / YECkery sites.

How clever.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,15:07   

Quote (Otangelo @ Nov. 16 2015,14:53)
Mutations cannot produce new information

That's easily disproven by the simple logic that whatever one mutation can do another in a later generation can undo.

If A -> B is a loss of information then

B -> A is a gain of information.

That's true no matter how you define "information".

These occurrences have been empirically observed in real life too.  They're called back mutations.

Back mutation can produce phenotype reversion in Bloom syndrome somatic cells

Of course here's where the IDiots start squirming and claiming "it's not new information, it's just different information!"   :D

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 16 2015,15:08   

Re: Origin of life

The new chewtoy repeated a lot of creationist nonsense about RNA, complexity, and activity. Here are some refuting articles;

Lee DH, Granja JR, Martinez JA, Severin K, Ghadri MR.
1996 “A self-replicating peptide.” Nature Aug 8;382(6591):525-8

Reader, J. S.  and G. F. Joyce
2002 "A ribozyme composed of only two different nucleotides." Nature vol 420, pp 841-844.

Anthony D. Keefe, Jack W. Szostak
2001 “Functional proteins from a random-sequence library” Nature 410, 715-718

Ekland, EH, JW Szostak, and DP Bartel
1995 "Structurally complex and highly active RNA ligases derived from random RNA sequences"  Science: Vol. 269. no. 5222, pp. 364-370

Powner, Matthew W., Béatrice Gerland & John D. Sutherland
2009 “Synthesis of activated pyrimidine ribonucleotides in prebiotically plausible conditions” Nature Vol; 459, 239-242 doi:10.1038/nature08013

Saladino R, Crestini C, Ciambecchini U, Ciciriello F, Costanzo G, Di Mauro E.
2004 "Synthesis and degradation of nucleobases and nucleic acids by formamide in the presence of montmorillonites" Chembiochem, 5(11):1558-66

In short, activated RNAs can readily form; RNAs do not need to be complex to function as ribozymes; peptides are capable of "evolving" self replication; peptides randomly assembled are highly active.

I'll also toss in the spontaneous formation of phospholipid membranes, and encapsulation;

A.C. Chakrabarti, R.R. Breaker, G.F. Joyce, & D.W. Deamer
1994 "Production of RNA by a Polymerase Protein Encapsulated within Phospho-Lipid Vesicles" Journal of Molecular Evolution 39(6): 555-559

Khvorova A, Kwak YG, Tamkun M, Majerfeld I, Yarus M.  
1999.  "RNAs that bind and change the permeability of phospholipid membranes" Proceedings of the National Academy of the Sciences USA 96:10649-10654.

Yarus M.  
1999 "Boundaries for an RNA world" Current Opinion in Chemical Biology  3:260-267.

Wang KJ, Ferris JP
2005 "Catalysis and selectivity in prebiotic synthesis: initiation of the formation of oligo(U)s on montmorillonite clay by adenosine-5'-methylphosphate" Orig Life Evol Biosph, 35(3):187-212

Martin M. Hanczyc, Shelly M. Fujikawa, and Jack W. Szostak
2003 "Experimental Models of Primitive Cellular Compartments: Encapsulation, Growth, and Division" Science Vol. 302: 618-622.


A book reviewing much of this is;

Deamer, David W.
2011 “First Life: Discovering the Connections between Stars, Cells, and How Life Began” University of California Press

Edited by Dr.GH on Nov. 16 2015,13:11

--------------
"Science is the horse that pulls the cart of philosophy."

L. Susskind, 2004 "SMOLIN VS. SUSSKIND: THE ANTHROPIC PRINCIPLE"

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,15:14   

Quote (Dr.GH @ Nov. 16 2015,15:08)

Origin of life

http://reasonandscience.heavenforum.org/t2024-t....fe#3414

refute, if you can.

Your list of scientific papers does not impress me in the slightest.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,15:18   

Quote (Otangelo @ Nov. 16 2015,15:14)
 
Quote (Dr.GH @ Nov. 16 2015,15:08)

Origin of life

http://reasonandscience.heavenforum.org/t2024-t....fe#3414

refute, if you can.

There's nothing to refute.  It's just one more IDiot claiming abiogenesis is impossible, claiming to have proved a negative.

Quote
Your list of scientific papers does not impress me in the slightest.


Of course not since you didn't read them and wouldn't understand them if you did.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Texas Teach



Posts: 1493
Joined: April 2007

(Permalink) Posted: Nov. 16 2015,16:14   

Quote (Otangelo @ Nov. 16 2015,12:03)
We have imho plenty of evidence that spirits can exist without a body, which gives support to the inference that a non physical intelligent designer created the living beings on earth.

Ooooooooooooooooooo...

--------------
"Creationists think everything Genesis says is true. I don't even think Phil Collins is a good drummer." --J. Carr

"I suspect that the English grammar books where you live are outdated" --G. Gaulin

  
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 16 2015,16:23   

I am certain that the new chewtoy imagined his creationist cut and paste "answered" the obvious ID creationism's failures that I illustrated by scientific citation. He failed miserably.

I'll take the opportunity to rub it in a bit. Chewtoy wrote,
 
Quote
Eye / brain is a interdependent and irreducible complex system




This photo is the eye stalk of a cubozoan, rhopalium

There are three different kinds of eyes. The cubozoa have no brains.

Edited by Dr.GH on Nov. 16 2015,14:27

--------------
"Science is the horse that pulls the cart of philosophy."

L. Susskind, 2004 "SMOLIN VS. SUSSKIND: THE ANTHROPIC PRINCIPLE"

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,16:56   

Quote (Dr.GH @ Nov. 16 2015,16:23)

[QUOTE][There are three different kinds of eyes. The cubozoa have no brains./QUOTE]

1. You have not read my answer. It was about the signal transduction pathway in photoreceptor cells.

2. Your example does not refute my claim, since its about another organism, not the human eye.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,17:04   

Quote (Otangelo @ Nov. 16 2015,16:56)
1. You have not read my answer. It was about the signal transduction pathway in photoreceptor cells.

Yeah, we know. "The (insert body part here) is SOOOOO COMPLEX it just couldn't have evolved!  Therefore GODDIDIT!!"

 
Quote
2. Your example does not refute my claim, since its about another organism, not the human eye.


You bluster doesn't support your claim that human eye/brain evolution is impossible.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Cubist



Posts: 493
Joined: Oct. 2007

(Permalink) Posted: Nov. 16 2015,18:43   

Replying to the latest Creationist chewtoy seeker after Truth, with relevant context restored as needed

Quote (Otangelo @ Nov. 16 2015,12:03)
Quote (Cubist @ Nov. 16 2015,06:08)
Quote (Otangelo @ Nov. 15 2015,20:58)
 
Quote (Occam's Aftershave @ Nov. 15 2015,20:23)
Ah, here it comes.  The demand for INFINITE DETAIL while providing exactly ZERO of his own.

Well, isnt that a prediction of the ToE, that these transitional fossils should be encountered ?

No. What ToE predicts is that "these transitional fossils" actually did exist at some time in the past. ToE is silent on the question of whether or not "these transitional fossils" should still exist in the present day; it neither mandates their present-day existence, nor forbids their present-day existence.
So the ToE would be making absolute claims, and be  true, no matter if there is evidence to support its assertions,  or not...

You have chosen to respond to what I wrote—that being, the ToE does not mandate that transitional fossils must necessarily survive to the present day—as if I had actually said something akin to the ToE does not require any evidence at all. Until such time as you elect to reply to what I wrote, rather than to what you imagine I wrote, I see no reason to engage with you further on this point.

Quote
Quote
Quote
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…

We "know from broad and repeated experience" that human agents "can and do produce information-rich systems", yes. To the best of my knowledge, we have no experience whatsoever of "information-rich systems" being produced by "intelligent agents" other than humans. Perhaps you'd care to cite some evidence of "information-rich systems" being produced by "intelligent agents" other than humans?

Neither do we have experience that non - intelligence has EVER produced codified information...

That's nice. It doesn't happen to be the "evidence of 'information-rich systems' being produced by 'intelligent agents' other than humans" I asked you for, but it's nice.

  
Cubist



Posts: 493
Joined: Oct. 2007

(Permalink) Posted: Nov. 16 2015,18:51   

Quote (Otangelo @ Nov. 16 2015,14:53)
Mutations cannot produce new information

This is a bog-standard Creationist talking point. In order to give Otangelo an opportunity to demonstrate that he actually comprehends this talking point, and isn't just mindlessly repeating it like a tape recorder, I do have a question.

What does "new information" look like? Given an arbitrary string of nucleotides, and a mutation which alters that string of nucleotides, how can you tell whether or not the post-mutation version of that string contains any "new" information?

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,18:56   

Quote (Cubist @ Nov. 16 2015,18:43)

Quote
You have chosen to respond to what I wrote—that being, the ToE does not mandate that transitional fossils must necessarily survive to the present day—as if I had actually said something akin to the ToE does not require any evidence at all. Until such time as you elect to reply to what I wrote, rather than to what you imagine I wrote,I see no reason to engage with you further on this point.


Sorry, i do not understand your replies. What do you mean with :

ToE does not mandate that transitional fossils must necessarily survive to the present day ???

If there are no transitional fossils in the fossil record, how would you confirm  the ToE in regard of paleontology ?


Quote
That's nice. It doesn't happen to be the "evidence of 'information-rich systems' being produced by 'intelligent agents' other than humans" I asked you for, but it's nice.


Once more your sentence is hard to understand. There is no reason to assume that humans are the only beings that can have intelligent thoughts.  Complex, specified, coded information rich, interdependent and irreducible complex systems are best explained through a intelligent designer. Period.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,19:01   

Quote (Otangelo @ Nov. 16 2015,18:56)
 Complex, specified, coded information rich, interdependent and irreducible complex systems are best explained through a intelligent designer. Period.

The people who designed those bullshit meaningless buzz terms to hang on biological forms may be intelligent but they certainly aren't very honest.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,19:03   

Quote (Cubist @ Nov. 16 2015,18:51)

Quote
What does "new information" look like? Given an arbitrary string of nucleotides, and a mutation which alters that string of nucleotides, how can you tell whether or not the post-mutation version of that string contains any "new" information?


http://reasonandscience.heavenforum.org/t2062-p....roteins

Few of the many  possible polypeptide chains will be useful to Cells
Paul Davies puts it more graphically: ‘Making a protein simply by injecting energy is rather like exploding a stick of dynamite under a pile of bricks and expecting it to form a house. You may liberate enough energy to raise the bricks, but without coupling the energy to the bricks in a controlled and ordered way, there is little hope of producing anything other than a chaotic mess.’ It is one thing to produce bricks; it is an entirely different thing to organize the building of a house or factory. If you had to, you could build a house using stones that you found lying around, in all the shapes and sizes in which they came due to natural causes. However, the organization of the building requires something that is not contained in the stones. It requires the intelligence of the architect and the skill of the builder. It is the same with the building blocks of life. Blind chance just will not do the job of putting them together in a specific way. Organic chemist and molecular biologist A.G. Cairns-Smith puts it this way: ‘Blind chance… is very limited… he can produce exceedingly easily the equivalent of letters and small words, but he becomes very quickly incompetent as the amount of organization increases. Very soon indeed long waiting periods and massive material resources become irrelevant.’

Bruce Alberts writes in Molecular biology of the cell :

Since each of the 20 amino acids is chemically distinct and each can, in principle, occur at any position in a protein chain, there are 20 x 20 x 20 x 20 = 160,000 different possible polypeptide chains four amino acids long, or 20n different possible polypeptide chains n amino acids long. For a typical protein length of about 300 amino acids, a cell could theoretically make more than 10^390  different pollpeptide chains. This is such an enormous number that to produce just one molecule of each kind would require many more atoms than exist in the universe. Only a very small fraction of this vast set of conceivable polypeptide chains would adopt a single, stable three-dimensional conformation-by some estimates, less than one in a billion. And yet the vast majority of proteins present in cells adopt unique and stable conformations. How is this possible?

The complexity of living organisms is staggering, and it is quite sobering to note that we currently lack even the tiniest hint of what the function might be for more than 10,000 of the proteins that have thus far been identified in the human genome. There are certainly enormous challenges ahead for the next generation of cell biologists, with no shortage of fascinating mysteries to solve.

Now comes Alberts  striking explanation of how the right sequence arised :

The answer Iies in natural selection. A protein with an unpredictably variable structure and biochemical activity is unlikely to help the survival of a cell that contains it. Such
proteins would therefore have been eliminated by natural selection through the enormously long trial-and-error process that underlies biological evolution. Because evolution has selected for protein function in living organisms, the amino acid sequence of most present-day proteins is such that a single conformation is extremely stable. In addition, this conformation has its chemical properties finely tuned to enable the protein to perform a particular catalltic or structural function in the cell. Proteins are so precisely built that the change of even a few atoms in one amino acid can sometimes disrupt the structure of the whole molecule so severelv that all function is lost.

Proteins are not rigid lumps of material. They often have precisely engineered moving parts whose mechanical actions are coupled to chemical events. It is this coupling of chemistry and movement that gives proteins the extraordinary capabilities that underlie the dynamic processes in living cells

Now think for a moment . It seems that natural selection  is the key answer to any phenomena in biology, where there is no scientific evidence to make a empricial claim. Much has been written about the fact that natural selection cannot produce coded information. Alberts short explanation is a prima facie example about how main stream sciencists  make without hesitation " just so "  claims without being able to provide a shred of evidence, just in order to mantain a paradigm on which the scientific establishment relies, where evolution is THE answer to almost every biochemical phenomena. Fact is that precision, coded information, stability, interdependence and irreducible complexity etc. are products of intelligent minds. The author seems also to forget that natural selection cannot occur before the first living cell replicates. Several hundred proteins had to be already in place and fully operating in order to make even the simplest life possible

  
Wesley R. Elsberry



Posts: 4885
Joined: May 2002

(Permalink) Posted: Nov. 16 2015,19:51   

Critique of complex specified information

Critique of Dembski's 'explanatory filter'

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 16 2015,19:54   

Since each of the 20 amino acids is chemically distinct and each can, in principle, occur at any position in a protein chain, there are 20 x 20 x 20 x 20 = 160,000 different possible polypeptide chains four amino acids long, or 20n different possible polypeptide chains n amino acids long. For a typical protein length of about 300 amino acids, a cell could theoretically make more than 10^390  different pollpeptide chains. This is such an enormous number that to produce just one molecule of each kind would require many more atoms than exist in the universe. Only a very small fraction of this vast set of conceivable polypeptide chains would adopt a single, stable three-dimensional conformation-by some estimates, less than one in a billion. And yet the vast majority of proteins present in cells adopt unique and stable conformations. How is this possible?


Because, dummy, the proteins and such in YOUR body have been changing and forming correctly (because incorrectly formed proteins means the organism died) over the last billion years.

It's YOU guys who do "poof" it appears. Not evolutionary theory. Get it straight. Evolution isn't what you think it is.

BTW: Did you answer my questions? I doubt it.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,20:29   

Quote (Otangelo @ Nov. 16 2015,19:03)
Fact is that precision, coded information, stability, interdependence and irreducible complexity etc. are products of intelligent minds.

Those things can be produced by intelligent minds but they don't have to be.  They can also be produced by non-intelligent iterative processes using feedback and heritability, exactly how evolution proceeds.  This has been demonstrated hundreds of times over with the workings of genetic algorithms.

     
Quote
The author seems also to forget that natural selection cannot occur before the first living cell replicates. Several hundred proteins had to be already in place and fully operating in order to make even the simplest life possible


FAIL again.  Evolution begins as soon as you have imperfect self replicators competing for resources.  Even the simplest pre-biotic self-replicating molecules would experience selection pressures.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 16 2015,20:43   

Quote (Occam's Aftershave @ Nov. 16 2015,20:29)
     

Quote
The author seems also to forget that natural selection cannot occur before the first living cell replicates. Several hundred proteins had to be already in place and fully operating in order to make even the simplest life possible

FAIL again.  Evolution begins as soon as you have imperfect self replicators competing for resources.  Even the simplest pre-biotic self-replicating molecules would experience selection pressures.


That's a pseudo scientific claim at its best.

http://reasonandscience.heavenforum.org/t2110-w....ts#3797

Based on the conjoint analysis of several computational and experimental strategies designed to define the minimal set of protein-coding genes that are necessary to maintain a functional bacterial cell, we propose a minimal gene set composed of 206 genes. Such a gene set will be able to sustain the main
vital functions of a hypothetical simplest bacterial cell with the following features.

(i) A virtually complete DNA replication machinery, composed of one nucleoid DNA binding protein, SSB, DNA helicase, primase, gyrase, polymerase III, and ligase. No initiation and recruiting proteins seem to be essential, and the DNA gyrase is the only topoisomerase included, which should perform
both replication and chromosome segregation functions.

(ii) A very rudimentary system for DNA repair, including only one endonuclease, one exonuclease, and a uracyl-DNA glycosylase.

(iii) A virtually complete transcriptional machinery, including the three subunits of the RNA polymerase, a  factor, an RNA helicase, and four transcriptional factors (with elongation, antitermination, and transcription-translation coupling functions). Regulation of transcription does not appear to be essential in bacteria with reduced genomes, and therefore the minimal gene set does not contain any transcriptional regulators.

(iv) A nearly complete translational system. It contains the 20 aminoacyl-tRNA synthases, a methionyl-tRNA formyltransferase, five enzymes involved in tRNA maturation and modification, 50 ribosomal proteins (31 proteins for the large ribosomal subunit and 19 proteins for the small one), six proteins necessary for ribosome function and maturation (four of which are GTP binding proteins whose specific function is not well known), 12 translation factors, and 2 RNases involved in RNA degradation.

(v) Protein-processing, -folding, secretion, and degradation functions are performed by at least three proteins for posttranslational modification, two molecular chaperone systems (GroEL/S and DnaK/DnaJ/GrpE), six components of the translocase machinery (including the signal recognition particle, its receptor, the three essential components of the translocase channel, and a signal peptidase), one endopeptidase, and two proteases.

(vi) Cell division can be driven by FtsZ only, considering that, in a protected environment, the cell wall might not be necessary for cellular structure.

(vii) A basic substrate transport machinery cannot be clearly defined, based on our current knowledge. Although it appears that several cation and ABC transporters are always present in all analyzed bacteria, we have included in the minimal set only a PTS for glucose transport and a phosphate transporter. Further analysis should be performed to define a more complete set of transporters.

(viii) The energetic metabolism is based on ATP synthesis by glycolytic substrate-level phosphorylation.

(ix) The nonoxidative branch of the pentose pathway contains three enzymes (ribulose-phosphate epimerase, ribosephosphate isomerase, and transketolase), allowing the synthesis of pentoses (PRPP) from trioses or hexoses.

(x) No biosynthetic pathways for amino acids, since we suppose that they can be provided by the environment.

(xi) Lipid biosynthesis is reduced to the biosynthesis of phosphatidylethanolamine from the glycolytic intermediate dihydroxyacetone phosphate and activated fatty acids provided by the environment.

(xii) Nucleotide biosynthesis proceeds through the salvage pathways, from PRPP and the free bases adenine, guanine, and uracil, which are obtained from the environment.

(xiii) Most cofactor precursors (i.e., vitamins) are provided by the environment. Our proposed minimal cell performs only the steps for the syntheses of the strictly necessary coenzymes tetrahydrofolate, NAD, flavin aderine dinucleotide, thiamine diphosphate, pyridoxal phosphate, and CoA.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,20:53   

Quote (Otangelo @ Nov. 16 2015,20:43)
That's a pseudo scientific claim at its best.

(Snip the rest of the drivel)

OK, you convinced us you can C&P large gobs of non-pertinent information.  Will you ever have an on-topic answer for the questions you keep running from?

How do you define "information" in biology and how do you measure it to tell if some new information arose?

ETA:  It's pretty dishonest to plagiarize a paper and not list it as your source.

Determination of the Core of a Minimal Bacterial Gene Set

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 16 2015,20:58   

Having fun with the copypastafarian, folks?

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 16 2015,21:01   

Quote (Richardthughes @ Nov. 16 2015,20:58)
Having fun with the copypastafarian, folks?

I'm starting to think Batshit77 has a twin brother.   :O

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 16 2015,21:26   

Quote (Wesley R. Elsberry @ Nov. 16 2015,17:51)
<a href="'http://www.antievolution.org/people/wre/papers/eandsdembski.pdf'" target="_blank">Critique of complex specified information</a>

<a href="'http://www.talkdesign.org/cs/theft_over_toil'" target="_blank">Critique of Dembski's 'explanatory filter'</a>

Here ya go.

Read them again!  :D

   
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 16 2015,21:35   

Quote (Otangelo @ Nov. 16 2015,17:03)
The author seems also to forget that natural selection cannot occur before the first living cell replicates.

More ignorant bullshit from chewtoy.

Kauffman, Stuart A.
1994 "The Origins of Order: Self -Organization and Selection in Evolution" Oxford: Oxford University Press.

Mulkidjanian, Armen Y.,  Dmitry A Cherepanov, Michael Y Galperin
2003 "Survival of the fittest before the beginning of life: Selection of the first oligonucleotide-like polymers by UV light"  BMC Evolutionary Biology 2003 3:12

--------------
"Science is the horse that pulls the cart of philosophy."

L. Susskind, 2004 "SMOLIN VS. SUSSKIND: THE ANTHROPIC PRINCIPLE"

   
fnxtr



Posts: 2576
Joined: June 2006

(Permalink) Posted: Nov. 16 2015,21:55   

Quote
Your list of scientific papers does not impress me in the slightest.


OK, who else thought of Behe at Dover? "These books are heavy."

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

"I am in a rush to catch up with science work." -- Gary Gaulin

  
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 16 2015,22:42   

Quote (fnxtr @ Nov. 16 2015,19:55)
Quote
Your list of scientific papers does not impress me in the slightest.


OK, who else thought of Behe at Dover? "These books are heavy."

Bawhaaaahaaha

Rothschild: Are you familiar with Dr. Hurd?

Behe: No, I am not.

--------------
"Science is the horse that pulls the cart of philosophy."

L. Susskind, 2004 "SMOLIN VS. SUSSKIND: THE ANTHROPIC PRINCIPLE"

   
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 16 2015,22:55   

Here's a brand new one: http://m.pnas.org/content....ull.pdf

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Cubist



Posts: 493
Joined: Oct. 2007

(Permalink) Posted: Nov. 17 2015,03:10   

Quote (Otangelo @ Nov. 16 2015,18:56)
Quote (Cubist @ Nov. 16 2015,18:43)
You have chosen to respond to what I wrote—that being, the ToE does not mandate that transitional fossils must necessarily survive to the present day—as if I had actually said something akin to the ToE does not require any evidence at all. Until such time as you elect to reply to what I wrote, rather than to what you imagine I wrote,I see no reason to engage with you further on this point.

Sorry, i do not understand your replies. What do you mean with :

ToE does not mandate that transitional fossils must necessarily survive to the present day ???

I meant exactly what I said: The theory of evolution does not mandate that any particular fossil (transitional or otherwise) must necessarily survive to the present day. This is because the theory of evolution does not mandate that any particular fossil be immune to physical damage. A fossil which is struck by lightning can end up shattered into zillions of unrecognizable bits; a fossil which is exposed to intense heat (such as the heat from a lightning-ignited forest fire, or from a volcanic lava flow) can end up burned or melted beyond recognition; a fossil which is subjected to intense pressure (such as from the impact of a heavy falling object) can end up crushed/shattered beyond recognition; and so on.

Of course, any fossil which has been identified by a human investigator is a fossil which has not been damaged beyond recognition. Since some fossils are sufficiently intact to be recognized as fossils, it's clear that the percentage of fossils which do get damaged beyond recognition must be something less than 100%. And those fossils which actually are found & identified in the fossil record, are among the less-than-100% of fossils which manage to avoid getting damaged beyond recognition by fire, pressure, lightning, etc.
Quote
If there are no transitional fossils in the fossil record, how would you confirm  the ToE in regard of paleontology?

Dunno. [shrug] Fortunately, the fossil record here in the RealWorld does contain various transitional fossils, so your question doesn't arise.
Quote
Quote
That's nice. It doesn't happen to be the "evidence of 'information-rich systems' being produced by 'intelligent agents' other than humans" I asked you for, but it's nice.

Once more your sentence is hard to understand. There is no reason to assume that humans are the only beings that can have intelligent thoughts.

You said it yourself:
Quote
We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems…

You argued, on the basis of "broad and repeated experience", that it's reasonable to presume that "intelligent agents… produce information-rich systems". I responded by pointing out that "broad and repeated experience" tells us that "information-rich systems" are not produced by nonspecific, vaguely-defined "intelligent agents" but, rather, by human beings. To the best of my knowledge, we do not have "broad and repeated experience" of "information-rich systems" created by "intelligent agents" other than human beings. More strongly: To the best of my knowledge, we have no experience whatsoever of "information-rich systems" created by "intelligent agents" other than human beings.

If you now want to argue that "information-rich systems" can be created by "agents" other than those (human) agents of which we do have "broad and repeated experience", that's cool—but in that case, you've just abandoned your own argument.
 
Quote
Complex, specified, coded information rich, interdependent and irreducible complex systems are best explained through a intelligent designer. Period.

[shrug] That's nice. Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,03:38   

Quote (Dr.GH @ Nov. 16 2015,21:35)

Quote
These results suggest that accumulation of the first polynucleotides could be explained by their abiogenic selection as the most UV-resistant biopolymers.


what nonsense !!

http://dwb.unl.edu/Teacher....yn.html

Nucleotides are some of the largest monomers that have to be made by the cell and understandably their synthesis involves many steps and large amounts of energy.
Biosynthesis of nucleotides is under tight regulatory control in the cell. Organisms need to make just the right amount of each base; if too much is made, energy is wasted, if too little, DNA replication and cellular metabolism come to a halt. Also, the cell is sensitive to the presence of any premade nucleotides in its environment and will down regulate their de novo synthesis pathways in favor of using what is already present in the surroundings. Bacteria are capable of interconverting purines (adenine and guanine) and interconverting pyrimidines (thymidine, cytidine and uracil). If a growth medium provides a purine and a pyrimidine, many microbes are capable of synthesizing the other needed nucleotides from them.

All nucleotides contain a ribose sugar and phosphate that form the backbone of DNA and RNA. These are synthesized from ribose 5-phosphate, a central metabolite of the pentose phosphate pathway.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,03:48   

Quote (Cubist @ Nov. 17 2015,03:10)

Quote
Fortunately, the fossil record here in the RealWorld does contain various transitional fossils, so your question doesn't arise.


I think there is enough evidence to say, the fossil record does NOT confirm the ToE :

Did Darwin also predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found ??

http://www.uncommondescent.com/darwini....-sanity

In Explaining the Cambrian Explosion, Has the TalkOrigins Archive Resolved Darwin’s Dilemma? – JonathanM – May 2012
Excerpt: it is the pattern of morphological disparity preceding diversity that is fundamentally at odds with the neo-Darwinian scenario of gradualism. All of the major differences (i.e. the higher taxonomic categories such as phyla) appear first in the fossil record and then the lesser taxonomic categories such as classes, orders, families, genera and species appear later. On the Darwinian view, one would expect to see all of the major differences in body plan appear only after numerous small-scale speciation events. But this is not what we observe.
http://www.evolutionnews.org/2.....5....71.html

Challenging Fossil of a Little Fish – 2000
“In Chen’s view, his evidence supports a history of life that runs opposite to the standard evolutionary tree diagrams, a progression he calls top-down evolution.”
Jun-Yuan Chen is professor at the Nanjing Institute of Paleontology and Geology
http://www.fredheeren.com/boston.....ton.htm

Scientific study turns understanding about evolution on its head – July 30, 2013
Excerpt: evolutionary biologists,,, looked at nearly one hundred fossil groups to test the notion that it takes groups of animals many millions of years to reach their maximum diversity of form.
Contrary to popular belief, not all animal groups continued to evolve fundamentally new morphologies through time. The majority actually achieved their greatest diversity of form (disparity) relatively early in their histories.
,,,Dr Matthew Wills said: “This pattern, known as ‘early high disparity’, turns the traditional V-shaped cone model of evolution on its head. What is equally surprising in our findings is that groups of animals are likely to show early-high disparity regardless of when they originated over the last half a billion years. This isn’t a phenomenon particularly associated with the first radiation of animals (in the Cambrian Explosion), or periods in the immediate wake of mass extinctions.”,,,
Author Martin Hughes, continued: “Our work implies that there must be constraints on the range of forms within animal groups, and that these limits are often hit relatively early on.
Co-author Dr Sylvain Gerber, added: “A key question now is what prevents groups from generating fundamentally new forms later on in their evolution.,,,
http://phys.org/news....on.html

Quote
Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?


Once its granted that non-intelligence mechanisms are unable to create information-rich systems, your question is moot.

We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,04:20   

Quote (Dr.GH @ Nov. 16 2015,21:35)

Quote
Mulkidjanian, Armen Y.,  Dmitry A Cherepanov, Michael Y Galperin
2003 "Survival of the fittest before the beginning of life: Selection of the first oligonucleotide-like polymers by UV light"  BMC Evolutionary Biology 2003 3:12


Furthermore, its quite dumb to assume that something can survive, that is not alive.... LOL....

and :

http://reasonandscience.heavenforum.org/t1279-a....ossible

In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

  
The whole truth



Posts: 1554
Joined: Jan. 2012

(Permalink) Posted: Nov. 17 2015,05:11   

Quote (Otangelo @ Nov. 17 2015,01:48)
[quote=Cubist,Nov. 17 2015,03:10][/quote]
Quote
Fortunately, the fossil record here in the RealWorld does contain various transitional fossils, so your question doesn't arise.


I think there is enough evidence to say, the fossil record does NOT confirm the ToE :

Did Darwin also predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found ??

http://www.uncommondescent.com/darwini....-sanity

In Explaining the Cambrian Explosion, Has the TalkOrigins Archive Resolved Darwin’s Dilemma? – JonathanM – May 2012
Excerpt: it is the pattern of morphological disparity preceding diversity that is fundamentally at odds with the neo-Darwinian scenario of gradualism. All of the major differences (i.e. the higher taxonomic categories such as phyla) appear first in the fossil record and then the lesser taxonomic categories such as classes, orders, families, genera and species appear later. On the Darwinian view, one would expect to see all of the major differences in body plan appear only after numerous small-scale speciation events. But this is not what we observe.
http://www.evolutionnews.org/2.....5....71.html

Challenging Fossil of a Little Fish – 2000
“In Chen’s view, his evidence supports a history of life that runs opposite to the standard evolutionary tree diagrams, a progression he calls top-down evolution.”
Jun-Yuan Chen is professor at the Nanjing Institute of Paleontology and Geology
http://www.fredheeren.com/boston.....ton.htm

Scientific study turns understanding about evolution on its head – July 30, 2013
Excerpt: evolutionary biologists,,, looked at nearly one hundred fossil groups to test the notion that it takes groups of animals many millions of years to reach their maximum diversity of form.
Contrary to popular belief, not all animal groups continued to evolve fundamentally new morphologies through time. The majority actually achieved their greatest diversity of form (disparity) relatively early in their histories.
,,,Dr Matthew Wills said: “This pattern, known as ‘early high disparity’, turns the traditional V-shaped cone model of evolution on its head. What is equally surprising in our findings is that groups of animals are likely to show early-high disparity regardless of when they originated over the last half a billion years. This isn’t a phenomenon particularly associated with the first radiation of animals (in the Cambrian Explosion), or periods in the immediate wake of mass extinctions.”,,,
Author Martin Hughes, continued: “Our work implies that there must be constraints on the range of forms within animal groups, and that these limits are often hit relatively early on.
Co-author Dr Sylvain Gerber, added: “A key question now is what prevents groups from generating fundamentally new forms later on in their evolution.,,,
http://phys.org/news.......on.html

Quote
Do you, or do you not, have evidence of "information-rich systems" being produced by "intelligent agents" other than human beings?


Once its granted that non-intelligence mechanisms are unable to create information-rich systems, your question is moot.

We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.

Hey Otangelo, ElShamah, etc., did allah-yahoo-satan-yeshoo-holy-spook "predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found"? Is there such a prediction in the bible and koran? LOL

"We know that...". "We" do, in the way that you're asserting?

I accept that some organisms other than humans are 'intelligent' to some degree, but what you're spewing is delusional bullshit.

--------------
Think not that I am come to send peace on earth: I came not to send peace, but a sword. - Jesus in Matthew 10:34

But those mine enemies, which would not that I should reign over them, bring hither, and slay them before me. -Jesus in Luke 19:27

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,05:23   

Quote (The whole truth @ Nov. 17 2015,05:11)

Quote
Hey Otangelo, ElShamah, etc., did allah-yahoo-satan-yeshoo-holy-spook "predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found"? Is there such a prediction in the bible and koran? LOL


Did i mention anywhere any holy book ??!!

All i say is that soft tissue found in fossils indicates a young age, not millions of years.

  
Soapy Sam



Posts: 659
Joined: Jan. 2012

(Permalink) Posted: Nov. 17 2015,05:38   

Quote (Otangelo @ Nov. 17 2015,10:20)
If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

What a load of crap. Photolysis generates a net yield of amino acids from simpler precursors. If amino acids were 'destroyed' by uv light, this would not be the case. Nor is it necessary for things to be restricted to the atmosphere.

--------------
SoapySam is a pathetic asswiper. Joe G

BTW, when you make little jabs like “I thought basic logic was one thing UDers could handle,” you come off looking especially silly when you turn out to be wrong. - Barry Arrington

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,05:46   

Quote (Soapy Sam @ Nov. 17 2015,05:38)

Quote
What a load of crap. Photolysis generates a net yield of amino acids from simpler precursors.


please provide a scientific source to back up your claim


If amino acids were 'destroyed' by uv light, this would not be the case. Nor is it necessary for things to be restricted to the atmosphere.[/QUOTE]

what do you suggest ? oceans ? prebiotic soup ?

  
The whole truth



Posts: 1554
Joined: Jan. 2012

(Permalink) Posted: Nov. 17 2015,06:03   

Quote (Otangelo @ Nov. 17 2015,03:23)
[quote=The whole truth,Nov. 17 2015,05:11][/quote]
Quote
Hey Otangelo, ElShamah, etc., did allah-yahoo-satan-yeshoo-holy-spook "predict that lots of fossils with soft tissue, proteins, collagen, and non-permineralized, would be found"? Is there such a prediction in the bible and koran? LOL


Did i mention anywhere any holy book ??!!

All i say is that soft tissue found in fossils indicates a young age, not millions of years.

Did anyone mention Darwin before you did??!11!???111!!!1!!111??!!!11?!11!!!!11?!1.................

As Ogre said:

" What the hell does Darwin have to do with anything?

Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution. None of which support any notion of ID. These papers are as far beyond Darwin could even imagine as my cell phone is to a Victorian detective."

And you should stop playing your dishonest games. The so-called 'designer' that you and the other IDiot-creationists are pushing is the so-called 'Abrahamic God' (allah-yahoo-yeshoo-holy-spook) and 'his' helpers (satan, angels, demons, etc.). Calling your imaginary 'God' and 'his' helpers 'the designer' just shows that you're a con man.

By the way, does your 'God' have a penis?

--------------
Think not that I am come to send peace on earth: I came not to send peace, but a sword. - Jesus in Matthew 10:34

But those mine enemies, which would not that I should reign over them, bring hither, and slay them before me. -Jesus in Luke 19:27

   
Soapy Sam



Posts: 659
Joined: Jan. 2012

(Permalink) Posted: Nov. 17 2015,06:16   

Quote (Otangelo @ Nov. 17 2015,11:46)
       
Quote (Soapy Sam @ Nov. 17 2015,05:38)

       
Quote
What a load of crap. Photolysis generates a net yield of amino acids from simpler precursors.


please provide a scientific source to back up your claim.


Google it. Educate yourself. Yields are low, but nonetheless the reaction proceeds in the direction of formation (depending to some degree on the hydrogen cyanide concentration).


     
Quote (Otangelo @ Nov. 17 2015,11:46)
       
Quote (Soapy Sam @ Nov. 17 2015,05:38)

If amino acids were 'destroyed' by uv light, this would not be the case. Nor is it necessary for things to be restricted to the atmosphere.
what do you suggest ? oceans ? prebiotic soup ?


I suggest not-necessarily-the-atmosphere. If your simplistic schema regarding amino acids and uv were true, it simply precludes long-term retention at the surface (depending, of course, on how cloudy it is...). The simple answer then would be: somewhere else. I don't have to join the dots, I'm simply refuting your simplistic argument.

--------------
SoapySam is a pathetic asswiper. Joe G

BTW, when you make little jabs like “I thought basic logic was one thing UDers could handle,” you come off looking especially silly when you turn out to be wrong. - Barry Arrington

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,06:18   

Quote (The whole truth @ Nov. 17 2015,06:03)

Quote
Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution.


haha, thats a good one.

1. modern science relies on methodological naturalism. Other than natural mechanisms are not permitted as explanation. Since evolution is the only natural proposal of biodiversity, evolution is not the outcome or inference, but the premise. Show one, just ONE scientific paper, that starts with a agostic standpoint, and ends with evolution as the best explanation amongst the two possible ones, that is naturalism, and design. Begging the question is not a exception. Its the norm of 99,999999% scientific papers.

2. Abiogenesis has nothing to do with evolution.

3. When it comes to origins, rather than provide compelling explanations and elucidation of how natural mechanisms provided the outcome in question, a big part admits ignorance , where , if replaced with intelligent design, the inference would make perfect sense. And the gap rather than closing, is widening, the more science opens the black box.

I am collecting these papers which admit ignorance:

http://reasonandscience.heavenforum.org/t1584-o....science

[QUOTE][ None of which support any notion of ID./QUOTE]

Furthermore, sometime scientific papers slip through that do implicitly admit intelligent design :

http://reasonandscience.heavenforum.org/t1498-s....plexity

This paper published online his summer is a true mind-blower showing the irreducible organizational complexity (author’s description) of DNA analog and digital information, that genes are not arbitrarily positioned on the chromosome etc.


[QUOTE][And you should stop playing your dishonest games./QUOTE]

Thats a acusation i am acostumed with. I am being called dishonest, and other names all the times. Sorry, that is imho not the way to make a point....


 
Quote
The so-called 'designer' that you and the other IDiot-creationists are pushing is the so-called 'Abrahamic God' (allah-yahoo-yeshoo-holy-spook) and 'his' helpers (satan, angels, demons, etc.). Calling your imaginary 'God' and 'his' helpers 'the designer' just shows that you're a con man.

By the way, does your 'God' have a penis?


So you are unaware why we do make a distinction between creationism, and intelligent design ? Educate yourself better, before making foolish acusations and expose your ignorance.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,06:21   

Quote (Soapy Sam @ Nov. 17 2015,06:16)

Quote
Google it. Educate yourself. Yields are low, but nonetheless the reaction proceeds in the direction of formation (depending to some degree on the hydrogen cyanide concentration).


I dont have to make your homework. You raise the argument, you back it up.....

  
Soapy Sam



Posts: 659
Joined: Jan. 2012

(Permalink) Posted: Nov. 17 2015,06:51   

Quote (Otangelo @ Nov. 17 2015,12:21)
Quote (Soapy Sam @ Nov. 17 2015,06:16)

 
Quote
Google it. Educate yourself. Yields are low, but nonetheless the reaction proceeds in the direction of formation (depending to some degree on the hydrogen cyanide concentration).


I dont have to make your homework. You raise the argument, you back it up.....

HAHA! Oh, the irony. Please yourself. If you want to talk shite on the net, failing to back up your own claim that the absence of an ozone layer is fatally inimical to amino acid synthesis, you carry on.

Are we supposed to just take your original bald photolysis assertion as valid unless 'scientifically' refuted? Why should I do work you won't put in yourself, lazy-arse?

--------------
SoapySam is a pathetic asswiper. Joe G

BTW, when you make little jabs like “I thought basic logic was one thing UDers could handle,” you come off looking especially silly when you turn out to be wrong. - Barry Arrington

  
fusilier



Posts: 247
Joined: Feb. 2003

(Permalink) Posted: Nov. 17 2015,06:51   

[quote=Otangelo,Nov. 15 2015,19:26]
Quote (OgreMkV @ Nov. 15 2015,15:07)
{snip}
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? {snip}

I hope I'm not too late with this, but in 1918, 35 years before Prof. Behe was born, H.J. Muller proposed the idea of "interlocking complexity" as a consequence of Descent with Modification.

As other posters have already pointed out, "Complex Specified Information" is completely undefined, except as "That ineffable property which only Go ...err, sorry, ... The Disembodied Telic Entity can produce."

--------------
fusilier
James 2:24

  
The whole truth



Posts: 1554
Joined: Jan. 2012

(Permalink) Posted: Nov. 17 2015,07:11   

Quote (Otangelo @ Nov. 17 2015,04:18)
[quote=The whole truth,Nov. 17 2015,06:03]

 
Quote
Here's a hint, there's been 150 years of progress, with tens of thousands of papers published every year on evolution, abiogenesis, paleontology, molecular genetics, etc. All of which confirm evolution.


haha, thats a good one.

1. modern science relies on methodological naturalism. Other than natural mechanisms are not permitted as explanation. Since evolution is the only natural proposal of biodiversity, evolution is not the outcome or inference, but the premise. Show one, just ONE scientific paper, that starts with a agostic standpoint, and ends with evolution as the best explanation amongst the two possible ones, that is naturalism, and design. Begging the question is not a exception. Its the norm of 99,999999% scientific papers.

2. Abiogenesis has nothing to do with evolution.

3. When it comes to origins, rather than provide compelling explanations and elucidation of how natural mechanisms provided the outcome in question, a big part admits ignorance , where , if replaced with intelligent design, the inference would make perfect sense. And the gap rather than closing, is widening, the more science opens the black box.

I am collecting these papers which admit ignorance:

http://reasonandscience.heavenforum.org/t1584-o....science

[QUOTE][ None of which support any notion of ID./QUOTE]

Furthermore, sometime scientific papers slip through that do implicitly admit intelligent design :

http://reasonandscience.heavenforum.org/t1498-s....plexity

This paper published online his summer is a true mind-blower showing the irreducible organizational complexity (author’s description) of DNA analog and digital information, that genes are not arbitrarily positioned on the chromosome etc.


Quote
[And you should stop playing your dishonest games./QUOTE]

Thats a acusation i am acostumed with. I am being called dishonest, and other names all the times. Sorry, that is imho not the way to make a point....


   
Quote
The so-called 'designer' that you and the other IDiot-creationists are pushing is the so-called 'Abrahamic God' (allah-yahoo-yeshoo-holy-spook) and 'his' helpers (satan, angels, demons, etc.). Calling your imaginary 'God' and 'his' helpers 'the designer' just shows that you're a con man.

By the way, does your 'God' have a penis?


So you are unaware why we do make a distinction between creationism, and intelligent design ? Educate yourself better, before making foolish acusations and expose your ignorance.

"So you are unaware why we do make a distinction between creationism, and intelligent design ?"

I'm thoroughly aware of why you cdesign proponentsists try to make a distinction between creationism and intelligent design.

"Other than natural mechanisms..."

And your detailed, scientific evidence and compelling explanation and elucidation of the alleged other than natural (just say supernatural, con man) "mechanisms" is? Is 'speaking' things into existence a "mechanism"?  

"Abiogenesis has nothing to do with evolution."

Really? Then shouldn't you IDiot-creationists stop connecting abiogenesis to evolution and shut the hell up about "origins"?

"if replaced with intelligent design, the inference would make perfect sense..."

You're absolutely right and I've been telling people for years that Fifi the Pink Unicorn God and her herd of My Little Ponies (with some help from the Flying Spaghetti Monster) are the intelligent designers-creators-guiders of everything. I'm sure that you agree with me.

"This paper published online his summer is a true mind-blower showing the irreducible organizational complexity (author’s description) of DNA analog and digital information, that genes are not arbitrarily positioned on the chromosome etc."

Therefor jesus?

"Thats a acusation i am acostumed with. I am being called dishonest, and other names all the times. Sorry, that is imho not the way to make a point...."

My point is accurate.

--------------
Think not that I am come to send peace on earth: I came not to send peace, but a sword. - Jesus in Matthew 10:34

But those mine enemies, which would not that I should reign over them, bring hither, and slay them before me. -Jesus in Luke 19:27

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,14:55   

Quote (Soapy Sam @ Nov. 17 2015,06:51)

Quote

HAHA! Oh, the irony.


yep......photolysis actually isnt helping your case....

http://reasonandscience.heavenforum.org/t1556-t....osphere

Ozone plays a beneficial role by absorbing most of the biologically damaging ultraviolet sunlight (called UV-B), allowing only a small amount to reach the Earth's surface. Ozone thus plays a key role in the temperature structure of the Earth's atmosphere. Without the filtering action of the ozone layer, more of the Sun's UV-B radiation would penetrate the atmosphere and would reach the Earth's surface.
In the atmosphere Oxygen is freed by the process called photolysis. This is when high energy sunlight breaks apart oxygen bearing molecules to produce free oxygen. One of the most well known photolysis it the ozone cycle. O2 oxygen molecule is broken down to atomic oxygen by the ultra violet radiation of sunlight. This free oxygen then recombines with existing O2 molecules to make O3 or ozone. This cycle is important because it helps to shield the Earth from the majority of harmful ultra violet radiation turning it to harmless heat before it reaches the Earth’s surface.

The assumption of an oxygen-free atmosphere has also been rejected on theoretical grounds. The ozone layer around planet earth consists of a thin but critical blanket of oxygen gas in the upper atmosphere. This layer of oxygen gas blocks deadly levels of ultraviolet radiation from the sun.9 Without oxygen in the early atmosphere, there could have been no ozone layer over that early earth. Without an ozone layer, all life on the surface of planet earth would face certain death from exposure to intense ultraviolet radiation. Furthermore, the chemical building blocks of proteins, RNA and DNA, would be quickly annihilated because ultraviolet radiation destroys their chemical bonds.10 It doesn't matter if these newly formed building blocks are in the atmosphere, on dry ground, or under water.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,14:58   

Quote (The whole truth @ Nov. 17 2015,07:11)

Quote
You're absolutely right and I've been telling people for years that Fifi the Pink Unicorn God and her herd of My Little Ponies (with some help from the Flying Spaghetti Monster) are the intelligent designers-creators-guiders of everything. I'm sure that you agree with me.


I dear you. How couldnt i agree more... LOL...

The problem is with the "God concept" of the so called "invisible pink unicorn."

http://reasonandscience.heavenforum.org/t1881-w....ht=pink

First, the ipu is NOT infinite (or it wouldn't be a unicorn) so it does NOT compare with an Infinite Creator.

Second, you know that unicorns (especially pink ones) are a literary
construct which DO NOT explain infinite regress (with respect to Uncaused
Cause, or Unmoved Mover).

Third, you don't have people all over the world worshipping the ipu and
claiming to have a personal relationship with this ipu. There are no
worship songs that I am aware of that are sung by congregations to
the ipu.

Fourth, we are not created in the Image of a horse with a single horn, in
that horses in general do not think, create and work with complex mathematics. Horses are not artistic.

Fifth, the ipu is temporal and moves from place to place and experience
duration (and is limited) from a linear progressive consecutive point of
view. (experiences time by moving from place to place).

Sixth, the invisible pink unicorn has negative evidence to its contrary
(to NOT believe it in). It is nonsense and a ridiculous appeal to an
imaginary construct which doesn't deal with the premises of an Infinite
Creator Who explains infinite regressions.

Seventh, the invisible pink unicorn never became a Man and died for the
sins of the world to demonstrate His Self-Sacrificing Love.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,15:03   

Quote (fusilier @ Nov. 17 2015,06:51)
[quote=Otangelo,Nov. 15 2015,19:26]
Quote (OgreMkV @ Nov. 15 2015,15:07)
{snip}
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? {snip}

I hope I'm not too late with this, but in 1918, 35 years before Prof. Behe was born, H.J. Muller proposed the idea of "interlocking complexity" as a consequence of Descent with Modification.

As other posters have already pointed out, "Complex Specified Information" is completely undefined, except as "That ineffable property which only Go ...err, sorry, ... The Disembodied Telic Entity can produce."

Behe's Critics' Scaffolding Falls Down

http://reasonandscience.heavenforum.org/t1656-h....ed#4297

And there's another problem with the scaffolding objection. Behe defines irreducible complexity as requiring not just one part, but "several well-matched, interacting parts."


Even if you end up with an irreducibly complex system by removing parts from scaffolding, you still had to build the scaffolding. How does unguided evolution build the scaffolding by adding parts?

In that regard, adding parts to build scaffolding may be more complicated than ID critics would admit. Adding a part isn't always that simple, even if it isn't indispensible. Sometimes simply getting a functional protein-protein interaction is beyond the reach of Darwinian evolution. In 2004, Behe and Snoke published a paper in Protein Science reporting results of computer simulations and theoretical calculations. They showed that the Darwinian evolution of a simple functional bond between two proteins would be highly unlikely to occur in populations of multicellular organisms. The reason, simply put, is because too many amino acids would have to be fixed by non-adaptive mutations before gaining any functional binding interaction.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 17 2015,15:09   

Quote (Otangelo @ Nov. 17 2015,14:58)
The problem is with the "God concept" of the so called "invisible pink unicorn."

I have it on good authority the Invisible Pink Unicorn is a Supergod who created your puny God out of boredom one rainy Saturday afternoon.  

Refute that if you can.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 17 2015,15:14   

Quote (Otangelo @ Nov. 17 2015,15:03)
And there's another problem with the scaffolding objection. Behe defines irreducible complexity as requiring not just one part, but "several well-matched, interacting parts."


Behe is an idiot whose arguments based on IC were gutted years ago.

Quote
Even if you end up with an irreducibly complex system by removing parts from scaffolding, you still had to build the scaffolding. How does unguided evolution build the scaffolding by adding parts?


Like this.



--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Texas Teach



Posts: 1493
Joined: April 2007

(Permalink) Posted: Nov. 17 2015,17:49   

Quote (Otangelo @ Nov. 17 2015,03:48)
We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.

You do realize "Ghostbusters" wasn't a documentary?

--------------
"Creationists think everything Genesis says is true. I don't even think Phil Collins is a good drummer." --J. Carr

"I suspect that the English grammar books where you live are outdated" --G. Gaulin

  
Texas Teach



Posts: 1493
Joined: April 2007

(Permalink) Posted: Nov. 17 2015,17:51   

Quote (Richardthughes @ Nov. 16 2015,20:58)
Having fun with the copypastafarian, folks?

More fun than Gaulin's diary/autobiography.

But that bar's pretty low.

--------------
"Creationists think everything Genesis says is true. I don't even think Phil Collins is a good drummer." --J. Carr

"I suspect that the English grammar books where you live are outdated" --G. Gaulin

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 17 2015,18:38   

Quote (Texas Teach @ Nov. 17 2015,17:51)
Quote (Richardthughes @ Nov. 16 2015,20:58)
Having fun with the copypastafarian, folks?

More fun than Gaulin's diary/autobiography.

But that bar's pretty low.

Gary will be

attention whores, both of them.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 17 2015,18:44   

Quote (Texas Teach @ Nov. 17 2015,17:49)
Quote (Otangelo @ Nov. 17 2015,03:48)
We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.

You do realize "Ghostbusters" wasn't a documentary?

http://reasonandscience.heavenforum.org/t1284-n....dualism


Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands

http://profezie3m.altervista.org/archivi....NDE.htm

division of Cardiology, Hospital Rijnstate, Arnhem, Netherlands (P van Lommel MD); Tilburg, Netherlands (R van Wees PhD); Nijmegen, Netherlands (V Meyers PhD); and Capelle a/d Ijssel, Netherlands (I Elfferich PhD)

"During a night shift an ambulance brings in a 44-year-old cyanotic, comatose man into the coronary care unit. He had been found about an hour before in a meadow by passers-by. After admission, he receives artificial respiration without intubation, while heart massage and defibrillation are also applied. When we want to intubate the patient, he turns out to have dentures in his mouth. I remove these upper dentures and put them onto the 'crash car'. Meanwhile, we continue extensive CPR. After about an hour and a half the patient has sufficient heart rhythm and blood pressure, but he is still ventilated and intubated, and he is still comatose. He is transferred to the intensive care unit to continue the necessary artificial respiration. Only after more than a week do I meet again with the patient, who is by now back on the cardiac ward. I distribute his medication. The moment he sees me he says: 'Oh, that nurse knows where my dentures are'. I am very surprised. Then he elucidates: 'Yes, you were there when I was brought into hospital and you took my dentures out of my mouth and put them onto that car, it had all these bottles on it and there was this sliding drawer underneath and there you put my teeth.' I was especially amazed because I remembered this happening while the man was in deep coma and in the process of CPR. When I asked further, it appeared the man had seen himself lying in bed, that he had perceived from above how nurses and doctors had been busy with CPR. He was also able to describe correctly and in detail the small room in which he had been resuscitated as well as the appearance of those present like myself. At the time that he observed the situation he had been very much afraid that we would stop CPR and that he would die. And it is true that we had been very negative about the patient's prognosis due to his very poor medical condition when admitted. The patient tells me that he desperately and unsuccessfully tried to make it clear to us that he was still alive and that we should continue CPR. He is deeply impressed by his experience and says he is no longer afraid of death. 4 weeks later he left hospital as a healthy man."

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 17 2015,19:12   

Quote (Otangelo @ Nov. 17 2015,18:44)
Quote (Texas Teach @ Nov. 17 2015,17:49)
Quote (Otangelo @ Nov. 17 2015,03:48)
We know that intelligence outside of the human realm is possible. We have lots and lots of evidence of dualism, and out-of the body experiences, and near death experiences, which indicate that intelligence can exist without being bond to the physical body.

You do realize "Ghostbusters" wasn't a documentary?

http://reasonandscience.heavenforum.org/t1284-n....dualism


Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands

http://profezie3m.altervista.org/archivi....NDE.htm

division of Cardiology, Hospital Rijnstate, Arnhem, Netherlands (P van Lommel MD); Tilburg, Netherlands (R van Wees PhD); Nijmegen, Netherlands (V Meyers PhD); and Capelle a/d Ijssel, Netherlands (I Elfferich PhD)

"During a night shift an ambulance brings in a 44-year-old cyanotic, comatose man into the coronary care unit. He had been found about an hour before in a meadow by passers-by. After admission, he receives artificial respiration without intubation, while heart massage and defibrillation are also applied. When we want to intubate the patient, he turns out to have dentures in his mouth. I remove these upper dentures and put them onto the 'crash car'. Meanwhile, we continue extensive CPR. After about an hour and a half the patient has sufficient heart rhythm and blood pressure, but he is still ventilated and intubated, and he is still comatose. He is transferred to the intensive care unit to continue the necessary artificial respiration. Only after more than a week do I meet again with the patient, who is by now back on the cardiac ward. I distribute his medication. The moment he sees me he says: 'Oh, that nurse knows where my dentures are'. I am very surprised. Then he elucidates: 'Yes, you were there when I was brought into hospital and you took my dentures out of my mouth and put them onto that car, it had all these bottles on it and there was this sliding drawer underneath and there you put my teeth.' I was especially amazed because I remembered this happening while the man was in deep coma and in the process of CPR. When I asked further, it appeared the man had seen himself lying in bed, that he had perceived from above how nurses and doctors had been busy with CPR. He was also able to describe correctly and in detail the small room in which he had been resuscitated as well as the appearance of those present like myself. At the time that he observed the situation he had been very much afraid that we would stop CPR and that he would die. And it is true that we had been very negative about the patient's prognosis due to his very poor medical condition when admitted. The patient tells me that he desperately and unsuccessfully tried to make it clear to us that he was still alive and that we should continue CPR. He is deeply impressed by his experience and says he is no longer afraid of death. 4 weeks later he left hospital as a healthy man."

http://www.scientificamerican.com/article....r-death

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 17 2015,19:20   

Quote (Otangelo @ Nov. 17 2015,18:44)
Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands

(facepalm) Now we gotta listen to this woo. You must have to pass a gullibility test in which you reject all science for speculative nonsense to be a YEC.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Jim_Wynne



Posts: 1198
Joined: June 2006

(Permalink) Posted: Nov. 17 2015,19:46   

Quote (Occam's Aftershave @ Nov. 17 2015,19:20)
Quote (Otangelo @ Nov. 17 2015,18:44)
Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands

(facepalm) Now we gotta listen to this woo. You must have to pass a gullibility test in which you reject all science for speculative nonsense to be a YEC.

To actually believe in YEC one has to be delusional, but to espouse it one only has to be deceitful.  Of course there can be some combination of the two.

--------------
Evolution is not about laws but about randomness on happanchance.--Robert Byers, at PT

  
fnxtr



Posts: 2576
Joined: June 2006

(Permalink) Posted: Nov. 17 2015,20:03   

Meh.

YHWH is a literary construct, too. Like Zeus and Odin.

Yawn.

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

"I am in a rush to catch up with science work." -- Gary Gaulin

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 17 2015,21:26   

To Otangelo, science is only useful when he thinks it supports his beliefs.

Just like every other creationist. Shame about that.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
The whole truth



Posts: 1554
Joined: Jan. 2012

(Permalink) Posted: Nov. 17 2015,22:24   

Quote (Otangelo @ Nov. 17 2015,12:58)
[quote=The whole truth,Nov. 17 2015,07:11][/quote]
Quote
You're absolutely right and I've been telling people for years that Fifi the Pink Unicorn God and her herd of My Little Ponies (with some help from the Flying Spaghetti Monster) are the intelligent designers-creators-guiders of everything. I'm sure that you agree with me.


I dear you. How couldnt i agree more... LOL...

The problem is with the "God concept" of the so called "invisible pink unicorn."

http://reasonandscience.heavenforum.org/t1881-w....ht=pink

First, the ipu is NOT infinite (or it wouldn't be a unicorn) so it does NOT compare with an Infinite Creator.

Second, you know that unicorns (especially pink ones) are a literary
construct which DO NOT explain infinite regress (with respect to Uncaused
Cause, or Unmoved Mover).

Third, you don't have people all over the world worshipping the ipu and
claiming to have a personal relationship with this ipu. There are no
worship songs that I am aware of that are sung by congregations to
the ipu.

Fourth, we are not created in the Image of a horse with a single horn, in
that horses in general do not think, create and work with complex mathematics. Horses are not artistic.

Fifth, the ipu is temporal and moves from place to place and experience
duration (and is limited) from a linear progressive consecutive point of
view. (experiences time by moving from place to place).

Sixth, the invisible pink unicorn has negative evidence to its contrary
(to NOT believe it in). It is nonsense and a ridiculous appeal to an
imaginary construct which doesn't deal with the premises of an Infinite
Creator Who explains infinite regressions.

Seventh, the invisible pink unicorn never became a Man and died for the
sins of the world to demonstrate His Self-Sacrificing Love.

Blasphemer! Bigot! Truth hater! Evil purveyor and worshiper of a false God! Fool! You better pray to Fifi and the FSM and beg them to have mercy on you.

--------------
Think not that I am come to send peace on earth: I came not to send peace, but a sword. - Jesus in Matthew 10:34

But those mine enemies, which would not that I should reign over them, bring hither, and slay them before me. -Jesus in Luke 19:27

   
JAM



Posts: 517
Joined: July 2007

(Permalink) Posted: Nov. 17 2015,23:50   

[quote=Otangelo,Nov. 15 2015,21:09][/quote]
 
Quote
No evidence that RNA molecules ever had the broad range of catalytic activities


No evidence? That's a lie.

What is peptidyltransferase? I suggest you reply in two parts:

1) Meyer's lie; and
2) The truth.

 
Quote
an ability to catalyze every step of protein synthesis." The RNA world is thus a hypothetical system behind which there is little positive evidence,

Peptidyltransferase catalyzes the central stem in protein synthesis. What is it? This is a simple factual question.

 
Quote
… investigators have proposed many hypotheses, but evidence in favor of each of them is fragmentary at best.

When was that written and what is peptidyltransferase?
 
Quote
The full details of how the RNA world, and life, emerged may not be revealed in the near future.

At least we know the details for peptidyltransferase. Why does Meyer lie to his readers about it?

 
Quote
The best claimed evidence of an "RNA World" includes the fact that there are RNA enzymes and genomes, and that cells use RNA to convert the DNA code into proteins.

Lie.
 
Quote
However, RNA plays only a supporting role in the cell,

Another lie. What is peptidyltransferase?

 
Quote
RNA experts have created a variety of RNA molecules which can perform biochemical functions through what is commonly termed "test tube evolution."

What performs the essential function of peptidyltransferase?
 
Quote
However, "test tube evolution" is just a description for what is in reality nothing more than chemical engineering in the laboratory employing Darwinian principles; that does not imply that there is some known pathway through which these molecules could arise naturally.

I'm talking about the peptidyltransferase that is the center of protein synthesis in your body.

  
Soapy Sam



Posts: 659
Joined: Jan. 2012

(Permalink) Posted: Nov. 18 2015,03:41   

Quote (Otangelo @ Nov. 17 2015,20:55)
     
Quote (Soapy Sam @ Nov. 17 2015,06:51)

       
Quote

HAHA! Oh, the irony.


yep......photolysis actually isnt helping your case.... [...]



You just respond to trigger words. 'Photolysis? Oh yeah, I've heard of that ... lemme see ... I think I've written something on that ...(copypastecopypaste)'.

Photolysis of simpler molecules can generate amino acids (at, admittedly, low yields). Therefore, the thermodynamics of the situation cannot automatically mean that all amino acids will be destroyed by uv. You want a reference? Your own reference was to your own frigging musings! So I'll reference mine in response. Sam says ...

The absence of an ozone layer is hardly a problem under clouds, rocks or the sea, is it? Indeed, holes in the ozone layer today don't result in the instant molecular disintegration of organisms under them. So you are, in short, talking shite.

--------------
SoapySam is a pathetic asswiper. Joe G

BTW, when you make little jabs like “I thought basic logic was one thing UDers could handle,” you come off looking especially silly when you turn out to be wrong. - Barry Arrington

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,05:23   

Quote (JAM @ Nov. 17 2015,23:50)
[quote=Otangelo,Nov. 15 2015,21:09][/quote]
 
Quote
No evidence that RNA molecules ever had the broad range of catalytic activities


No evidence? That's a lie.

What is peptidyltransferase? I suggest you reply in two parts:

1) Meyer's lie; and
2) The truth.

 
Quote
an ability to catalyze every step of protein synthesis." The RNA world is thus a hypothetical system behind which there is little positive evidence,

Peptidyltransferase catalyzes the central stem in protein synthesis. What is it? This is a simple factual question.

 
Quote
… investigators have proposed many hypotheses, but evidence in favor of each of them is fragmentary at best.

When was that written and what is peptidyltransferase?
 
Quote
The full details of how the RNA world, and life, emerged may not be revealed in the near future.

At least we know the details for peptidyltransferase. Why does Meyer lie to his readers about it?

 
Quote
The best claimed evidence of an "RNA World" includes the fact that there are RNA enzymes and genomes, and that cells use RNA to convert the DNA code into proteins.

Lie.
 
Quote
However, RNA plays only a supporting role in the cell,

Another lie. What is peptidyltransferase?

 
Quote
RNA experts have created a variety of RNA molecules which can perform biochemical functions through what is commonly termed "test tube evolution."

What performs the essential function of peptidyltransferase?
 
Quote
However, "test tube evolution" is just a description for what is in reality nothing more than chemical engineering in the laboratory employing Darwinian principles; that does not imply that there is some known pathway through which these molecules could arise naturally.

I'm talking about the peptidyltransferase that is the center of protein synthesis in your body.

[QUOTE][No evidence? That's a lie.

What is peptidyltransferase? I suggest you reply in two parts:

1) Meyer's lie; and
2) The truth./QUOTE]

peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis. Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function. Furthermore, there is a huge gap between this advanced peptyl bond formation through  peptidyltransferase , and in a prebiotic word, where this machinery were not in place.

http://reasonandscience.heavenforum.org/t2130-p....origins

How could the gap be closed ? Not only are prebiotic mechanisms unlikely, but the transition would required the emergence of all the complex machinery and afterwards transition from one mechanism to the other. Tamura admits that fact clearly : the ultimate route to the ribosome remains unclear.   It takes a big leap of faith to believe, that could be possible in any circumstances.

The synthesis of proteins and nucleic acids from small molecule precursors represents one of the most difficult challenges to the model of prebiological evolution. There are many different problems confronted by any proposal. Polymerization is a reaction in which water is a product. Thus it will only be favored in the absence of water. The presence of precursors in an ocean of water favors depolymerization of any molecules that might be formed. Careful experiments done in an aqueous solution with very high concentrations of amino acids demonstrate the impossibility of significant polymerization in this environment.

http://phys.org/news....tml#jCp

But for the hypothesis to be correct, ancient RNA catalysts would have had to copy multiple sets of RNA blueprints nearly as accurately as do modern-day enzymes. That's a hard sell; scientists calculate that it would take much longer than the age of the universe for randomly generated RNA molecules to evolve sufficiently to achieve the modern level of sophistication. Given Earth's age of 4.5 billion years, living systems run entirely by RNA could not have reproduced and evolved either fast or accurately enough to give rise to the vast biological complexity on Earth today.


The RNA world hypothesis: the worst theory of the early evolution of life

http://www.ncbi.nlm.nih.gov/pubmed....2793875

(i) RNA is too complex a molecule to have arisen prebiotically;
(ii) RNA is inherently unstable;
(iii) catalysis is a relatively rare property of long RNA sequences only; and
(iv) the catalytic repertoire of RNA is too limited.

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 18 2015,06:31   

ever define information yet?

Or explain how a back mutation that results in exactly the same DNA strand results in less information than it had before the mutations?

No?

I'm shocked.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
fusilier



Posts: 247
Joined: Feb. 2003

(Permalink) Posted: Nov. 18 2015,06:40   

[quote=Otangelo,Nov. 17 2015,16:03]
Quote (fusilier @ Nov. 17 2015,06:51)
Quote (Otangelo @ Nov. 15 2015,19:26)
 
Quote (OgreMkV @ Nov. 15 2015,15:07)
{snip}
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ? {snip}

I hope I'm not too late with this, but in 1918, 35 years before Prof. Behe was born, H.J. Muller proposed the idea of "interlocking complexity" as a consequence of Descent with Modification.

As other posters have already pointed out, "Complex Specified Information" is completely undefined, except as "That ineffable property which only Go ...err, sorry, ... The Disembodied Telic Entity can produce."

Behe's Critics' Scaffolding Falls Down

http://reasonandscience.heavenforum.org/t1656-h....ed#4297

And there's another problem with the scaffolding objection. Behe defines irreducible complexity as requiring not just one part, but "several well-matched, interacting parts."


Even if you end up with an irreducibly complex system by removing parts from scaffolding, you still had to build the scaffolding. How does unguided evolution build the scaffolding by adding parts?

In that regard, adding parts to build scaffolding may be more complicated than ID critics would admit. Adding a part isn't always that simple, even if it isn't indispensible. Sometimes simply getting a functional protein-protein interaction is beyond the reach of Darwinian evolution. In 2004, Behe and Snoke published a paper in Protein Science reporting results of computer simulations and theoretical calculations. They showed that the Darwinian evolution of a simple functional bond between two proteins would be highly unlikely to occur in populations of multicellular organisms. The reason, simply put, is because too many amino acids would have to be fixed by non-adaptive mutations before gaining any functional binding interaction.

How unexpected:  the goalposts are moving, and a red-herring or two are being dragged across the posts.

Your original statement was:
Quote
Well, was coded, complex specified information and interdependent , irreducible complex systems predicted by the ToE ?


I pointed out that, yes, so-called "irreducible" (Behe used the term irreducibly), complex systems had been predicted by evolutionary biologists, nearly four decades before Behe was born.  The term "interlocking complexity," in Muller's paper in Genetics as well as his 1946 (? I could be wrong on the year, sorry) Nobel acceptance speech, is explicitly Behe's notion.

So that portion of your claim is demonstrably false.

You know, you really shouldn't be citing Behe and Snokes (2004.)  Behe's original claim was that protein evolution simply could not occur, unless directed by some outside agency.  Behe and Snokes demonstrated that it can.  

"Unlikely" does not mean the same thing as "impossible."
Behe proved himself wrong.

As an aside, back in 1996, when Behe was going on book-signing tours, loudly proclaiming that NO ONE had EVER studied biochemical evolution, I was getting flyers from a publisher to use "Biochemical Evolution, 2nd Edition" in my courses.  (Since I teach Human Anatomy and Physiology, it wasn't a good fit, so I passed on the opportunity.)

Your website assertions are merely wordsmithing and flappdoodle, and otherwise not worth the ATP to refute.

--------------
fusilier
James 2:24

  
JAM



Posts: 517
Joined: July 2007

(Permalink) Posted: Nov. 18 2015,08:58   

Quote
peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis.


Moron. I asked you what peptidyltransferase IS, not what it DOES. Maybe you should review basic English interrogative pronouns.

 
Quote
Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function.

What part of the ribosome is the peptidyltransferase? The active site of the enzyme, idiot.

Keep it simple and a single word: peptidyltransferase is a _.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,09:17   

Otangelo seems to be a serial spammer and plagiarist who has posted this same drivel at dozens of C/E sites.  He's used numerous different handles; he's been banned from many sites for the mindless C&Ping.  Right now he's over at TheSkepticalZone ticking off the regulars with his preaching and refusal to defend his nonsense.

Looks like it's our turn.  :p

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
EmperorZelos



Posts: 81
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,09:25   

Quote
A vast amount of complex and specified information encoded in a biochemical language;

Language already presumes intelligence because language is communcation between one intelligent being and another intelligent being. As biochemistry does none of those it is not a language of any sort. Niether is it demonstrated to be informatoin because information is produced by intelligent beings. You need to demonstrate it was produced by an intelligence to say it contains information. It contains no more informatoin than the placement of stars tells me where I am and what time of the year it is. The star has no information.

Quote
A computer-like system of commands and codes that processes the information.

Presumes the previous point which is flawed from the ground up. But even then it's just chemicals doing chemistry. Just because we can draw analogies between it and a computer to more easily understand it doesn't make it a computer or even like one.

Quote
But where in our experience do things like language, complex and specified information, programming code, or machines come from? They have one and only one known source: intelligence.

That is because they are definitionally produced by them, for things to be those things they must be shown to be the product OF an intelligence. We do however know that things like these can have a natural origin.

Patterns in nature appear for many reasons without intelligence and in evolution it's even simpler, whatever has evolutionary benifits evolves forth over time and this has been done in computer simulations where simple hydrodynamics combined with limitation of fluid and pressure results in the system evolving forth a structure that looks very much like how our arteries and the likes are in our brain and tissues in general. It simply is the efficient method to do the work with those rules and constraints.

There is no intelligence behind rivers forming the way they do, even though they curve in nice curves over times, but a product of topology and simple physics.

You got the cart before the damn horse when it came to your initial thing and even then you don't understand evolution, in evolution you expect things to get more "complex" because it simply is more efficient. Dividing up work and forming systems is more efficient to do the job that has to be done.

You know the old saying, Jack of all trades are good at nothing.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,10:05   

Quote (OgreMkV @ Nov. 18 2015,06:31)
ever define information yet?

Or explain how a back mutation that results in exactly the same DNA strand results in less information than it had before the mutations?

No?

I'm shocked.

well, thats a easy one :

The five levels of information



http://reasonandscience.heavenforum.org/t1311-t....rmation

information, dividing it into five levels. Wherever information is found, it fits these five levels. These can be illustrated with a STOP sign. The first level, statistics, tells us the STOP sign is one word and has four letters. The second level, syntax, requires the information to fall within the rules of grammar such as correct spelling, word and sentence usage. The word STOP is spelled correctly. The third level, semantics, provides meaning and implications. The STOP sign means that when we walk or drive and approach the sign we are to stop moving, look for traffic and proceed when it is safe. The fourth level, pragmatics, is the application of the coded message. It is not enough to simply recognize the word STOP and understand what it means; we must actually stop when we approach the sign. The fifth level, apobetics, is the overall purpose of the message. The STOP signs are placed by our local government to provide safety and traffic control. The code in DNA completely conforms to all five of these levels of information.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,10:11   

Quote (Otangelo @ Nov. 18 2015,10:05)
well, thats a easy one :

The five levels of information

Hey, the serial spammer and plagiarist is back!  :)

Your C&Ped vomit still doesn't define "biological information" or explain how you measure biological information to tell if it has increased or decreased.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,10:13   

Quote (fusilier @ Nov. 18 2015,06:40)

I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?

And the evolution of proteins is still a problem for proponents of naturalism to explain.

There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.

In case of 1. you can't bring evolution into the game, since evolution depends on replication. So all you are left with, are luck and chance as mechanism to make the proteins of DNA replication

and in regard of 2. Behe made a nice analogy :

Darwins Black Box page 40:

http://reasonandscience.heavenforum.org/t2115-t....ox#3760

So let us attempt to evolve a bicycle into a motorcycle by the gradual accumulation of mutations. Suppose that a factory produced bicycles, but that occasionally there was a mistake in manufacture. Let us further suppose that if the mistake led to an improvement in the bicycle, then the friends and neighbors of the lucky buyer would demand similar bikes, and the factory would retool to make the mutation a permanent feature. So, like biological mutations, successful mechanical mutations would reproduce and spread. If we are to keep our analogy relevant to biology, however, each change can only be a slight modification, duplication, or rearrangement of a preexisting component, and the change must improve the function of the bicycle. So if the factory mistakenly increased the size of a nut or decreased the diameter of a bolt, or added an extra wheel onto the front axle or left off the rear tire, or put a pedal on the handlebars or added extra spokes, and if any of these slight changes improved the bike ride, then the improvement would immediately be noticed by the buying public and the mutated bikes would, in true Darwinian fashion, dominate the market. Given these conditions, can we evolve a bicycle into a motorcycle? We can move in the right direction by making the seat more comfortable in small steps, the wheels bigger, and even (assuming our customers prefer the «biker» look) imitating the overall shape in various ways. But a motorcycle depends on a source of fuel, and a bicycle has nothing that can be slightly modified to become a gasoline tank. And what part of the bicycle could be duplicated to begin building a motor? Even if a lucky accident brought a lawnmower engine from a neighboring factory into the bicycle factory, the motor would have to be mounted on the bike and be connected in the right way to the drive chain. How could this be done step-by-step from bicycle parts? A factory that made bicycles simply could not produce a motorcycle by natural selection acting on variation—by «numerous, successive, slight modifications»—and in fact there is no example in history of a complex change in a product occurring in this manner.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,10:15   

Quote (JAM @ Nov. 18 2015,08:58)
Quote (Otangelo @ Nov. 18 2015,04:23)
 
Quote
peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis.


Moron. I asked you what peptidyltransferase IS, not what it DOES. Maybe you should review basic English interrogative pronouns.

 
Quote
Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function.

What part of the ribosome is the peptidyltransferase? The active site of the enzyme, idiot.

Keep it simple and a single word: peptidyltransferase is a _.

 
Quote
peptidyltransferase is not your life-saving buoy. It forms peptide bonds between adjacent amino acids using tRNAs during the translation process of protein biosynthesis.


Moron. I asked you what peptidyltransferase IS, not what it DOES. Maybe you should review basic English interrogative pronouns.

 
Quote
Thats a highly specific task, which requires  all other ribosome parts et al.  in place , otherwise it would have no function.

What part of the ribosome is the peptidyltransferase? The active site of the enzyme, idiot.

Keep it simple and a single word: peptidyltransferase is a _.

After Occam, you are the second poster here on my ignore list. Good bye.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,10:18   

Quote (Otangelo @ Nov. 18 2015,10:13)
There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.


Yawn.  The same Creationist stupidity.  "Science doesn't know all the steps yet therefore GAWDDIDIT!!"

Quote
and in regard of 2. Behe made a nice analogy :


The serial spammer and plagiarizer still too dumb to get that analogies aren't evidence.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,10:20   

Quote (Otangelo @ Nov. 18 2015,10:15)
After Occam, you are the second poster here on my ignore list. Good bye.

Gee, I suppose we should feel honored.  A serial spammer and plagiarist has decided he's too afraid to respond.

That's OK Otangelo.  We'll still keep answering your idiocy and showing what a scientifically ignorant nincompoop you are.  No charge.   :)

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,11:10   

What a fucking tool.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
fusilier



Posts: 247
Joined: Feb. 2003

(Permalink) Posted: Nov. 18 2015,11:39   

Quote (Otangelo @ Nov. 18 2015,11:13)
Quote (fusilier @ Nov. 18 2015,06:40)

I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?

And the evolution of proteins is still a problem for proponents of naturalism to explain.

There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.

In case of 1. you can't bring evolution into the game, since evolution depends on replication. So all you are left with, are luck and chance as mechanism to make the proteins of DNA replication

and in regard of 2. Behe made a nice analogy :

Darwins Black Box page 40:

http://reasonandscience.heavenforum.org/t2115-t....ox#3760

So let us attempt to evolve a bicycle into a motorcycle by the gradual accumulation of mutations. Suppose that a factory produced bicycles, but that occasionally there was a mistake in manufacture. Let us further suppose that if the mistake led to an improvement in the bicycle, then the friends and neighbors of the lucky buyer would demand similar bikes, and the factory would retool to make the mutation a permanent feature. So, like biological mutations, successful mechanical mutations would reproduce and spread. If we are to keep our analogy relevant to biology, however, each change can only be a slight modification, duplication, or rearrangement of a preexisting component, and the change must improve the function of the bicycle. So if the factory mistakenly increased the size of a nut or decreased the diameter of a bolt, or added an extra wheel onto the front axle or left off the rear tire, or put a pedal on the handlebars or added extra spokes, and if any of these slight changes improved the bike ride, then the improvement would immediately be noticed by the buying public and the mutated bikes would, in true Darwinian fashion, dominate the market. Given these conditions, can we evolve a bicycle into a motorcycle? We can move in the right direction by making the seat more comfortable in small steps, the wheels bigger, and even (assuming our customers prefer the «biker» look) imitating the overall shape in various ways. But a motorcycle depends on a source of fuel, and a bicycle has nothing that can be slightly modified to become a gasoline tank. And what part of the bicycle could be duplicated to begin building a motor? Even if a lucky accident brought a lawnmower engine from a neighboring factory into the bicycle factory, the motor would have to be mounted on the bike and be connected in the right way to the drive chain. How could this be done step-by-step from bicycle parts? A factory that made bicycles simply could not produce a motorcycle by natural selection acting on variation—by «numerous, successive, slight modifications»—and in fact there is no example in history of a complex change in a product occurring in this manner.

[quote=fusilier,Nov. 18 2015,06:40][/quote]
Quote

I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?


Muller's Genetics paper was in 1918, not 1935.  The "what" is that you loudly proclaimed  evolutionary biology did not and could not predict "irreducibly complex" structures, but that goddidit does.  You were wrong.  When corrected, you now pretend that you never did so.

That isn't merely being wrong, it's telling a lie.  

For the balance of your flapdoodle, I invite you to read several hundred papers from Jack Szostak's lab:

http://molbio.mgh.harvard.edu/szostak....ns.html

The late Carl Woese also demolished your claim.

OBTW, motorcycles don't reproduce.  Otherwise there's this really nice Moto Guzzi/Indian hybrid I've been thinking about.

--------------
fusilier
James 2:24

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,12:07   

Quote (fusilier @ Nov. 18 2015,11:39)
Quote (Otangelo @ Nov. 18 2015,11:13)
Quote (fusilier @ Nov. 18 2015,06:40)

I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?

And the evolution of proteins is still a problem for proponents of naturalism to explain.

There are actually two problems to explain:

1. How the minimal set of proteins emerged to make the first living cell, in particular DNA replication proteins

2. and how new proteins to make new body plans could have evolved after life was up and going.

In case of 1. you can't bring evolution into the game, since evolution depends on replication. So all you are left with, are luck and chance as mechanism to make the proteins of DNA replication

and in regard of 2. Behe made a nice analogy :

Darwins Black Box page 40:

http://reasonandscience.heavenforum.org/t2115-t....ox#3760

So let us attempt to evolve a bicycle into a motorcycle by the gradual accumulation of mutations. Suppose that a factory produced bicycles, but that occasionally there was a mistake in manufacture. Let us further suppose that if the mistake led to an improvement in the bicycle, then the friends and neighbors of the lucky buyer would demand similar bikes, and the factory would retool to make the mutation a permanent feature. So, like biological mutations, successful mechanical mutations would reproduce and spread. If we are to keep our analogy relevant to biology, however, each change can only be a slight modification, duplication, or rearrangement of a preexisting component, and the change must improve the function of the bicycle. So if the factory mistakenly increased the size of a nut or decreased the diameter of a bolt, or added an extra wheel onto the front axle or left off the rear tire, or put a pedal on the handlebars or added extra spokes, and if any of these slight changes improved the bike ride, then the improvement would immediately be noticed by the buying public and the mutated bikes would, in true Darwinian fashion, dominate the market. Given these conditions, can we evolve a bicycle into a motorcycle? We can move in the right direction by making the seat more comfortable in small steps, the wheels bigger, and even (assuming our customers prefer the «biker» look) imitating the overall shape in various ways. But a motorcycle depends on a source of fuel, and a bicycle has nothing that can be slightly modified to become a gasoline tank. And what part of the bicycle could be duplicated to begin building a motor? Even if a lucky accident brought a lawnmower engine from a neighboring factory into the bicycle factory, the motor would have to be mounted on the bike and be connected in the right way to the drive chain. How could this be done step-by-step from bicycle parts? A factory that made bicycles simply could not produce a motorcycle by natural selection acting on variation—by «numerous, successive, slight modifications»—and in fact there is no example in history of a complex change in a product occurring in this manner.

[quote=fusilier,Nov. 18 2015,06:40][/quote]  
Quote

I did not answer to your point about Muller, simply because you are right. He came up with interlocked complexity in 1935. So what ?


Muller's Genetics paper was in 1918, not 1935.  The "what" is that you loudly proclaimed  evolutionary biology did not and could not predict "irreducibly complex" structures, but that goddidit does.  You were wrong.  When corrected, you now pretend that you never did so.

That isn't merely being wrong, it's telling a lie.  

For the balance of your flapdoodle, I invite you to read several hundred papers from Jack Szostak's lab:

http://molbio.mgh.harvard.edu/szostak....ns.html

The late Carl Woese also demolished your claim.

OBTW, motorcycles don't reproduce.  Otherwise there's this really nice Moto Guzzi/Indian hybrid I've been thinking about.

Well, irreducible complexity is basically the opposit of step by step , gradual evolution by mutations and natural selection. So no miracle here for Muller to come up with the concept.

When Szostak has a compelling explanation of how life came to be, a prize of 1mio dollar awaits for him, and the Nobel prize.

But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,12:17   

Quote (Otangelo @ Nov. 18 2015,12:07)
[snip]

But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....

And you've failed basic logic there - universal negatives.

Also, you clearly don't understand ID, which is a (flawed) probabilistic argument. (Improbable vs impossible)

So you're dismissed.

Next?

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,12:18   

Quote (Otangelo @ Nov. 18 2015,12:07)
But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....

Another blustering empty claim by the spamming plagiarist.  :p

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,12:23   

Quote (Otangelo @ Nov. 18 2015,13:07)
...
Well, irreducible complexity is basically the opposit of step by step , gradual evolution by mutations and natural selection. So no miracle here for Muller to come up with the concept.

Nonsense.
And beside the point.
You were wrong.  You lied in your response.
And you are running away from all the various counters and challenges raised against the PRATTs you've posted.
Quote
When Szostak has a compelling explanation of how life came to be, a prize of 1mio dollar awaits for him, and the Nobel prize.

But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....

When you have a compelling and detailed explanation of how life  came to be, we'll be fascinated.
"Poof" is neither rationally compelling nor detailed.
Amongst other logical flaws, all cases of creation known to us, without exception, are interactions between matter.
A 'disembodied mind', whatever else it might be, is entirely impotent.  It can have no causal impact.
Evidence to the contrary, not merely wishful thinking, is required.

Why is abiogenesis impossible?  What particular chemical reactions are not possible but occur in the transition from non-living to living?
We have concrete real examples of such transitions -- potato mosaic virus being one of  the better known.
At no point in the process, vague and indeterminate though the exact point of change may be, is  there anything going on that is not physical.  As such, there is nothing going on that is not explicable by chemistry and physics.
That's far more than you have.  Far better supported by evidence.  And logic.

Until you can demonstrate that there is some violation of chemical and physical behavior required for life to occur, you are merely asserting your own wishful thinking.
Waffling on about 'information' is irrelevant.  Provide the actual chemical and/or physical impossibilities that prevent abiogenesis.
There are none known.  You'd get quit a prize if you could provide one.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,12:54   

Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?

There are many reasons. I will post a small list to begin with:

http://reasonandscience.heavenforum.org/t1279-a....ossible

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

2. The next problem concerns the so-called handedness of the amino acids. Because of the way that carbon atoms join up with other atoms, amino acids exist in two forms—the right-handed form and the left-handed form. Just as your right hand and left hand are identical in all respects except for their handedness, so the two forms of amino acids are identical except for their handedness. In all living systems only left-handed amino acids are found. Yet Miller’s experiment produced a mixture of right-handed and left-handed amino acids in identical proportions. As only the left-handed ones are used in living systems, this mixture is useless for the evolution of living systems.

3. Another major problem for the chemical evolutionist is the origin of the information that is found in living systems. There are various claims about the amount of information that is found in the human genome, but it can be conservatively estimated as being equivalent to a few thousand books, each several hundred pages long. Where did this information come from?

4. If the many instructions that direct an animal’s or plant’s immune system had not been preprogrammed in the organism’s genetic system when it first appeared on earth, the first of thousands of potential infections would have killed the organism. This would have nullified any rare genetic improvements that might have accumulated. In other words, the large amount of genetic information governing the immune system could not have accumulated in a slow, evolutionary sense.a Obviously, for each organism to have survived, all this information must have been there from the beginning.  

5.The sugar found in the backbone of both DNA and RNA, ribose, has been particularly problematic, as the most prebiotically plausible chemical reaction schemes have typically yielded only a small amount of ribose mixed with a diverse assortment of other sugar molecules.

6. all the peptide links to form a proptein must be alpha-peptide bonds, not some mix of alpha and epsilon,beta, and gamma bonds


http://www.newgeology.us/present....32.html

"The first paradox is the tendency of organic matter to devolve and to give tar.  If you can avoid that, you can start to try to assemble things that are not tarry, but then you encounter the water problem, which is related to the fact that every interesting bond that you want to make is unstable, thermodynamically, with respect to water.  If you can solve that problem, you have the problem of entropy, that any of the building blocks are going to be present in a low concentration; therefore, to assemble a large number of those building blocks, you get a gene-like RNA -- 100 nucleotides long -- that fights entropy.  And the fourth problem is that even if you can solve the entropy problem, you have a paradox that RNA enzymes, which are maybe catalytically active, are more likely to be active in the sense that destroys RNA rather than creates RNA."


7.amino acids and sugars combine and destroy each other. In lab experiments the component chemicals are neatly separated from one another. How is this possible in a primitive ocean?

8. Synthesis vs destruction - For chemical bonds to form there needs to be an external source of energy. Unfortunately, the same energy that creates the bonds is much more likely to destroy them. In the famous Miller experiment (1953) that synthesized amino acids, a cold trap is used to selectively isolate the reaction products. Without this, the would be no products. This poses a challenge to simplistic early earth schemes where lightning simply strikes a primitive ocean. Where is the "trap" in such an ocean? Also, the creation of amino acids by a chemist in a laboratory is still much different from forming self-replicating life.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,12:58   

Quote (Otangelo @ Nov. 18 2015,12:54)
 
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?

There are many reasons. I will post a small list to begin with:

Unknowns to overcome but not one thing that makes abiogenesis impossible.

Same idiot blithering.  :D

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,13:04   

Quote (Occam's Aftershave @ Nov. 18 2015,12:58)
Quote (Otangelo @ Nov. 18 2015,12:54)
 
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?

There are many reasons. I will post a small list to begin with:

Unknowns to overcome but not one thing that makes abiogenesis impossible.

Same idiot blithering.  :D

Fails basic logic.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
EmperorZelos



Posts: 81
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,13:14   

Quote
But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....

The fact is that scientists disagree, if you think they are wrong why aren't you publishing your results in a scientific journal yourself? It'd save them a lot of work.

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,13:29   

Prediction: Ignore followed by more copypasta.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,13:54   

Quote (Otangelo @ Nov. 18 2015,13:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?

There are many reasons. I will post a small list to begin with:

http://reasonandscience.heavenforum.org/t1279-a....ossible

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

2. The next problem concerns the so-called handedness of the amino acids. Because of the way that carbon atoms join up with other atoms, amino acids exist in two forms—the right-handed form and the left-handed form. Just as your right hand and left hand are identical in all respects except for their handedness, so the two forms of amino acids are identical except for their handedness. In all living systems only left-handed amino acids are found. Yet Miller’s experiment produced a mixture of right-handed and left-handed amino acids in identical proportions. As only the left-handed ones are used in living systems, this mixture is useless for the evolution of living systems.

3. Another major problem for the chemical evolutionist is the origin of the information that is found in living systems. There are various claims about the amount of information that is found in the human genome, but it can be conservatively estimated as being equivalent to a few thousand books, each several hundred pages long. Where did this information come from?

4. If the many instructions that direct an animal’s or plant’s immune system had not been preprogrammed in the organism’s genetic system when it first appeared on earth, the first of thousands of potential infections would have killed the organism. This would have nullified any rare genetic improvements that might have accumulated. In other words, the large amount of genetic information governing the immune system could not have accumulated in a slow, evolutionary sense.a Obviously, for each organism to have survived, all this information must have been there from the beginning.  

5.The sugar found in the backbone of both DNA and RNA, ribose, has been particularly problematic, as the most prebiotically plausible chemical reaction schemes have typically yielded only a small amount of ribose mixed with a diverse assortment of other sugar molecules.

6. all the peptide links to form a proptein must be alpha-peptide bonds, not some mix of alpha and epsilon,beta, and gamma bonds


http://www.newgeology.us/present....32.html

"The first paradox is the tendency of organic matter to devolve and to give tar.  If you can avoid that, you can start to try to assemble things that are not tarry, but then you encounter the water problem, which is related to the fact that every interesting bond that you want to make is unstable, thermodynamically, with respect to water.  If you can solve that problem, you have the problem of entropy, that any of the building blocks are going to be present in a low concentration; therefore, to assemble a large number of those building blocks, you get a gene-like RNA -- 100 nucleotides long -- that fights entropy.  And the fourth problem is that even if you can solve the entropy problem, you have a paradox that RNA enzymes, which are maybe catalytically active, are more likely to be active in the sense that destroys RNA rather than creates RNA."


7.amino acids and sugars combine and destroy each other. In lab experiments the component chemicals are neatly separated from one another. How is this possible in a primitive ocean?

8. Synthesis vs destruction - For chemical bonds to form there needs to be an external source of energy. Unfortunately, the same energy that creates the bonds is much more likely to destroy them. In the famous Miller experiment (1953) that synthesized amino acids, a cold trap is used to selectively isolate the reaction products. Without this, the would be no products. This poses a challenge to simplistic early earth schemes where lightning simply strikes a primitive ocean. Where is the "trap" in such an ocean? Also, the creation of amino acids by a chemist in a laboratory is still much different from forming self-replicating life.

None of those are adequate.
We have  life.
We have chemistry and physics.
We have no reason whatsoever to believe that chemistry and physics could not lead to the formation of life.

I note  with mild interest that you ignore the example of tobacco mosaic virus.
I note you appear to be unfamiliar with, and likely unaware of, Schrodinger's production of DNA prior to its discovery.
Surely one of the great predictions of evolutionary theory, confirmed and continuing to be useful.
Not a single prediction of 'design "theory"' has such evidentiary backing.
All 'design "theory"' does is whine about alleged problems with the genuine sciences.  It produces nothing of itself, it merely casts aspersions.  And whine, endlessly.

Your claim was not that abiogenesis was unlikely, your claim was that it was impossible.
The strongest of your, frankly ignorant, objections, can show, at most, that abiogenesis is unlikely.

Your claim, you need to support it.   Why is abiogenesis impossible?
Particularly, the  challenge you must overcome is to show that there is some aspect of life that violates the laws of chemistry and physics.  Until and unless such demonstration is provided, there is little, as in no, warrant, to suppose that chemistry and physics do not suffice.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,14:44   

Quote (EmperorZelos @ Nov. 18 2015,13:14)
Quote
But i doubt that will ever happen, since abiogenesis is IMPOSSIBLE to happen. THAT is a fact.....

The fact is that scientists disagree, if you think they are wrong why aren't you publishing your results in a scientific journal yourself? It'd save them a lot of work.

ah no ?

Evolutionist George Wald reflected on this dilemma and wrote

"The reasonable view [during the two centuries before Louis Pasteur] was to believe in spontaneous generation; the only alternative, to believe in a single, primary act of supernatural creation. There is no third position. One has only to contemplate the magnitude of this task to concede that the spontaneous generation of a living organism is impossible.

Joseph Mastropaolo, Ph.D.

According to the most generous mathematical criteria for evolution, abiogenesis and monogenesis are impossible to unimaginable extremes.

Abiogenic Origin of Life: A Theory in Crisis
Ó 2005 Arthur V. Chadwick, Ph.D.
Professor of Geology and Biology

To give you an idea of how incomprehensible, I use the following illustration. An ameba starts out at one side of the universe and begins walking towards the other side, say, 100 trillion light years away. He travels at the rate of one meter per billion years. He carries one atom with him. When he reaches the other side, he puts the atom down and starts back. In 10186 years, the ameba will have transported the entire mass of the universe from one side to the other and back a trillion trillion trillion trillion trillion trillion times. That is my definition of impossible. And what resulted from success, if it did occur would not be a living cell or even a promising combination. Spontaneous origin of life on a prebiological earth is IMPOSSIBLE!

biologist Francis Crick acknowledged in 1981:

  "An honest man, armed with all the knowledge available to us now, could only state that in some sense, the origin of life appears at the moment to be almost a miracle, so many are the conditions which would have had to be satisfied to get it going."

Abiogenesis is not only unproven, it is mathematically impossible. No wonder both Orgel and Crick called it a miracle.

― Michael Denton, Evolution: A Theory In Crisis

“The complexity of the simplest known type of cell is so great that it is impossible to accept that such an object could have been thrown together suddenly by some kind of freakish, vastly improbable, event. Such an occurrence would be indistinguishable from a miracle.”

Some have suggested that certain clay or crystal surfaces might "select" one isomer over another and therefore, purify a mixture of like handed (optically pure) molecules. However, this argument ignores that fact that the entropy states of the two isomers are identical and are very difficult to separate. Secondly, experimental chemistry shows that it is impossible to get pure mixtures of one or the other isomer this way. Irregularities in the structure of the clay or crystal surfaces would result in the accumulation of both isomers, i.e., contaminants. Since this is so, if even one incorrect isomer gets integrated into a protein or nucleic acid, its 3-D structure would be destroyed.

The Second Law, coupled with the fact that these condensation reactions are reversible, drives the solution in the net direction of a mixture containing predominantly unbonded building blocks. According to thermodynamic calculations by Harold Blum (Time's Arrow and Evolution), in a watery solution about 1% of amino acids will exist as dipeptides (two bonded amino acids), .001% as tripeptides and less than one in 10/20 will exist in a chain of ten amino acids. Those that do bond will be quickly unbonded when a collision with water occurs unless these unlikely, reduced entropy molecules are stored and kept away from the solution in equilibrium. 41. In a primordial soup, random molecular movement would cause the building blocks of life to diffuse away from their site of origin. Just as concentrated red dye will disperse when dropped into water, the building blocks of DNA and protein will also diffuse until equilibrium is reached. At this point there would be billions of water molecules for every unbonded building block. This process, along with the rapid breakdown of nucleotides and amino acids by oxygen and UV radiation, makes it almost impossible to imagine how, in a watery environment, biochemical precursors could combine, stay combined and continue to build upon each other in the fact of the concept of chemical equilibrium.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,14:46   

Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?

more reasons :

The hardware and software of the cell, evidence of design

http://reasonandscience.heavenforum.org/t2221-t....-design

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,14:59   

Quote (Otangelo @ Nov. 18 2015,14:46)
Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?

more reasons :

The hardware and software of the cell, evidence of design

http://reasonandscience.heavenforum.org/t2221-t....-design

You don't really understand "impossible", do you?


But like a good creationist, you just ignore the bits that don't work for you and press on. I'm sure your points getting destroyed doesn't stop you raising them again in the future. Seen it all before.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,15:02   

Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,15:19   

Quote (Otangelo @ Nov. 18 2015,15:46)
 
Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?

more reasons :

The hardware and software of the cell, evidence of design

http://reasonandscience.heavenforum.org/t2221-t....-design

Design in the usual sense of the term is an irrelevancy.  A red herring.
What is needed is evidence of manufacture.
This is starkly missing.
Many things are design but never produced.  Many things  are produced but not designed.  

All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,15:19   

Quote (Otangelo @ Nov. 18 2015,14:46)
 
Quote (NoName @ Nov. 18 2015,13:54)
  Why is abiogenesis impossible?

more reasons :

More C&Ped Creationist horsecrap that doesn't support your claim abiogenesis is impossible.

Do you think your lying and bearing false witness will get you into heaven?  Is that why you do it?

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,15:30   

Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?

Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,15:35   

Quote (NoName @ Nov. 18 2015,15:19)
All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?

Two points here :

How exactly did God create things ? what process was involved ?

http://reasonandscience.heavenforum.org/t1794-h....nvolved

Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.

Argument from incredulity

http://reasonandscience.heavenforum.org/t1724-a....ty#2738

Incredulity is based on human experience and on what we actually know. For example, the belief in abiogenesis can be strongly doubted, one can be skeptical of it, because it has never been observed and all proposals have lead to a dead end so far. So its more than rational to look somewhere else.  What has been observed is biogenesis, life coming from life. What we know is that the complexity in the natural world of living organisms is similar to, in fact much greater than, the complexity of intelligently created devices, such as the clock or the computer. You might implie that incredulity is an unreasonable position, but it is in fact a foundation for all critical thought. Sensible people do not believe things without evidence. Consider the opposite, credulity; there is no context in which that is not a pejorative word! Considering what atheists are willing to believe, can indeed be classed as credulous.

It is also quite proper for a person of one religion or philosophy to be skeptical of the beliefs of another one. The religion of naturalism, which is the basis of evolution, can properly be rejected by a biblical theist. The evolutionist system may be dominant in some parts of the world, but that says nothing about whether it is true. Many have looked at it and found it inadequate; they have found good reasons to be skeptical of it, especially since theism better explains very many features of the natural world.

When i say that something is unbelievable or inconceivable,  i give good reasons. If my whole argument were simply an unsupported statement of unbelief, you would have a good point; to say something is unbelievable without giving a reason is not a good argument. But the problem is that you oversimplify; you do not address the reasons for incredulity.

Incredulity is an argument of scepticism about a certain point of view, and the evolutionist and atheist are not innocent of using such an argument. Incredulity, doubt and scepticism about God and special creation, are implicit in every naturalistic explanation  about abiogenesis and many other facets of their  view points.

This kind of arguments are frequent :

 how can a perfect deity create such a messed up world? (translation: it is inconceivable that a perfect deity could create such a messed up world, therefore, since evolution is a theory of messed-up, random natural forces and actions, it must be true)
 how can (a certain part of a living organism, e.g., the human eye) be designed when it has this mistake or that problem? (translation: it is inconceivable that an intelligent divine designer could create that supposedly malfunctioning part of the living organism; therefore it must have been formed through random, unintelligent, natural forces, i.e. evolution)

All of these arguments could be accurately classed as arguments of incredulity. If no reason is given, any argument from incredulity is weak.

And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

  
Soapy Sam



Posts: 659
Joined: Jan. 2012

(Permalink) Posted: Nov. 18 2015,15:51   

Quote (Otangelo @ Nov. 18 2015,21:30)
Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?

Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.

Hey! Can you ignore me too please? Thanks.

--------------
SoapySam is a pathetic asswiper. Joe G

BTW, when you make little jabs like “I thought basic logic was one thing UDers could handle,” you come off looking especially silly when you turn out to be wrong. - Barry Arrington

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,16:04   

Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

Why do you keep telling this same lie?  It doesn't get any better with age or retelling.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,16:06   

Quote (Otangelo @ Nov. 18 2015,15:30)
Quote (Richardthughes @ Nov. 18 2015,15:02)
Liar: " Orgel and Crick called it a miracle. "

The quote just above it:

" almost a miracle" - Crick. No supporting Orgel quote given. Why do you lie? What do you think happens to liars?

Richard

you called me a liar without a adequate justification. You ignored all quotes i provided.

Nr.3 on my ignore list. congrats.

To use your very example:

True or false:

"miracle" = "almost a miracle" ??


Its very simple. YOU LIAR.

I didn't 'ignore all the quotes you provided' as I cited the one that shows you are a liar.

SO THAT'S ANOTHER LIE, THEN.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Richardthughes



Posts: 10762
Joined: Jan. 2006

(Permalink) Posted: Nov. 18 2015,16:08   

Quote (Occam's Aftershave @ Nov. 18 2015,16:04)
Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

Why do you keep telling this same lie?  It doesn't get any better with age or retelling.

because YEC creationist, obviously!

Facts just won't stick. Disgusting.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,16:14   

Quote (Otangelo @ Nov. 18 2015,16:35)
   
Quote (NoName @ Nov. 18 2015,15:19)
All the design claims can possibly lead to are conclusions that intelligent living material beings created life on earth.
Obviously, this solves no problems, but merely shifts the problem elsewhere.  As such it is worse than nonsense, it is useless nonsense.

This is one of many reasons why 'design inferences' fail.  They have no explanatory power.
Design explains nothing.
You need evidence of manufacture.  This is starkly missing.

So far all you have done is trot out more and more strained arguments from incredulity.
Your claim, which you still need to defend, is that abiogenesis is impossible.

It clearly occurred -- life exists.  
There is nothing in or about life that violates the laws of chemistry and physics.
Thus, there are no grounds for inferring anything other than chemical and physical abiogenesis.
Attempts to drag poorly defined, vague and equivocal notions like 'information' into the argument, and allowing them to trump far better grounded arguments, are unjustifiable.  They all amount to arguments from incredulity and special pleading.
Worse, from the perspective of the enterprise of human knowledge, they all seek to make a positive claim based solely on asserted problems with the existing explanations.
Flaws in our current understanding of anything at all provide no positive support for otherwise unsupported assertions masquerading as arguments.

So to repeat the question you continue to avoid, about a claim you yourself made quite emphatically
Why is abiogenesis not merely unlikely or improbable, but impossible?

Two points here :

How exactly did God create things ? what process was involved ?

Who asked?
Note, too, that 'process' is also an inherently temporal term.  There can be no process if there is no time.
Further, processes are not disembodied or free-floating -- how can there be a process if there are no things (in the broadest sense of the term)?
You're worse at philosophy then you are at science.
[pointless link deleted]
 
Quote
Looking at the account of Genesis 1:1 for just a brief moment, the words in that first verse are quite remarkable. They are indicative of the incredible mind of God. God says in that first verse everything that could have been said about creation and He says it in such few terms. The statement is precise and concise almost beyond human composition.

A well-known scientist named Herbert Spencer died in 1903. He discovered that all reality, all reality, all that exists in the universe can be contained in five categories...time, force, action, space and matter. Herbert Spencer said everything that exists, exists in one of those categories...time, force, action, space and matter.

Now think about that. Time, force, action, space and matter. That is a logical sequence. And then with that in your mind, listen to Genesis 1:1. "In the beginning," that's time..."God," that's force, "created," that's action, "the heavens," that's space, "and the earth," that's matter. Everything that could be said about everything that exists is said in that first verse.

Now either you believe that or you don't. You either believe that that verse is accurate and God is the force or you believe that God is not the force that created everything. And then you're left with chance or randomness or coincidence.

In genesis it says God spoke and things came into existence. God is a potent cause with power ( energy ) and his spoken word indicates information.  Because we do not understand and in a detailled manner how he created the physical universe, and life, does not mean God does not understand or can't. Mystery to us is not mystery to God, but we do know that God is not limited to His spiritual realm, as he shown with his becoming of flesh in Jesus Christ.

Argument from incredulity...

Funny, in all that blather there is nothing that rescues your arguments nor shows that my claims regarding them are false.
You are simply arguing from your own prejudicial (in the technical sense of the term) rejection of theories that you cannot even present accurately.  Most, if not all, of your objections to abiogenesis are old, tired, and amount to PRATTs.

 
Quote
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

Oddly enough, nothing you have posted supports this conclusion.  
You continue to squirm around avoiding the question.
Could it be you are not qualified to assert such a claim so boldly and absolutely?  You are not so qualified if you cannot answer the question.
Why is abiogenesis impossible?

The words that so impress you are not remarkable in any way.
The claims were not uttered nor recorded by God.  Even in  the Abrahamic religions, those words are claimed to have been recorded by Moses.  Moses' words are not self-validating.  It is circular, if not question-begging, to simply accept them on the face of things.
Particularly when, on the face of things, that is, the clear text, the beginning of Genesis is a mishmash of commonplace mythology of the Mediterranean basin, particularly the region from Egypt east and northwards to Turkey.
You are asking us to assume your conclusion.
It remains an asserted conclusion, without adequate support, and without any explanatory power whatsoever even if the existence of a god should somehow be shown.
"Poof" is not an explanation.

But all of those words that you bibliolators are so impressed by are entirely irrelevant to the claims I am attacking.
They are, at best, a cop-out.

Nothing you have posted is responsive to the issues raised.
Why is abiogenesis impossible?

New issues, since you raised the subjects:
How does creation happen when there is no time?
There is no 'beginning' without time.

Ontology has progressed since Spencer.  Nor is he particularly noted for his ontology.
You're cherry-picking as part of your furious Gish-gallop to avoid the problems of your own position.
Defend it or explicitly abandon it.

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,16:22   

Shorter response to Otangelo's drivel:

The deity of the Abrahamic religions does not and cannot solve the problem of abiogenesis.
The god (or "God" if you prefer) of Abraham, Isaac, and Jacob is not biologically alive.
Therefore, the problem remains untouched.
If abiogenesis is impossible, than god can't do it either, not being biologically alive.
If God is claimed to be biologically alive, then he rose from abiogenesis, or abiogenesis is possible and there is some prior 'process' which led to his life.
If God is not biologically alive (and he possesses none of the hallmarks of biologically living things), and he 'created' life, then we still have the problem of how.
Asserting it sans positive evidence does not solve the problem of how abiogenesis occurred.
Unless everything, literally, is alive, the problem remains how did life arise?
"Poof" is not an answer.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,16:25   

Quote (Otangelo @ Nov. 18 2015,15:35)
And i repeat it WITH ALL LETTERS. Upon what we have learned through research of the origin of life, abiogenesis is not merely unlikely or improbable. It is IMPOSSIBLE by all means. Period.

How do you know it is impossible by all means?  Are you an omnipotent God who tested all means?

Why don't you add this to your "library".

Researchers may have solved origin-of-life conundrum

"The origin of life on Earth is a set of paradoxes. In order for life to have gotten started, there must have been a genetic molecule—something like DNA or RNA—capable of passing along blueprints for making proteins, the workhorse molecules of life. But modern cells can’t copy DNA and RNA without the help of proteins themselves. To make matters more vexing, none of these molecules can do their jobs without fatty lipids, which provide the membranes that cells need to hold their contents inside. And in yet another chicken-and-egg complication, protein-based enzymes (encoded by genetic molecules) are needed to synthesize lipids.

Now, researchers say they may have solved these paradoxes. Chemists report today that a pair of simple compounds, which would have been abundant on early Earth, can give rise to a network of simple reactions that produce the three major classes of biomolecules—nucleic acids, amino acids, and lipids—needed for the earliest form of life to get its start. Although the new work does not prove that this is how life started, it may eventually help explain one of the deepest mysteries in modern science.

“This is a very important paper,” says Jack Szostak, a molecular biologist and origin-of-life researcher at Massachusetts General Hospital in Boston, who was not affiliated with the current research. “It proposes for the first time a scenario by which almost all of the essential building blocks for life could be assembled in one geological setting.”

Here's the actual paper

Common origins of RNA, protein and lipid precursors in a cyanosulfidic protometabolism
Patel et al
Nature Chemistry, 7, 301–307 (2015)

Abstract: A minimal cell can be thought of as comprising informational, compartment-forming and metabolic subsystems. To imagine the abiotic assembly of such an overall system, however, places great demands on hypothetical prebiotic chemistry. The perceived differences and incompatibilities between these subsystems have led to the widely held assumption that one or other subsystem must have preceded the others. Here we experimentally investigate the validity of this assumption by examining the assembly of various biomolecular building blocks from prebiotically plausible intermediates and one-carbon feedstock molecules. We show that precursors of ribonucleotides, amino acids and lipids can all be derived by the reductive homologation of ​hydrogen cyanide and some of its derivatives, and thus that all the cellular subsystems could have arisen simultaneously through common chemistry. The key reaction steps are driven by ultraviolet light, use ​hydrogen sulfide as the reductant and can be accelerated by Cu(I)–Cu(II) photoredox cycling

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,16:56   

Quote (NoName @ Nov. 18 2015,16:22)
"Poof" is not an answer.

What is ?

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,17:09   

Quote (Otangelo @ Nov. 18 2015,17:56)
Quote (NoName @ Nov. 18 2015,16:22)
"Poof" is not an answer.

What is ?

Absence of a definitive answer is better answered by "we don't know yet" than by "poof".
One is susceptible to further investigation and study.  The other is the death of the mind.

As I have shown, that there are living and non-living things is the core problem of abiogenesis.
The Abrahamic god is not a sufficient answer.  Nor does recourse to 'god did it' serve as an explanation, and, in fact, either dethrones the deity or fails to address the problem.  Worse, it requires acceptance of contradictions as noted previously.

So you are left clutching your incredulity, further from an answer than science and reason.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,17:12   

Quote (NoName @ Nov. 18 2015,17:09)
The Abrahamic god is not a sufficient answer.

It might not be to you. But it is certainly to me, and many others...

Limited causal alternatives for origins

http://reasonandscience.heavenforum.org/t1810-l....origins

Its not justified to claim " we don't know ", when a limited range of alternatives and options are available. In regard our our existence, there are just and exactly 3, namely:

chance
design
physical necessity.

since chance, and physical necessity won't cut the cake, the best explanation for our existence is design.


Pretend you wake up in the morning and there's a birthday cake sitting on your kitchen table, and it just happens to be your birthday. What do you think? You ask yourself, "Where did this cake come from?" There are only a couple of possibilities, theoretically. It could have just materialized out of nowhere on your kitchen table coincidentally on your birthday. It could have just "poofed" into existence. I guess that would be in the realm of theoretic possibilities. Or maybe a great, hot, wet wind blew through your neighbor's kitchen gathering up a bunch of ingredients and kind of accidentally baked a cake that landed on your table. The fact that it happened on your birthday is a coincidence. I guess that would be "possible" too. The cake could have come out of nowhere, or could have just assembled itself by chance. Or the other alternative would be that a person baked the cake for you and dropped it off in the middle of the night.

Now here's the trick. When faced with limited options you don't have the liberty not to believe something. If you reject the idea that somebody baked the cake for you, you must assert in its place that the cake either materialized out of nothing or formed itself by accident. When you reject one option you are asserting an alternate option when all the options are clear.

Do you see that? When you are faced with just a limited number of choices, if you reject one choice you've got to opt for one of those that remains. So the question is, which option makes most sense?


http://enrichmentjournal.ag.org/201303....sts.cfm

The Christian Geneticist Francis Collins of Human Genome Project fame said he was an agnostic in college. Yet he confesses that his “I don’t know” was more an “I don’t want to know” attitude — a “willful blindness.”11 This agnosticism eventually gave way to outright atheism — although Collins would later come to faith in Christ. He began reading C.S. Lewis’ Mere Christianity, and Collins realized his own antireligious constructs were “those of a schoolboy.”12

Because the existence of God is a massively important topic, we cannot afford not to pay attention — especially in an age of so many diversions. Philosopher Tom Morris points out that sports, TV, restaurants, concerts, cars, billiards, and a thousand other activities can divert us from the ultimate issues of life. As a result, we don’t “tune into” God. And when a crisis hits (death, hospitalization, natural disaster), we are not really in the best condition to process and make accurate judgments about those deep questions.13 The person who says, “I do not know if God exists,” may have chosen to live by diversions and distractions and thus to ignore God. This is not an innocent ignorance; this ignorance is the result of our neglecting our duty.

So the theist, atheist, and militant (ornery) agnostic all bear a burden of proof; the theist does not have a heavier burden since all claim to know something. Furthermore, even the alleged ordinary agnostic still is not off the hook. For one thing, one cannot remain neutral all his life; he will make commitments or hold beliefs all along the way that reflect either an atheistic or theistic worldview. He is either going to be a practical atheist or practical theist (or a mixture of the two) in some fashion throughout his life. But he can’t straddle the fence for long. Also, the ordinary agnostic may say, “I do not know,” but this often means “I do not care” — the view of an “apatheist.” Refusing to seek out whether God exists or not; refusing to humble oneself to seek whatever light about God is available; living a life of distractions rather than thoughtfully reflecting about one’s meaning, purpose, or destiny leaves one culpable in his ignorance, not innocent.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,17:17   

Quote (Otangelo @ Nov. 18 2015,17:12)
It might not be to you. But it is certainly to me, and many others...

If you're content to stay pitifully ignorant about the natural world and accept "POOF!  GAWDDIDIT" for everything then more power to you.  Just don't expect anyone with an IQ higher than room temperature (Celsius) to agree with you.  And certainly don't expect to change anyone's mind by C&Ping the bog-standard Creationist lies and misinformation.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,17:25   

As I said, the death of the mind.

That pretty much makes you a zombie.

You can't justify your claims, you can't defend them, you accept atemporal  processes and atemporal causation, both manifestly internally contradictory.

As has been obvious from the start, you are making prejudicial assertions in service of your agenda and your incredulity.

That this is satisfactory to you is shameful.

  
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,17:27   

Quote (Otangelo @ Nov. 18 2015,17:12)
Its not justified to claim " we don't know ", when a limited range of alternatives and options are available. In regard our our existence, there are just and exactly 3, namely:

chance
design
physical necessity.

since chance, and physical necessity won't cut the cake, the best explanation for our existence is design.

But the combination of chance and physical necessity in the form of evolution does the job quite nicely.

Sorry, no need for your Magic Designing Poofter.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,17:46   

It is perhaps worth noting that design is only required in the face of physical necessity.
Without limitations, material limits or restrictions, i.e., physical necessity, design is superfluous.
The Abrahamic god, claimed to be omniscient and omnipotent, need not design.  The very notion is outside the scope of consideration of any such being.
Thus, we have good grounds for rejecting your claims of signs of divine or non-natural design -- they must be spurious.
If there are such signs, they undercut the claims made for the nature of god.

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 18 2015,17:59   

What is the information VALUE from this string of DNA
Quote
ATG GTG GAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTGAAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC GGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGC
ACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAGTCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCTCAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTCAAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCTGAG AAC TTC AGG TGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACAGT
TTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTT
TCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGA
AATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTT
GCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTT
AATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTA
TCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAAC
AGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT


Now calculate the information VALUE of this string
Quote
ATG GTG GAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
GAG AAC TTC AGG GTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT


1) Show your work?
2) How does the mutation in bold change the information VALUE of the string?
3) Why is this change impossible?

BTW: I will not accept C&P posts. Do the math, show your work, derive your conclusions from the math. Or, like every other creationist, admit that you can't.

P.S. I should add that if you ignore me too, then there's basically no one else on this site. You'll basically be spamming a thread that no one will ever read and you won't listen to any responses.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,18:33   

Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly

please cite me where i make that admittance.

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,18:34   

Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?

i am bad on math. sorry

  
NoName



Posts: 2721
Joined: Mar. 2013

(Permalink) Posted: Nov. 18 2015,18:44   

Quote (Otangelo @ Nov. 18 2015,19:33)
 
Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly

please cite me where i make that admittance.

It's implied by your remarks regarding Genesis 1:1, above.  The first post on this page.
Either god created time, which commits you to atemporal causes and atemporal processes, or god did not create the five Spencerian ontological categories you are so impressed by.

But again, this is beside the point.
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

We can return to the more recently raised issues of your ontological confusions and absurdities after we've cleared that up.

  
Dr.GH



Posts: 2137
Joined: May 2002

(Permalink) Posted: Nov. 18 2015,18:53   

Quote (Otangelo @ Nov. 18 2015,10:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?

There are many reasons. I will post a small list to begin with:

1.  In Miller’s experiment he was careful to make sure there was no oxygen present. If oxygen was present, then the amino acids would not form. However, if oxygen was absent from the earth, then there would be no ozone layer, and if there was no ozone layer the ultraviolet radiation would penetrate the atmosphere and would destroy the amino acids as soon as they were formed. So the dilemma can be summed up this way: amino acids would not form in an atmosphere with oxygen and amino acids would be destroyed in an atmosphere without oxygen.

Miller was using the atmospheres of the other Solar System planets known by spectrographic analysis. This was his professor Harold Urey's hypothesis. Charles Darwin's idea was that the origin of life was in a reducing environment because the decomposition products of tissues were reduced. He was incorrect, Urey was correct.

You clearly have no experience in chemistry.

The early earth had a reduced atmosphere. We know this in several ways. The most significant is geological data.

Matthew A. Pasek, Jelte P. Harnmeijer, Roger Buick, Maheen Gull, and Zachary Atlas
2013 "Evidence for reactive reduced phosphorus species in the early Archean ocean" PNAS 2013 ; published ahead of print June 3, 2013, doi:10.1073/pnas.1303904110

Colin Goldblatt, Timothy M. Lenton and Andrew J. Watson
2006 "Bistability of atmospheric oxygen and the Great Oxidation" Nature 443, 683-686 (12 October 2006) | doi:10.1038/nature05169

Manfred Schidlowski, Peter W. U. Appel, Rudolf Eichmann and Christian E. Junge
1979 "Carbon isotope geochemistry of the 3.7 × 109-yr-old Isua sediments, West Greenland: implications for the Archaean carbon and oxygen cycles" Geochim. Cosmochim. Acta 43, 189-199

Zahnle, Kevin, Laura Schaefer and Bruce Fegley
2010 “Earth's Earliest Atmospheres” Cold Spring Harbor Perspectives in Biology

Ozone with a reducing atmosphere;

Noll KS, Roush TL, Cruikshank DP, Johnson RE, Pendleton YJ.
1997 “Detection of ozone on Saturn's satellites Rhea and Dione. “ Nature 1997 Jul 3;388(6637):45-7

Additionally, UV shielding would only be needed in continental terrains;

Sagan, Carl, Christopher Chyba
1997  “The Early Faint Sun Paradox: Organic Shielding of Ultraviolet-Labile Greenhouse Gases” Science v. 276 (5316): 1217-1221

E. T. Wolf and O. B. Toon
2010 “Fractal Organic Hazes Provided an Ultraviolet Shield for Early Earth” Science 4 June 328: 1266-1268 [DOI: 10.1126/science.1183260]

Watanabe, Y., Martini, J.E.J., Ohmoto, H.
2000 “Geochemical evidence for terrestrial ecosystems 2.6 billion years ago.” letters, Nature, 408, 574-578 (2000).  (terrestrial bio by 2.6 to 2.7 Ga implies sufficient O2 for an biogenic Ozone UV shield)

But, an even better UV shield is ice. And, Ice is an excellent location for several key chemical steps;

Cleaves, H. James, Stanley L. Miller
1998 “Oceanic protection of prebiotic organic compounds from UV radiation” PNAS-USA v. 95, issue 13: 7260-7263

Bada, Jeffrey. L., C. Bigham, Stanley L. Miller
1994 “Impact melting of frozen oceans on the early Earth: Implications for the origin of life” PNAS-USA v.91: 1248-1250

BERNSTEIN, MP, JP DWORKIN, SA SANDFORD, GW COOPER &
LJ ALLAMANDOLA
2002 "Racemic amino acids from the ultraviolet photolysis of interstellar ice analogues"  Nature 416, 401 - 403 (2002)

Attwater, J., Wochner, A., & Holliger, P.
2013 "In-ice evolution of RNA polymerase ribozyme activity" Nature chemistry, 5(12), 1011-1018.

Bernstein, M. P. et al.  
1999 "UV irradiation of polycyclic aromatic hydrocarbons in ices: Production of alcohols, quinones, and ethers" Science 283, 1135–1138

Blank, J.G., Gregory H. Miller, Michael J. Ahrens, Randall E. Winans
2001 “Experimental shock chemistry of aqueous amino acid solutions and the cometary delivery of prebiotic compounds” Origins of Life and Evolution of the Biosphere 31(1-2):
15-51,

GM MUÑOZ CARO, UJ MEIERHENRICH, WA SCHUTTE, B BARBIER, A ARCONES SEGOVIA, H ROSENBAUER, WHP THIEMANN, A BRACK & JM GREENBERG
2002 "Amino acids from ultraviolet irradiation of interstellar ice analogues"  Nature 416, 403 - 406 (2002)

Miyakawa S, Cleaves HJ, Miller SL.
2002 "The cold origin of life: B. Implications based on pyrimidines and purines produced from frozen ammonium cyanide solutions" Orig Life Evol Biosph. 2002 Jun;32(3):209-18

Cleaves HJ, Nelson KE, Miller SL.
2006 "The prebiotic synthesis of pyrimidines in frozen solution" Naturwissenschaften. 2006 Mar 22

And, the final nail in this particular creationist fraud is that abiotic amino acid synthesis can happen in the presence of oxygen;

Cleaves, H. James, John H. Chalmers, Antonio Lazcano, Stanley L. Miller, Jeffrey L. Bada
2008 “A Reassessment of Prebiotic Organic Synthesis in Neutral Planetary Atmospheres” Orig Life Evol Biosph (2008) 38:105–115

So, to review; the Miller/Urey hypothesis was confirmed; the UV "problem" was not a problem.

--------------
"Science is the horse that pulls the cart of philosophy."

L. Susskind, 2004 "SMOLIN VS. SUSSKIND: THE ANTHROPIC PRINCIPLE"

   
Occam's Aftershave



Posts: 1786
Joined: Feb. 2006

(Permalink) Posted: Nov. 18 2015,18:55   

Quote (Otangelo @ Nov. 18 2015,18:34)
 
Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?

i am bad on math. sorry

You pretty much suck at science too but that's not stopping you.

--------------
"Science is what got us to the humble place we’re at, and what hard-won progress we might realize comes from science, with ID completely flaccid, religious apologetics bitching from the sidelines." - Eigenstate at UD

  
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,20:04   

Quote (NoName @ Nov. 18 2015,18:44)
Quote (Otangelo @ Nov. 18 2015,19:33)
 
Quote (NoName @ Nov. 18 2015,17:25)
you accept atemporal  processes and atemporal causation, both manifestly

please cite me where i make that admittance.

It's implied by your remarks regarding Genesis 1:1, above.  The first post on this page.
Either god created time, which commits you to atemporal causes and atemporal processes, or god did not create the five Spencerian ontological categories you are so impressed by.

But again, this is beside the point.
Why is abiogenesis impossible?
Nothing about life violates the laws of physics and chemistry.  Purely natural processes control the transition of tobacco mosaic virus from non-living crystal to life -- and back.

We can return to the more recently raised issues of your ontological confusions and absurdities after we've cleared that up.

What i said, does not imply that God created outside of time. That is impossible.

http://www.leaderu.com/offices....on.html

the cause of the Big Bang operated at to, that is, simultaneously (or coincidentally{1}) with the Big Bang. Philosophical discussions of causal directionality routinely treat simultaneous causation, the question being how to distinguish A as the cause and B as the effect when these occur together at the same time [Dummett and Flew (1954); Mackie (1966); Suchting (1968-69); Brier (1974), pp. 91-98; Brand (1979)].{2} Even on a mundane level, we regularly experience simultaneous causation;

Non of the alternatives make sense to me :

5 Easy Steps to refute Atheism

http://reasonandscience.heavenforum.org/t1877-5....sm#3144

  
OgreMkV



Posts: 3654
Joined: Oct. 2009

(Permalink) Posted: Nov. 18 2015,20:07   

Quote (Otangelo @ Nov. 18 2015,18:34)
Quote (OgreMkV @ Nov. 18 2015,17:59)
1) Show your work?

i am bad on math. sorry

So you have no way of knowing that they are lying to you?

But you trust them. Why?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Otangelo



Posts: 148
Joined: Oct. 2015

(Permalink) Posted: Nov. 18 2015,20:11   

Quote (Dr.GH @ Nov. 18 2015,18:53)
Quote (Otangelo @ Nov. 18 2015,10:54)
Quote (NoName @ Nov. 18 2015,12:23)
Why is abiogenesis impossible?