RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (5) < 1 2 [3] 4 5 >   
  Topic: Creating CSI with NS, H T T H H H T H T T H H H H T T T< Next Oldest | Next Newest >  
Cubist



Posts: 275
Joined: Oct. 2007

(Permalink) Posted: Nov. 20 2012,09:15   

Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

  
Jim_Wynne



Posts: 715
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,09:38   

Quote (Cubist @ Nov. 20 2012,09:15)
Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

This one's easy.  If it's not *obvious* that something is complex and specified, it's obviously *not* complex and specified.  And Modern ID Theorists don't need to calculate things that are obvious and easy to see for anyone not wearing the blinders of hidebound methological naturalism and goo-to-zoo-to-you "science."  Any fool can figure that out, so maybe you'd just better learn a little about Modern ID Theory® before you make a fool of yourself.  :angry:

--------------
Evolution is not about laws but about randomness on happanchance.--Robert Byers, at PT

  
OgreMkV



Posts: 2987
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,09:49   

Quote (Jim_Wynne @ Nov. 20 2012,09:38)
This one's easy.  If it's not *obvious* that something is complex and specified, it's obviously *not* complex and specified.  And Modern ID Theorists don't need to calculate things that are obvious and easy to see for anyone not wearing the blinders of hidebound methological naturalism and goo-to-zoo-to-you "science."  Any fool can figure that out, so maybe you'd just better learn a little about Modern ID Theory® before you make a fool of yourself.  :angry:

DI : 7.0
AIG: 5.5
UD: 9.5

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
rossum



Posts: 151
Joined: Dec. 2008

(Permalink) Posted: Nov. 20 2012,09:56   

Quote (Cubist @ Nov. 20 2012,09:15)
So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

That is a very significant thing to do.  The NSA/GCHQ would be very interested in a distinguisher like that, which could tell the difference between an encoded message and junk.  It defeats one of the obvious ways to block traffic analysis -- just fill up the comm link with junk when it is not being used, so it always appears to be running at the same capacity.

The first attack against a cypher is often a distinguisher, that is a way to tell the output of the cypher from true random.  One of the attacks against the RC4 keystream (due to Mantin and Shamir) showed that the second byte of the keystream was 0x00 with a frequency of 1/128 instead of the expected 1/256.  Obviously that attack only works for RC4 and not for other cyphers.  What the Discovery Institute claims to have is a general distinguisher, valid for all current and future cyphers.  Hence they are in effect claiming to have a way to attack any cypher whatsoever.

If CSI really is such a distinguisher, then the Discovery Institute is being very unpatriotic in not offering it to the NSA immediately.

--------------
The ultimate truth is that there is no ultimate truth.

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:02   

Quote (OgreMkV @ Nov. 19 2012,18:29)
Quote (Jerry Don Bauer @ Nov. 19 2012,17:35)
OK.  If I am ignorant on the subject, it's because every creationist I've ever talked to has been utterly unable to explain or teach the concept.

Since any organism is over 500 bits... let's try this.

5093413647
5962916509
4066005562
8540770698
8342922442
0194220209
7331543188
7173101712
5811761471
3261216342
2525310538
4613627960
9767559584
8786679179
7022618236
5134707276
1505272783
6020313600
8013081724
2444671310
5268821392
0881048845
1181910939
0754282725
9802869949
3733118584
7969279971
8150134026
7987778049
5178595812
2668421641
8163467125
0645780953
5684243267
1401437548
9391680033
7856973231
7145812146
8632651141
7699167635
0557559516
8611985974
7805273622
9849541633
3279510329
7149754142
7096458973
6301485923
1880042518
4930165865


Is this CSI?  Yes/No  Why?

Ok, I wasn't being rude and you are not taking it that way...Good.

But are the numbers you posted CSI? No. Unless I'm missing something.....How are they even specified information at all?

Of course, I don't know what they represent but they just seem like a random listing of numbers to me at this point.

Have you read any of my or Dembski's writings using an archer to define specificity and calculating it?

It would seem germain to the subject should you want to learn that.

Interesting.  Because if you had the correct algorithm you would find these number to be very, very specific.

In other words, you can't use CSI to tell the difference between a random series of numbers and a series of non-random numbers.

So, what's the point in CSI?  It doesn't mean anything.  It doesn't tell us anything unique or useful about the real world.  

You do realize that any amino acid chain longer than 250 AAs is, by your definition "CSI" and therefore requiring intelligence. Do you realize that AA chains of nearly that length have been developed in the lab using the random attachments that you deplore as not being capable of forming CSI.

While we're at it, can you explain the 500 bit limit?[/quote]
Let's start over with some VERY basic premises........

Here is a number: 53739901284746603....is it CSI?

NO!

It's just a number that doesn't represent anything at all...I just made it up so how is it even information? Information communicates something to the observer.

Numbers in themselves aren't information.....one would have to know what the numbers are calculating....what do they represent? Then one can begin to make sense of it all.

the number 10 doesn't really mean anything...10 what? 10 pebbles, 10 planets, 10 good looking ladies, 10 drinks I had of my favorite whiskey last night? I have to know for 10 to mean anything to me as these "number 10s" have quite different meanings as I process information about them.

So let's start with numbers representing things. I have a pile of 2 pebbles, another pile of 10 pebbles and another pile of 100 pebbles....so how big a pile of pebbles would I have to have before I can calculate CSI?

Well, it might be argued that the bigger piles are more complex because, if we are viewing a pebble as information, 100 bits of information is certainly larger than one one bit and the whole of the parts seem more complex than the sum of one unit that comprise them.

But the truth is, it doesn't matter if I accumulate a billion pebbles in a pile, even if that pile might, by sheer volume be more complex, there is no specificity involved with the pile, therefore a pile of pebbles can never be CSI.

So is a simple pebble information?

Yes. I can be walking down a path, see some pebble laying in it and record in my mind that there are pebbles present. In fact, all matter is information, energy is information because it is also matter.....Einstein taught us that E=MC^2, therefore E=M=I.

But it is specificity and the intelligence it involves that CSI hinges on.......So, let's look at specificity, how it calculates out and how intelligence comes into play with that concept.

I have an archer. I blindfold him and place him in the middle of a huge stadium and tell him to shoot an arrow into the wall. He draws an arrow and plugs it into the wall quite handily.

Am I surprised? Of course not. The wall is so large, it surrounds him, I would be surprised if he DIDN'T hit the wall.

Now I paint the wall into a checkerboard with black and white squares and tell him to hit a black square. Now his odds go down in accomplishing this.

In fact, there is a 50% chance he will and a 50% chance he won't. But he does. I'm still not surprised any more than I would be if I flipped a coin and it comes up heads.

Then I paint the checkboard into 4 colors, then 8, then 16....but wait a minute, the archer is STILL hitting the color I tell him to? The odds of him doing so are becoming so high against him doing it that I'm beginning to suspect something here.

So, on the enormous wall of that giant stadium, I draw a little one inch circle, spin the archer around a few times and tell him to try to hit the tiny circle. He nails it dead center.

OK, only an idiot whould not begin to suspect that intelligence is involved here. Maybe he can see through the blindfold, maybe someone has a walkie talkie and he has a tiny receiver in his ear......Maybe he has ESP..SOMETHING..I don't know....but the odds are so low of him hitting that circle that, if he does, intelligence HAS to be involved somewhere in there.

In fact, once those odds get to be more than 1:10^150 against him (the UPB is reached) it becomes mathematically impossible that he will accomplish the task without intelligence somewhere in there.

So, can you also see how specificity is calculated? With one color he had a 1:1 chance, with 2 a 1:2 chance, with 16 colors a 1:16 chance etc. all the way up to 1:10^150 where he would have no chance at all.

Another post will follow to clarify more.....thanks for your interest

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:12   

So, and I'm not sure why, but there are those on here repeatedly requesting that I calculate the CSI of an organism as if that is some big deal.

In fact, many, including myself have accomplished this many times.

Here is an excerpt from some of my writings in that area doing exactly that:

If I flip a coin what are the odds of me getting heads or tails? 1:2. If I flip 50 coins and I get 25 heads and 25 tails, what are the odds when I flip that 51st coin that I will receive head or tails? 1:2. If I have flipped 99 coins and 47 have come up heads and 52 have come up tails, what are the odds for heads or tails in that 100th coin? 1:2.

Well what are the odds if I flip 100 coins they all will come up heads? 1:(.5^100). But what if I have already flipped 50 of the coins and 25 of them are tails and 25 of them are heads. Now what are the odds that all 100 coins will come up heads? They’re still the same 1:(.5^100). I’m not getting all heads, but with odds against me of getting them, I’m not surprised at the result.

So let’s place all 100 coins in a bag, shake them up all at once and see how many heads I get. What are these odds? 1:(.5^100). So it doesn’t really matter if I flip the coins all at once (a ‘poof’ as in spontaneous generation) or I flip them one at a time (individual, incremental steps), the odds in the big picture do not change.

Of course, chemical reactions are not coins and this happens a bit different in the real world.

For two atoms to “bond” (join together into a molecule) they must be within an “interacting neighborhood.” In fact, in order for two atoms to react together, they must be in the area of about 100 picometers (10 to the -10 power meters) in distance from one another.

The universe is big. And atoms must be moving in order to come into the “neighborhood” of another atom. The faster they are moving, the more opportunities they have to form a bond.

But this gets a little hairy because if they are moving too fast, the momentum will shoot them past each other before they can bond.

And, the temperature can‘t be too cold as reactions will not effectively occur and if it is too hot more bonds will be broken than are formed, and even when the temperatures are perfect, “bonds” of a long molecular chain may be broken simply because a random high energy atom or molecule knocks it loose. The point is, there is a certain finite number of opportunities available, even in 50 billion years for a reaction to occur in reality

For these reasons, Brewster and Morris concluded, based upon the size of the universe, the temperatures under which bonding occurs, the surmised age of the universe, the nature of bonds and how they form and break-- that 10 to the 67th power is the ultimate upper threshold for any chemical event to happen--anytime, anywhere in the universe, even in 50 billion years.

Dembski defines a universal probability bound of 10^-150, based on an estimate of the total number of processes that could have occurred in the universe since its beginning. Estimating the total number of particles in the universe at 10^80, the number of physical state transitions a particle can make at 10^45 per second (Planck time, the smallest physically meaningful unit of time) and the age of the universe at 10^25 seconds, thus the total number of processes involving at least one elementary particle is at most 1:10^150. Anything with a probability of less than 10^150 is unlikely to have occurred by chance. Previous to Dembski, statisticians concluded through Borel’s Law that 1:10^50 was the upper limit odds in which anything could actually happen.

The smallest known bacteria I’m aware of consists of around 500 proteins but I don’t think anyone would disagree with me that I am safe in using a 100 protein scenario in order to form an organism that could remotely be called life.

Proteins from which all of life is based are formed from amino acids. And these proteins are usually chains of from 50 to 50,000 amino acids.

Chemist, Stanley Miller showed long ago that under the correct conditions we can create amino acids in a beaker.

A chirality problem exists in that they come out completely “racemized.” The amino acids produced by Miller consisted of equal amounts of “right-handed” and “left-handed” molecules. The atoms that react to form amino acids bond together into cork-screw shapes--these cork-screws can curve to the right (right-handed) or to the left (left-handed). But a useable protein for life has to be composed entirely of left-handed molecules.

So, when an amino acid adds itself to a protein chain, the odds are one in two that it will be left-handed. That’s not a big deal if the protein chain is extremely short--say three amino acids long. Our probability would be one chance in 2 to the 3rd power or 1:8. That’s not bad odds for this type of thing.

So, let’s look at this primeval ooze from which that first protist popped and we are going to surmise that this ooze was racemized amino acids that had occurred naturally.

The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.

Well shoot, we are already past the Borel’s Law barrier with one tiny protein and we are nowhere near our organism. It would only take one more to catch up with Dembski’s UPB.

And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Now we can see why some Idists calculate that the odds against a fully functioning, much more complex human cell occurring by chance is one chance in 10 to the 100 billionth power. That’s one hundred billion zeroes. Us computer geeks can think of it as a 100 gigabyte hard drive full of nothing but zeroes.

And whether or not this cell forms one step at a time, or all at once, these odds don’t change.

Enjoy, my new friends.... :)

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Nov. 20 2012,10:13   

Quote
In fact, once those odds get to be more than 1:10^150 against him (the UPB is reached) it becomes mathematically impossible that he will accomplish the task without intelligence somewhere in there.

Relate this in a meaningful way to biology then.

As that's what ID is all about, biology and how it had a designer.

So how do you get from UPB  to life was designed?

HINT: No biologist (Darwinst or otherwise) claims that cells/proteins all assembled "all at once" in their current form.

The chances of that, all are already agreed, are well beyond the UPB.

Yet that's going to be your claim, that a protein used in biology must have been designed because the chances of finding that protein in protein possibility space is too low.

Yet nobody makes that claim. It's a strawman that people like you create in order to knock down to fool the credulous into believing that what you are doing is science.

It's just bad math is all. Nothing to do with biology at all.

So, go on, get from "UPB" to "life is designed" without invoking the "tornado in a junkyard" strawman.

Bet you can't. You and yours have never been able to understand the claims of modern biology. It's like you are a stuck record, stuck back when YEC was not quite the dodo it is now.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:16   

I'm sorry, post before last did not post correctly and I see no way to edit it. My reply starts about 6 pararaphs into where you THINK it starts.

  
OgreMkV



Posts: 2987
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,10:17   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
In fact, many, including myself have accomplished this many times.

Link to it.

Even a PDF that shows your work.

I bet you can't.  In fact, I KNOW that you can't.

Let me go farther.  You've never calculated the CSI of anything.

I've asked you several times now and you can't even tell me the basic process, much a process sufficiently robust that any person, anywhere in the world, could do the same thing and get the same result.

You can't even tell me what units CSI is measured in.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Nov. 20 2012,10:24   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

Bingo! Exactly as I predicted.

Your understanding of biology is woeful.

Your point is only valid if you assume that these proteins formed all at once.

What evidence do you have that is in fact the case?

Quote
So, and I'm not sure why, but there are those on here repeatedly requesting that I calculate the CSI of an organism as if that is some big deal.


Yet there is no list that says

Organism A has X CSI.
Organism B has Y CSI.

Is there?

I wonder why.....

Quote
In fact, many, including myself have accomplished this many times.

So where is the list?
Quote
The smallest known bacteria I’m aware of consists of around 500 proteins but I don’t think anyone would disagree with me that I am safe in using a 100 protein scenario in order to form an organism that could remotely be called life.

Your assumption that the first self-replicator resembled bacteria is unwarranted.

Unless, of course, you were there?

On what basis do you make this claim?
Quote
The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.


Tell me, what biological process is this related to? When you say "assemble" what biological process is it that you refer to?

When you say "usable" what do you mean? Usable for what? If I have two proteins that differ only slightly is one more "usable" then the other? What for?
Quote
Well shoot, we are already past the Borel’s Law barrier with one tiny protein and we are nowhere near our organism. It would only take one more to catch up with Dembski’s UPB.


This is not a problem, the problem is that your examples are not related to biology. Biology does not "assemble" 50,000 chained amino acids all in one go.
Quote
To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Yes, and nobody disagrees with you. You are quite right. But at the same time you are "not even wrong".

This organism will "never form" by all it's component pieces coming together all at once. What biologist is actually making the claim this is how life originated?

You are simply ignorant about the claims of modern biology  and I know this from a simple fact. You won't respond by relating your "The odds of assembling a protein that long are 1:10^15,000" example to actual biology.

Anyway, your IDiocy has been refuted in many places many times already. Nobody is fooled. In fact we're laughing at you.
Quote
When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Yet you have no problem "in reality" with a designer that hangs around for billions of years and behaves exactly as one would expect evolution to.

If the odds against a simplistic organism forming are 1:10^7400 then what are the odds of a designer forming that could create that organism? They must be higher? Yet that's what you believe happened!

LOL!

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:24   

You guys need to take a breather and read the posts...lol....everything you accuse me of NOT doing is right there in black and white...no need to link to anything, I posted it for you directly.....now, you need to directly attack the math I just threw your way...*wink*

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:32   

Quote (Cubist @ Nov. 20 2012,09:15)
Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

Hey Cubist:

It's correct...random garbage is not CSI...CSI must communicate.....

Language is not REALLY germain to CSI either unless we are somehow relating language to matter/energy....

And yes, we can distinguish meaningful information from garbage by honing into it's specificity....No specificity....no CSI...

The rest of that post pretty much shows a lack of understanding of the CSI concept......But you admit that up front and it's OK as I'm used to it......This will hopefully become clearer as we progress.

  
OgreMkV



Posts: 2987
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,10:33   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:02)
Quote
Interesting.  Because if you had the correct algorithm you would find these number to be very, very specific.

In other words, you can't use CSI to tell the difference between a random series of numbers and a series of non-random numbers.

So, what's the point in CSI?  It doesn't mean anything.  It doesn't tell us anything unique or useful about the real world.  

You do realize that any amino acid chain longer than 250 AAs is, by your definition "CSI" and therefore requiring intelligence. Do you realize that AA chains of nearly that length have been developed in the lab using the random attachments that you deplore as not being capable of forming CSI.

While we're at it, can you explain the 500 bit limit?

Let's start over with some VERY basic premises........

Here is a number: 53739901284746603....is it CSI?

NO!

It's just a number that doesn't represent anything at all...I just made it up so how is it even information? Information communicates something to the observer.


You are confusing the "meaning" of the information with the "information" itself.  This is a fundamental mistake.

If you are only interested in the meaning of the information, then none of the mathematical treatments used for information can apply.  Why?

Let's look at a common phrase.

"The quick brown fox jumped over the lazy dog."

This is a highly complex sequence and, informationally speaking, it is difficult to compress because there are few repeated letters.  But in French...

"Le rapide goupil brun sauta par dessus le chien paresseux."

You see that the phrase is much longer and also contains many more repeated letters.  This is easier to compress than the English version.

Do these two versions have the same AMOUNT of CSI?  Yes/No... why?

Quote

Numbers in themselves aren't information.....one would have to know what the numbers are calculating....what do they represent? Then one can begin to make sense of it all.


Wrong.  This is the basic premise of cryptology.  You can perform informational functions on random numbers, pseudo-random numbers, and non-random numbers.

However, you can't extract meaning from random numbers.  You cannot extract meaning from pseudo-random numbers without additional information.

This continues to show that you don't even know what information you're talking about.

Quote

the number 10 doesn't really mean anything...10 what? 10 pebbles, 10 planets, 10 good looking ladies, 10 drinks I had of my favorite whiskey last night? I have to know for 10 to mean anything to me as these "number 10s" have quite different meanings as I process information about them.

So let's start with numbers representing things. I have a pile of 2 pebbles, another pile of 10 pebbles and another pile of 100 pebbles....so how big a pile of pebbles would I have to have before I can calculate CSI?


Let's say you have 1 pebble of feldspar.  Can you calculate the CSI of that highly ordered, very complex, and very, very specific mineral?

I bet you can't.

Quote

Well, it might be argued that the bigger piles are more complex because, if we are viewing a pebble as information, 100 bits of information is certainly larger than one one bit and the whole of the parts seem more complex than the sum of one unit that comprise them.

But the truth is, it doesn't matter if I accumulate a billion pebbles in a pile, even if that pile might, by sheer volume be more complex, there is no specificity involved with the pile, therefore a pile of pebbles can never be CSI.

So is a simple pebble information?

Yes. I can be walking down a path, see some pebble laying in it and record in my mind that there are pebbles present. In fact, all matter is information, energy is information because it is also matter.....Einstein taught us that E=MC^2, therefore E=M=I.

But it is specificity and the intelligence it involves that CSI hinges on.......So, let's look at specificity, how it calculates out and how intelligence comes into play with that concept.


Man, this is just babbling.

CSI is evidence of intelligence because CSI requires intelligence.

Do the words "circular reasoning" have any meaning for you or is just information?

Quote

I have an archer. I blindfold him and place him in the middle of a huge stadium and tell him to shoot an arrow into the wall. He draws an arrow and plugs it into the wall quite handily.

Am I surprised? Of course not. The wall is so large, it surrounds him, I would be surprised if he DIDN'T hit the wall.

Now I paint the wall into a checkerboard with black and white squares and tell him to hit a black square. Now his odds go down in accomplishing this.

In fact, there is a 50% chance he will and a 50% chance he won't. But he does. I'm still not surprised any more than I would be if I flipped a coin and it comes up heads.

Then I paint the checkboard into 4 colors, then 8, then 16....but wait a minute, the archer is STILL hitting the color I tell him to? The odds of him doing so are becoming so high against him doing it that I'm beginning to suspect something here.

So, on the enormous wall of that giant stadium, I draw a little one inch circle, spin the archer around a few times and tell him to try to hit the tiny circle. He nails it dead center.

OK, only an idiot whould not begin to suspect that intelligence is involved here.


Nice analogy, utterly meaningless.  I bet I could come up with a similar analogy that doesn't use any intelligence to pick out a single 1 cm^2 area inside the area of a football field... even an area within a football field filled with noise (in the information sense of the word, not the sound sense of the word).  And no intelligence required.

Want to bet that I can?

Quote

Maybe he can see through the blindfold, maybe someone has a walkie talkie and he has a tiny receiver in his ear......Maybe he has ESP..SOMETHING..I don't know....but the odds are so low of him hitting that circle that, if he does, intelligence HAS to be involved somewhere in there.


Saying it again and again doesn't make it true.  

There is no evidence here.  None.  Just claims of the incredulous.

Quote

In fact, once those odds get to be more than 1:10^150 against him (the UPB is reached) it becomes mathematically impossible that he will accomplish the task without intelligence somewhere in there.


Again, you are mistaken.  Because, again, within the entire universe the odds of a oxygen atom reacted with two specific hydrogens is way higher than your UPB.  However, the odds of an oxygen atom reacting with any two hydrogens approaches unity.

You are making a logical fallacy here.

Quote

So, can you also see how specificity is calculated? With one color he had a 1:1 chance, with 2 a 1:2 chance, with 16 colors a 1:16 chance etc. all the way up to 1:10^150 where he would have no chance at all.

Another post will follow to clarify more.....thanks for your interest

Here's the problem.

The protein for human hemoglobin, alpha 1 is about 30 kilobytes long.  Way beyond the UPB.

However, no biologist, no scientist thinks that human hemoglobin, alpha 1 just appeared, by chance.

If there were only two options (chance and intelligent design), then I think we could concede that something else was involved.

But there's not two options is there?  There's a third option, which you dismiss out of hand with no evidence.  That is evolution: common descent, selection, mutation.

Actually, there are only two options, but not the ones you think.  The only two options are chance and evolution.  Because there is no evidence that an intelligent designer even exists, much less is actually capable of performing actions claimed for him.

So, again, you have several logical fallacies in your statement here.  You have several fundamental errors in both fact and reasoning.  And you can't actually do the things you claim to do (and claim to have done).

edit to fix quotes

Edited by OgreMkV on Nov. 20 2012,10:36

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 2987
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,10:48   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:24)
You guys need to take a breather and read the posts...lol....everything you accuse me of NOT doing is right there in black and white...no need to link to anything, I posted it for you directly.....now, you need to directly attack the math I just threw your way...*wink*

What do you need to calculate the CSI of an organism?

It's entire genome?
It's entire genome + associated memories and learned skills?
Every protein sequence that it needed to build the organism?

Since those big numbers are too scary for you, how about this?

Here's a gene sequence, what's the CSI for it?

5' CCTGGGTCACUAUAGGAAGAACACACUAUAGUGACCCAGGAAAAGACAAAUCUGCCCUUAGAGCUUGAGAACAUCUUCGGAUGCACGGGA
GGCAGCUCGCGAUGGAAGUAACGGACCCAGCGUUCUCAACAGUGUUCACAGAACCUUAAUGC 3'

What is the CSI? and was this therefore designed?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jim_Wynne



Posts: 715
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,10:57   

I'm really, really excited because I've just seen solid evidence of the occurence of a miracle!!  

I picked up a deck of cards and browsed through it, and realized that there is only a 1:8.06582E+67 chance that the cards could be in that particular order.  

PRAISE JEBUS!!!!

--------------
Evolution is not about laws but about randomness on happanchance.--Robert Byers, at PT

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:07   

Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

If you don't grasp what the term means in its most simplistic usage, there will be way to discuss the subject intelligently.

Where is the specificity in a random number, or a random sequence of nucleotides or the random order of a deck of cards?

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

Are there ANY on here who have ever actually studied the concept and rejected it out of science, math and logic rather than just poo-poo it because it makes them insecure in their religious beliefs?

I hope I haven't entered a cult hang-out here...*wink*

  
Robin



Posts: 1361
Joined: Sep. 2009

(Permalink) Posted: Nov. 20 2012,11:14   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

--------------
we IDists rule in design for the flagellum and cilium largely because they do look designed.  Bilbo

The only reason you reject Thor is because, like a cushion, you bear the imprint of the biggest arse that sat on you. Louis

  
OgreMkV



Posts: 2987
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,11:14   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

If you don't grasp what the term means in its most simplistic usage, there will be way to discuss the subject intelligently.

Where is the specificity in a random number, or a random sequence of nucleotides or the random order of a deck of cards?

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

Are there ANY on here who have ever actually studied the concept and rejected it out of science, math and logic rather than just poo-poo it because it makes them insecure in their religious beliefs?

I hope I haven't entered a cult hang-out here...*wink*

Funny, all I see is someone who makes lots of claims, yet can't actually do the things he claims.  

I see someone who has had numerous logical, mathematical, and content errors pointed out to them.  I see that person refusing to even acknowledge those errors, much less try to understand and correct them.

I see someone who very well may understand CSI, but cannot explain the concept clearly and then blames others for his inability to teach.

Guess what, Jerry.  They are all you.

I predict a flounce pretty soon...

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:26   

Quote (Robin @ Nov. 20 2012,11:14)
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:28   

Quote (Robin @ Nov. 20 2012,11:14)
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

  
Southstar



Posts: 149
Joined: Nov. 2011

(Permalink) Posted: Nov. 20 2012,11:38   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.

And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Sorry your maths is way off... ever study statistics? You should look into that before doing probability calculations.

The odds against  a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” the power. Yes... and what happened to all the other variables? did the cat eat 'em?

One of the fundamental variables is the number of amino acids evolved. I.e. how many acids are singularly playing the game. It's all fine and dandy to say that it's very hard to win the lottery but if your chances of winning are 1:1 million you can bet that if one million people play someone's going to win. What you have to ask yourself is how many amino acids can fit in a square meter of primal pond then ask yourself how many cubic kilometres of pond you have.

The second variable is time. How many attempts at combining are being played per second and how much time do they have to hit a meaningful combination... you haven't put this in your equation.

Third you don't need to get the complete sequence in the first shot you could have a cumulative sequence which would mean that you don’t reset the game if say on first time you get a string of 5 amino acids.

Now why don't you rewrite your math and add these variables in...

--------------
"Cows who know a moose when they see one will do infinitely better than a cow that pairs with a moose because they cannot see the difference either." Gary Gaulin

  
OgreMkV



Posts: 2987
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,11:38   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:26)
Quote (Robin @ Nov. 20 2012,11:14)
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

Because...

1) It's an ANALOGY
2) It doesn't actually have the steps needed to calculate the CSI of something alive (e.g. what do you need to know)
3) There are fundamental issues with the concepts you have presented that you have yet to deal with.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Southstar



Posts: 149
Joined: Nov. 2011

(Permalink) Posted: Nov. 20 2012,11:47   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:28)
I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

The analogy is NOT correct...

You need to multiply the number of archers, define the time per shot, set a total time available, allow for partial "close shots" that summed up give a hit (so as to allow for cumulative aggregation of the acids)

--------------
"Cows who know a moose when they see one will do infinitely better than a cow that pairs with a moose because they cannot see the difference either." Gary Gaulin

  
Richardthughes



Posts: 9538
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,11:54   

Jerry Don Bauer - you are a bullshitter. And not a very good one. That is all.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:55   

Are there any scientists in here other than Wesley? Thus far it seems, I'm only getting posts (with a couple exceptions, maybe) from religionists from whom I glean I'm offending by attempting to discuss thought with them.....

Never met so many religionists on what I thought was a science forum...oh well...

  
Richardthughes



Posts: 9538
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,11:56   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:55)
Are there any scientists in here other than Wesley? Thus far it seems, I'm only getting posts (with a couple exceptions, maybe) from religionists from whom I glean I'm offending by attempting to discuss thought with them.....

Never met so many religionists on what I thought was a science forum...oh well...



--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Richardthughes



Posts: 9538
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,11:58   

Put up or shut up.

Calculate the CSI of something organic. If you can. If you can't, we'll take that as evidence that you don't understand or can't apply CSI, or that CSI itself is unusable.

Thanks for playing.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Richardthughes



Posts: 9538
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,12:00   

Bonus:

http://forums.carm.org/vbb....27.html

"Are there any real scientists here?" LOL you fucking tard.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
fnxtr



Posts: 1835
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,12:08   

Quote (Southstar @ Nov. 20 2012,09:47)
 
Quote (Jerry Don Bauer @ Nov. 20 2012,11:28)
I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

The analogy is NOT correct...

You need to multiply the number of archers, define the time per shot, set a total time available, allow for partial "close shots" that summed up give a hit (so as to allow for cumulative aggregation of the acids)

So specificity is (AI)*(FLW). *

Got it. Thanks.

* Argument from incredulity multiplied by the lottery winner fallacy.

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
Robin



Posts: 1361
Joined: Sep. 2009

(Permalink) Posted: Nov. 20 2012,12:09   

[quote=Jerry Don Bauer,Nov. 20 2012,11:28][/quote]
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?


The archer analogy is terrible! Why? Because it's erroneous. First, the archer analogy doesn't even offer a scenario in which intelligence is required, so it fails outright. But even as a rebuttal to evolution it's inane because it relies on the fallacy of large numbers and the failure to take "genetic memory" (heredity) into account. The fact is, successful biological compounds are remembered; the archer's successful hits are not. Bottom line, your concept thus far makes no sense because too much of it is erroneous.

Quote
What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).


You may think you've defined it precisely, but you are wholly mistaken on that count. Your analogies are fallacious and do not in fact reflect reality. To make matters worse, you've yet to provide any substantiation for the base claims - that you can actually calculate CSI. Thus far, I can only conclude that this "CSI" has no value to anything, never mind just science.

--------------
we IDists rule in design for the flagellum and cilium largely because they do look designed.  Bilbo

The only reason you reject Thor is because, like a cushion, you bear the imprint of the biggest arse that sat on you. Louis

  
  128 replies since Oct. 06 2012,18:57 < Next Oldest | Next Newest >  

Pages: (5) < 1 2 [3] 4 5 >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]

Visits since January 19th, 2010: