RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (249) < ... 170 171 172 173 174 [175] 176 177 178 179 180 ... >   
  Topic: Joe G.'s Tardgasm, How long can it last?< Next Oldest | Next Newest >  
olegt



Posts: 1378
Joined: Dec. 2006

(Permalink) Posted: Oct. 14 2012,21:21   

Quote (Joe G @ Oct. 14 2012,21:20)
So to be clear- oleg is never going to support his claim that I used "additive" incorrectly.

That is it, that is all I need to know.

thanks

You don't understand what additive means in mathematics. You failed to answer my question about f(x) = x+2. I answered it for you.

--------------
If you are not:
Galapagos Finch
please Logout »

  
Richardthughes



Posts: 10064
Joined: Jan. 2006

(Permalink) Posted: Oct. 14 2012,21:22   

Quote (Joe G @ Oct. 14 2012,21:18)
Quote (Richardthughes @ Oct. 14 2012,21:16)
Quote (Joe G @ Oct. 14 2012,21:13)
 
Quote (Richardthughes @ Oct. 14 2012,21:10)
Thanks Oleg - great JoeTard meltdown! Quality LOLs.

The meltdown is all yours and oleg's.

Meltdowns belong to people who spew and cannot support their spewage- and that would be you.

Yeah, I saw you confidently answer one if his questions, incorrectly and dodge the other. Never mind, KF will kiss it all better for you, gimpy.

Now what are you talking about?

Oleg has not supported his false accusation. He can't. All he can do is spew and then cause some diversion.

Joe, you're an idiot with most things, but you're exceptionally bad at all things related to math. Now go and spoon with KF, cry and ask to remain on UD because the 'Evos' were mean to you.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 14 2012,21:37   

Quote (Joe G @ Oct. 14 2012,20:34)
Quote (OgreMkV @ Oct. 14 2012,19:18)
Quote (Joe G @ Oct. 14 2012,19:01)
 
Quote (fnxtr @ Oct. 10 2012,19:21)
 
Quote
So 500 1s alone do NOT tell me anything- I need to have information about the entire process. Got it.


This from the doofus who gave us "design is a mechanism".

So sad. So very, very sad.

According to the dictionary, design is a mechanism. So don't blame me because you are too stupid to be able to read and understand a dictionary.

But "your" design isn't just design.  It's also construction and you don't have a mechanism for that.

If you do, you might let Behe know, since he stated that he doesn't have a mechanism by which the "intelligent designer" acted.

BTW: Are you going to call gpuccio on his statement that
 
Quote
Again: we test dFSCI with a set of long enough strings. Some of them are designed and meaningful, some of them are generated randomly. We know the origin of each string (if it was designed or randomly originated) because we have direct knowledge of how they were produced. Then we take some independent observer, who knows nothing about the origin of the strings, and ask him to infer desing, or not, using the evaluation of dFSCI for those strings. He will recognize the designed strings, with 100% specificity.


Ya see, you told me when I asked you to do the same thing that my random vs. non-random string wasn't about ID.

Yet gpuccio is talking about it as though he could actually use ID to determine the difference between a random string and a designed string.

So Joe, is gpuccio wrong or do you need to go ask him how it's done?

Kevin, you ignorant dumbass- design refers to the construction part too.

And the design inference refers to what it takes an agency to produce vs what blind and undirected processes can do.

So please spare me your ignorance.

OK, so let me know when you write a letter to Michael Behe correcting him.  I'd really like to read it.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 14 2012,21:44   

Quote (Joe G @ Oct. 14 2012,20:39)
In his bullshit article on "Darwininian Evolution on a Chip", Kevin spews:



 
Quote
Michael Behe, in his book Edge of Evolution states that it is impossible for four mutations to happen in a gene to result in a improvement in the resulting protein. He uses the example of resistant malaria, where there are two mutations and states that this is the edge of evolution because there’s probability that these two mutations can’t happen in the same gene at the same time.








1-    In a GENE, that means in a complete organism

So I'm intrepreting the word "gene" wrong?

Really... one gene is a complete organism?  So, the gene that controls my ability to taste certain chemicals is also all that's needed to build my entire body?

Dang, the rest of the biological science need to figure this stuff out.  (yes, I'm laughing at you)
Quote



2-    In an organism the target space is much larger than this example

But we're not talking about an organism are we?

Just out of curiosity Joe, how many mutations does the average human have?  Meaning, how many differences betwen a child's genes and the parents'?
Quote



3-    This example the thing that requires changing gets mutated every time it is placed in the error-prone PCR

Yeah, so?  Even human systems make mistakes.  Quite poor design that, don't you think?
Quote



4-    With an organism mutations would occur in other parts of the genome and the target gene may not get mutated again

Again... SO?  You see that word you used "may".  Makes a pretty powerful difference.

I know you don't understand why though.
Quote



5-    Two, or more mutations occurring in one gene at the same time is just relying on pure luck, which is NOT scientific


You keep using words, but the study was done and it happened.

Quote



6-    I cannot find where Behe says states it is impossible for four mutations to happen in a gene to result in an improvement in the resulting protein- what page/ pages is that on


Oh sorry, what Behe actually says is "two".

Quote



Also Behe puts the edge of evolution at two new protein-to-protein binding sites. Who cares about how many mutations- you need to have those mutations construct new protein machinery.

Yep and the Evolution on a chip study shows that it can happen in very little time, with very small populations, resulting in MASSIVE increases in efficiency of the result.

Winning.

edit to fix quotes.
edit again to fix quotes (and further mock Joe's 'understanding' of biology

Edited by OgreMkV on Oct. 15 2012,11:04

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 14 2012,21:49   

Quote (Joe G @ Oct. 14 2012,20:42)
Quote
I continually ask creationists two questions. The first is simple.



Quote
Do you understand that even if you completely and totally discredit evolution right here, right now, it doesn’t mean that your notions of creationism are correct?




And I always tell Kevin that 1- we are not trying to discredit "evolution". Rather we are just pointing out the obvious flaws in the blind watchmaker thesis.
[/quote]

The blindwatchmaker hypothesis that you are the only person on this Earth that uses it.
Quote



2- In order to reach a design inference we must first dispense with the blind watchmaker thesis.


Since the blind watchmaker thesis doesn't exist, that's done.  next?
Quote


ya see Newton's four rules of scientific investigation, and the explanatory filter, mandate that approach. If you actually knew something about science you would have known that.

Poor Joe.  Why don't you actually use the EF to do something.  Well. we can hope that's what's coming next.
Quote



Quote
The other question I routinely ask is



Quote
OK, you win. Evolution (or other science) is wrong. Now what? How does ID/creationism/etc. describe phenomenon x?





It all depends on what it is. Science is context specific there Kevin. Again that is something you would have known had you any understanding of science.

Um no.  It's not.  You must not understand science.  Science is a PROCESS, not a conclusion.
Quote


Take Stonehenge. Obviously mother nature can produce rocks and rock formations. However there is something about Stonehenge that makes us infer mother nature didn't do it.


What is that thing that makes us infer design?  How is it determined?  Can it be applied to anything?  Can I give you a few things and see if you can infer design or not design?
Quote


IOW the investigation is different than any purely geological survey. The design inference adds something, ie designers, a purpose, ie a new can of worms.


Then what are the designers?  Where are they?  What is the mechanism of their action?  When do they act?  How?  Why?
[quote]

Studying it as a purely geological formation wouldn't have any of those questions. And it would be a waste of time.

Nevermind.

BTW: Are you going to go correct gpuccio?  Because you and him are saying the completely opposite things.

Of course, you and Behe are saying completely opposite things too.  Going to correct him?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Erasmus, FCD



Posts: 6349
Joined: June 2007

(Permalink) Posted: Oct. 15 2012,00:09   

Quote (Joe G @ Oct. 14 2012,21:45)
Quote (Richardthughes @ Oct. 14 2012,20:41)
Check out his " ID is a non mechanistic theory which has a mechanism which is design" meltdown right now - priceless!

Richie, Your ignoramnce doesn't mean I am having a meltdown. And yes your ignorance is priceless.

So to be clear, RichTARD Hughes is too stupid to use a dictionary and he thinks his ignorance is a refutation.

Intelligent Design is not a mechanistic theory but that does NOT mean that 1- design is not a mechansim or 2- we cannot propose specific design mechanisms.

But obvioulsy you are too fucking stupid to understand that.

What Richie dumbass doesn't understand is when we say ID is not a mechansitic theory we mean that we do not have to know the specific design mechansims used BEFORE we can infer design.

oh dear god
MOAR OF THIS



--------------
You're obviously illiterate as hell. Peach, bro.-FtK

Finding something hard to believe based on the evidence, is science.-JoeG

the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat

I work on molecular systems with pathway charts and such.-Giggles

  
blipey



Posts: 2061
Joined: June 2006

(Permalink) Posted: Oct. 15 2012,00:26   

Quote (Joe G @ Oct. 14 2012,21:20)
So to be clear- oleg is never going to support his claim that I used "additive" incorrectly.

That is it, that is all I need to know.

thanks

He did neatly show that you have no idea what additive means.  That was a small piece of awesome.

--------------
But I get the trick question- there isn't any such thing as one molecule of water. -JoeG

And scientists rarely test theories. -Gary Gaulin

   
blipey



Posts: 2061
Joined: June 2006

(Permalink) Posted: Oct. 15 2012,00:29   

Since you're having the troubles with the mathz, Joe, why not try your hand at the writings?  Now would be a great time to post the high school ID curriculum that you've written.

--------------
But I get the trick question- there isn't any such thing as one molecule of water. -JoeG

And scientists rarely test theories. -Gary Gaulin

   
keiths



Posts: 2040
Joined: Jan. 2006

(Permalink) Posted: Oct. 15 2012,01:36   

Quote (blipey @ Oct. 14 2012,22:29)
Since you're having the troubles with the mathz, Joe, why not try your hand at the writings?

Before he tries his hand at the writings, I'd like to see him learn how to do the spellcheckings.

Quote (Joe G @ Oct. 14 2012,21:45)
 
Richie, Your ignoramnce doesn't mean I am having a meltdown. And yes your ignorance is priceless.

So to be clear, RichTARD Hughes is too stupid to use a dictionary [says Joe, who is too stupid to use a spell-checker] and he thinks his ignorance is a refutation.

Intelligent Design is not a mechanistic theory but that does NOT mean that 1- design is not a mechansim or 2- we cannot propose specific design mechanisms.

But obvioulsy you are too fucking stupid to understand that.

What Richie dumbass doesn't understand is when we say ID is not a mechansitic theory we mean that we do not have to know the specific design mechansims used BEFORE we can infer design.


Joe, haven't you always wondered what the red squiggly lines mean in a text window?



Think about it.

--------------
And the set of natural numbers is also the set that starts at 0 and goes to the largest number.  -- Joe G

Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there. -- KF

  
The whole truth



Posts: 971
Joined: Jan. 2012

(Permalink) Posted: Oct. 15 2012,02:12   

joey shat:

"Hopefully your flight crashes and you die. The world will be a much better place without the likes of you."

That's mighty muslim of you joey.

--------------
Think not that I am come to send peace on earth: I came not to send peace, but a sword. - Jesus in Matthew 10:34

But those mine enemies, which would not that I should reign over them, bring hither, and slay them before me. -Jesus in Luke 19:27

   
Zachriel



Posts: 2593
Joined: Sep. 2006

(Permalink) Posted: Oct. 15 2012,09:29   

Quote (Joe G @ Oct. 14 2012,20:54)
Quote (olegt @ Oct. 14 2012,20:52)
Oh, and Joe thinks he knows what a superset is, even though his understanding differs from the commonly accepted mathematical definition.

Let's hear from him directly, ladies and gentlemen.

Joe, here is a set: A = {1,2,3}. Anyone knows that {1}, {2}, and {3} are subsets of A. Is {1,2} a superset?

There is only one superset in a nested hierarchy, ie only one set that consists of and contains ALL other sets.

Now you may take issue to that usage but that is your problem, not mine.


The fact remains in a nested hierarchy there is only one set that consists of and conatins ALL of the other (sub)sets. So that would be "the" superset. Duh.

This is reminiscent of the time that Joe couldn't understand that the empty set is a subset of every set.

In any case, Joe, take it from our long and varied experience, it's best to simply admit your error and learn. We have acquired quite an education thereby.

--------------
There is only one Tard. The Tard is One.

   
Erasmus, FCD



Posts: 6349
Joined: June 2007

(Permalink) Posted: Oct. 15 2012,10:57   

Quote (Joe G @ Oct. 14 2012,21:57)
Quote (Richardthughes @ Oct. 14 2012,20:55)
Quote (Joe G @ Oct. 14 2012,20:49)
 
Quote (olegt @ Oct. 14 2012,20:46)
 
Quote (Joe G @ Oct. 14 2012,20:43)
I am using it corectly you little faggot.

Oh, really, Mr. Math? Then tell us what it means for a function to be additive. Is f(x) = x+2 an additive function? :D

oleg make your case you lying piece of shit. IOW prove that I am using the word "additive" incorrectly as opposed to just spewing it.

You won't because you are just a lying loser.

Oh Joe, you're shaking again. You always get caught bluffing!

You faggots are the fucking bluffers. Obviously you cannot make a case that I am using the word "additive" incorrectly and it pisses you off taht you got caught lying.



yes that is just what i needed

Joe you know old buddy what you need to do is go and get you some degrees so that you can publish your ideas and the world can accept your authority.  I mean, as compelling a case as "you faggots are the fucking bluffers" may be, I am yet hesitant to accept that this means that you have any clue what oleg is asking you whatsoever

but by all means rage on little buddy, we feast upon your butthurt as if it were the body and blood of the host.  won't you do this in remembrance of me?

--------------
You're obviously illiterate as hell. Peach, bro.-FtK

Finding something hard to believe based on the evidence, is science.-JoeG

the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat

I work on molecular systems with pathway charts and such.-Giggles

  
Erasmus, FCD



Posts: 6349
Joined: June 2007

(Permalink) Posted: Oct. 15 2012,11:00   

Quote (Richardthughes @ Oct. 14 2012,22:02)
Meet me in the parkinglot after class, Oleg!!!!111



"meat"

--------------
You're obviously illiterate as hell. Peach, bro.-FtK

Finding something hard to believe based on the evidence, is science.-JoeG

the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat

I work on molecular systems with pathway charts and such.-Giggles

  
Erasmus, FCD



Posts: 6349
Joined: June 2007

(Permalink) Posted: Oct. 15 2012,11:08   

Quote (Joe G @ Oct. 14 2012,22:06)
Quote (olegt @ Oct. 14 2012,21:04)
So, Joe, I don't have much time to waste tonight. I have an early flight tomorrow and I need to finish a letter of recommendation for a grad student.

I hereby conclude that you have no idea what additive means in a mathematical context. If you knew, you would have no trouble answering that f(x) = x+2 is not an additive function.

oleg- no one cares what you conclude. You are an ignorant fucking asshole. And obvioulsy you are a coward because you cannot make your case against me.

Ya see only a coward needs to play games as opposed to actually making a case, and here you are.

Hopefully your flight crashes and you die. The world will be a much better place without the likes of you.



You are making Him cry, Joe.  Be a nice boy and ask oleg to forgive your uncharitable remarks

--------------
You're obviously illiterate as hell. Peach, bro.-FtK

Finding something hard to believe based on the evidence, is science.-JoeG

the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat

I work on molecular systems with pathway charts and such.-Giggles

  
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 15 2012,11:14   

It took me about 3 minutes to hit up Wikipedia, find "additive function" and understand why Oleg's function that he asked Joe about wasn't additive.

Here's a hint Joe: An additive function doesn't mean that you add a number to another number.

You see, much like Biology, Chemistry and everything else, mathematics has some very specific definitions. They use words in ways that may be counter-intuitive.  That means, your 'common sense' understanding of the terms is wrong.  

You know, things like 'mol' and 'design' and 'super set'.

You really ought to learn what the words actually mean before trying to discuss them.  I'll give you another hint.  If you're using a word, in a particular context, then it's not us who have to use your definition.  We're not wrong because we use the word correctly.

Come on Joe, tell all about mols again.

BTW: Are you busy writing that letter to Behe to tell him that ID is a mechanism.  I hope you have the mechanism handy (here's a hint, a blueprint for a building is not a mechanism for constructing the building).

Or maybe you're writing a response to gpuccio about how he's wrong because ID can (try to) distinguish between random and non-random... after you told me that wasn't even required for ID.

It makes one almost think that you don't even understand ID... or that ID has too many definitions.  Either way, your side is pretty much screwed.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
JohnW



Posts: 2198
Joined: Aug. 2006

(Permalink) Posted: Oct. 15 2012,13:12   

So now we can add a couple more things to the "things Joe knows nothing about" list.

Of course, given the evidence, I think we're justified in putting everything on the "things Joe knows nothing about" list.  In the unlikely event that Joe shows any discernible skill or knowledge, we can remove an item or two from the list.  But I think it's safe to write it in ink.

--------------
Math is just a language of reality. Its a waste of time to know it.
- Robert Byers

  
Erasmus, FCD



Posts: 6349
Joined: June 2007

(Permalink) Posted: Oct. 15 2012,13:54   

Quote (JohnW @ Oct. 15 2012,14:12)
So now we can add a couple more things to the "things Joe knows nothing about" list.

Of course, given the evidence, I think we're justified in putting everything on the "things Joe knows nothing about" list.  In the unlikely event that Joe shows any discernible skill or knowledge, we can remove an item or two from the list.  But I think it's safe to write it in ink.

for Bonus LULZ, re-write this syllogism in set notation

--------------
You're obviously illiterate as hell. Peach, bro.-FtK

Finding something hard to believe based on the evidence, is science.-JoeG

the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat

I work on molecular systems with pathway charts and such.-Giggles

  
JohnW



Posts: 2198
Joined: Aug. 2006

(Permalink) Posted: Oct. 15 2012,14:15   

Quote (Erasmus @ FCD,Oct. 15 2012,11:54)
Quote (JohnW @ Oct. 15 2012,14:12)
So now we can add a couple more things to the "things Joe knows nothing about" list.

Of course, given the evidence, I think we're justified in putting everything on the "things Joe knows nothing about" list.  In the unlikely event that Joe shows any discernible skill or knowledge, we can remove an item or two from the list.  But I think it's safe to write it in ink.

for Bonus LULZ, re-write this syllogism in set notation

I was thinking of writing it in a more explicitly Bayesian manner.  Joe babbling on probability and statistics has a lot of potential.

--------------
Math is just a language of reality. Its a waste of time to know it.
- Robert Byers

  
keiths



Posts: 2040
Joined: Jan. 2006

(Permalink) Posted: Oct. 15 2012,15:36   

The KF-Joe "scold and grovel" dynamic:
Quote
Joe: Remember, I cannot spend a lot of time policing and cleaning up threads. Kindly, restrain yourself. Namecalling and personal attacks are patently counter-productive: answer a fool according to his folly, and you will be as him, down in the mud of a fever swamp wrestling amidst the filth, where he can probably beat you on experience. Yes, I can see where a well warranted negative conclusion where someone has gone to the point where his/her behaviour goes to character is appropriate; but even in those cases, remember you are dealing with a human being and should not say anything you would not wish said about you in polite company. Thank you. KF


Quote
My aplogies kairosfocus, I lost my focus yesterday


A dim, obnoxious toady groveling in front of a hypocritical, sanctimonious windbag.  Lovely.

--------------
And the set of natural numbers is also the set that starts at 0 and goes to the largest number.  -- Joe G

Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there. -- KF

  
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 15 2012,15:40   

Quote (keiths @ Oct. 15 2012,15:36)
The KF-Joe "scold and grovel" dynamic:
Quote
Joe: Remember, I cannot spend a lot of time policing and cleaning up threads. Kindly, restrain yourself. Namecalling and personal attacks are patently counter-productive: answer a fool according to his folly, and you will be as him, down in the mud of a fever swamp wrestling amidst the filth, where he can probably beat you on experience. Yes, I can see where a well warranted negative conclusion where someone has gone to the point where his/her behaviour goes to character is appropriate; but even in those cases, remember you are dealing with a human being and should not say anything you would not wish said about you in polite company. Thank you. KF


Quote
My aplogies kairosfocus, I lost my focus yesterday


A dim, obnoxious toady groveling in front of a hypocritical, sanctimonious windbag.  Lovely.

KF must love Joe.  He could have said "Shut the Fuck Up!"*

* Of course, KF would have said it in 30,000 words, with numerous links to naked ladies and Sam Jackson.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Freddie



Posts: 365
Joined: Oct. 2009

(Permalink) Posted: Oct. 15 2012,15:52   

Quote (OgreMkV @ Oct. 15 2012,15:40)
   
Quote (keiths @ Oct. 15 2012,15:36)
The KF-Joe "scold and grovel" dynamic:
     
Quote
Joe: Remember, I cannot spend a lot of time policing and cleaning up threads. Kindly, restrain yourself. Namecalling and personal attacks are patently counter-productive: answer a fool according to his folly, and you will be as him, down in the mud of a fever swamp wrestling amidst the filth, where he can probably beat you on experience. Yes, I can see where a well warranted negative conclusion where someone has gone to the point where his/her behaviour goes to character is appropriate; but even in those cases, remember you are dealing with a human being and should not say anything you would not wish said about you in polite company. Thank you. KF


     
Quote
My aplogies kairosfocus, I lost my focus yesterday


A dim, obnoxious toady groveling in front of a hypocritical, sanctimonious windbag.  Lovely.

KF must love Joe.  He could have said "Shut the Fuck Up!"*

* Of course, KF would have said it in 30,000 words, with numerous links to naked ladies and Sam Jackson.


KF (Two posts earlier in the same thread):
   
Quote
Here Toronto is being willfully misleading, hoping to profit by his misrepresentation being perceived as truth.

 
Quote
So, Toronto is being irresponsible and distractive.

Sadly, no surprise.


--------------
Joe: Most criticisims of ID stem from ignorance and jealousy.
Joe: As for the authors of the books in the Bible, well the OT was authored by Moses and the NT was authored by various people.
Byers: The eskimo would not need hairy hair growth as hair, I say, is for keeping people dry. Not warm.

  
Erasmus, FCD



Posts: 6349
Joined: June 2007

(Permalink) Posted: Oct. 15 2012,15:53   

Quote (keiths @ Oct. 15 2012,16:36)
The KF-Joe "scold and grovel" dynamic:
Quote
Joe: Remember, I cannot spend a lot of time policing and cleaning up threads. Kindly, restrain yourself. Namecalling and personal attacks are patently counter-productive: answer a fool according to his folly, and you will be as him, down in the mud of a fever swamp wrestling amidst the filth, where he can probably beat you on experience. Yes, I can see where a well warranted negative conclusion where someone has gone to the point where his/her behaviour goes to character is appropriate; but even in those cases, remember you are dealing with a human being and should not say anything you would not wish said about you in polite company. Thank you. KF


Quote
My aplogies kairosfocus, I lost my focus yesterday


A dim, obnoxious toady groveling in front of a hypocritical, sanctimonious windbag.  Lovely.



i am sure that they meat in real life

--------------
You're obviously illiterate as hell. Peach, bro.-FtK

Finding something hard to believe based on the evidence, is science.-JoeG

the odds of getting some loathsome taint are low-- Gordon E Mullings Manjack Heights Montserrat

I work on molecular systems with pathway charts and such.-Giggles

  
keiths



Posts: 2040
Joined: Jan. 2006

(Permalink) Posted: Oct. 15 2012,16:47   

Incipient tard fight:

Quote (Mung @ October 15 2012, 10:52 am)
Hey Joe,

Want me to write a program for you that generates insults?

Yours are getting kind of stale.


--------------
And the set of natural numbers is also the set that starts at 0 and goes to the largest number.  -- Joe G

Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there. -- KF

  
k.e..



Posts: 2835
Joined: May 2007

(Permalink) Posted: Oct. 16 2012,07:23   

Quote (OgreMkV @ Oct. 15 2012,19:14)
It took me about 3 minutes to hit up Wikipedia, find "additive function" and understand why Oleg's function that he asked Joe about wasn't additive.

Here's a hint Joe: An additive function doesn't mean that you add a number to another number.

You see, much like Biology, Chemistry and everything else, mathematics has some very specific definitions. They use words in ways that may be counter-intuitive.  That means, your 'common sense' understanding of the terms is wrong.  

You know, things like 'mol' and 'design' and 'super set'.

You really ought to learn what the words actually mean before trying to discuss them.  I'll give you another hint.  If you're using a word, in a particular context, then it's not us who have to use your definition.  We're not wrong because we use the word correctly.

Come on Joe, tell all about mols again.

BTW: Are you busy writing that letter to Behe to tell him that ID is a mechanism.  I hope you have the mechanism handy (here's a hint, a blueprint for a building is not a mechanism for constructing the building).

Or maybe you're writing a response to gpuccio about how he's wrong because ID can (try to) distinguish between random and non-random... after you told me that wasn't even required for ID.

It makes one almost think that you don't even understand ID... or that ID has too many definitions.  Either way, your side is pretty much screwed.

....erm ......you know his mouth has an IQ of maybe 90 but his brain's around 70?

If you are trying to teach him that solid water is the same as liquid water except for the enery level, you might be on a loser there.

If you explain it in terms of cooking he might get it.

e.g. Hey Joe, you're lower than a snakes vagina in a wagon rut. (That should get his attention)

Listen up kitchen boy. I think he speaks spanish so could try Pinche gringo culero ve a chingar a tu reputisima madre!

Ok Joe, we are now going to see how much information is in a cake.

Take one egg.
Add it to a bowl.
Add some flour,
Add butter,
Add sugar and
Add another egg.

Got that?

Good, because that's addition.

Now fuck off.

--------------
"I get a strong breeze from my monitor every time k.e. puts on his clown DaveTard suit" dogdidit
"Abbie Smith (ERV) who's got to be the most obnoxious arrogant snot I've ever seen except for when I look in a mirror" DAVE TARD
"ID is deader than Lenny Flanks granmaws dildo batteries" Erasmus

  
k.e..



Posts: 2835
Joined: May 2007

(Permalink) Posted: Oct. 16 2012,07:46   

Quote (keiths @ Oct. 16 2012,00:47)
Incipient tard fight:

Quote (Mung @ October 15 2012, 10:52 am)
Hey Joe,

Want me to write a program for you that generates insults?

Yours are getting kind of stale.

Quick send Mung a memo:=: Shut the fuck up fucker.

Remember the old saying

sic gorgiamus allos subjectatos nunc

--------------
"I get a strong breeze from my monitor every time k.e. puts on his clown DaveTard suit" dogdidit
"Abbie Smith (ERV) who's got to be the most obnoxious arrogant snot I've ever seen except for when I look in a mirror" DAVE TARD
"ID is deader than Lenny Flanks granmaws dildo batteries" Erasmus

  
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 16 2012,09:43   

Hey Joe.

I just happened to be looking for something else and found these comments from early 2010.

Quote
Hey Joe,

I gave you an example of evidence for Evolution.

Now I would like to see your evidence for ID.  I would like to see you use CSI or EF to explain what we see in biological organisms.

Thanks in advance (link)


and

Quote

Quote
(Mindrover @ April 04 2010,08:18)
Quote
(Joe G @ April 03 2010,08:04)
1-The definition I provided is an example of specified information.

2-I then measured the information contained in that definition.

3- It was an EXAMPLE of how to measure SI to see if CSI is present.

Granting that SI can be measured, how much SI is required for CSI to be present?
Does CSI = Designed?

These are honest questions, I would hope for an answer devoid of invectives.

To add to Mindrover's post, as he's granting that CSI is measuring "information", I'd like to know what is actually being measured?

Joe, could you define or tell what type of information is being measured by CSI?

Can different methods show different degrees or types of information?


It's been almost 30 months since these questions have come up Joe and you have yet to answer them or actually explain this.

Two years of "you're too stupid" and "you're an asshole" without a single attempt to explain your own position.  Now who does that remind you of?

Oh yeah, it's what you CLAIM we do.

So, the question now is, are you just a hypocrite or are do you actually not have a clue what you're talking about?

Careful, that's a trick question.  (Hint: It's both)

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 16 2012,13:42   

Quote (OgreMkV @ Mar. 07 2012,17:15)
Hmm.. interesting.. so, Joe, before the knowledge of stall speed and wing vortexes... bees really couldn't fly?  

The laws ARE Joe.  We don't have to know how they work to make use of them.  No one knows exactly how mass warps spacetime to create what we call gravity.  As has been stated several times, that doesn't stop anyone from using the known principles of gravity to determine a result.

Speaking of which, hey Joe.  has anyone ever used a principle of ID to determine a result (other than 'it looks designed').

Since you have absolutely failed chemistry and brought up the concept of "information", I guess it's time to begin the test.  Are you ready.  This is going to be so much fun.

Joe, here are two DNA sequences.  Since I know how big you are on context, I'll tell you a little bit about them.  Both of the sequences are exactly the same length.  Indeed, except for the bolded nucleotide, they are exactly the same.  Both produce a protein that is required for humans to live.  Both produce a slightly different form of that protein, but a person with either one will live a long live (all other things being equal... this protein won't prevent you from tearing you anus and bleeding to death while kicking yourself in the ass).

What I'd like is you to use some principles of ID to tell me something about these two sequences.  Which came first?  Which is more functional, etc.

However, because we both know that you will never do this.  What I'd like you to do is define information and then tell us which sequence has more information.  You get to pick which kind of information we talk about.  We just need a definition so that we're all on the same page.

So, define information and which one has more information.

Sequence the first:
ATG GTG GAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
GAG AAC TTC AGG GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA
TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA
GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT
GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT
CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA
TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA
ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA

Sequence the second

ATG GTG GAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
GAG AAC TTC AGG GTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA
TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA
GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT
GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT
CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA
TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA
ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA

Feel free to compare them using grep (you do know what grep is right?)

BTW: While we're talking about it.  I would like to remind you that using the known laws of science...

There is NOTHING that would prevent life from arising from non-live.  Believe me, I've studied this for years.  There's a lot of exciting research coming out.  Not only is it possible, it is likely to have happened via multiple pathways.

Again, this is how science works.  You make a claim, you support it.

My claim is that there is nothing in the laws of the universe that would prevent life coming from non-life.  So far, 50 years of research and thousands of scientific papers support my views.

Your claim is that it is impossible.  However, your requirements are hypocritical in that you demand stuff from science that you don't demand from your own notions.  Again, you are making the claim that thousands of experiments are wrong.  You support it.

All it takes is one experiment to prove me wrong, yet it hasn't ever happened yet.  Why don't you learn what a mole is, get a degree in chemistry, and then do the experimental world to prove me wrong.

Oh that's right, your too scared it will alter your world view.  You aren't interested in science, you are just interested in playing internet tough guy.

I fully expect you to run away from this challenge too.

Just out of curiosity Joe, you've had this to work on for about 6 months now.  Any progress?

Just tell us ANYTHING about what ID says about these two (human) DNA sequences and how you determined it.  

Anything at all
1) Which came first?
2) Which contains more information?
3) Which one was designed?
4) Which one is a mutated version of the other one?
5) Which one has the greatest survival advantage?

Careful, there are more trick questions in there... (snicker)

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 3260
Joined: Oct. 2009

(Permalink) Posted: Oct. 16 2012,17:35   

here you go JoeG, everything you always wanted for evolution.

Quote
"We were particularly excited about the actualization stage," Blount said. "The actual mutation involved is quite complex. It re-arranged part of the bacteria's DNA, making a new regulatory module that had not existed before. This new module causes the production of a protein that allows the bacteria to bring citrate into the cell when oxygen is present. That is a new trick for E. coli." The change was far from normal, Lenski said. "It wasn't a typical mutation at all, where just one base-pair, one letter, in the genome is changed," he said. "Instead, part of the genome was copied so that two chunks of DNA were stitched together in a new way. One chunk encoded a protein to get citrate into the cell, and the other chunk caused that protein to be expressed."

Read more at: http://phys.org/news....e> id='postcolor'>

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Woodbine



Posts: 738
Joined: June 2007

(Permalink) Posted: Oct. 17 2012,05:00   

So you thought Joe couldn't possibly believe in anything more stupid than ID, Nazca alien runways and drinking bleach?

Oh ye of little TARD....


  
Freddie



Posts: 365
Joined: Oct. 2009

(Permalink) Posted: Oct. 17 2012,06:15   

Quote (Woodbine @ Oct. 17 2012,05:00)
So you thought Joe couldn't possibly believe in anything more stupid than ID, Nazca alien runways and drinking bleach?

Oh ye of little TARD....


It's all just water at the end of the day, unless you freeze it of course :-)

--------------
Joe: Most criticisims of ID stem from ignorance and jealousy.
Joe: As for the authors of the books in the Bible, well the OT was authored by Moses and the NT was authored by various people.
Byers: The eskimo would not need hairy hair growth as hair, I say, is for keeping people dry. Not warm.

  
  7454 replies since Feb. 24 2010,12:00 < Next Oldest | Next Newest >  

Pages: (249) < ... 170 171 172 173 174 [175] 176 177 178 179 180 ... >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]