RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (5) < [1] 2 3 4 5 >   
  Topic: Creating CSI with NS, H T T H H H T H T T H H H H T T T< Next Oldest | Next Newest >  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 06 2012,18:57   

As per this thread at TSZ:

http://theskepticalzone.com/wp....t....t-16375

I've created a version here:

http://complexspecifiedinformation.appspot.com/....pot....pot.com

Source code to follow shortly. Feature suggestions etc welcome. If it does not actually render for you then it's because it's not outputting actual HTML just yet, will fix asap.


images

Full data history of every step can be/will be made available. Initialized with random data.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
rossum



Posts: 148
Joined: Dec. 2008

(Permalink) Posted: Oct. 07 2012,05:26   

Possibly off topic, but this is a piece I keep for when the CSI argument pops up:


CSI and Regular Processes

Dr Dembski asserts that it is not possible for regular processes to create Complex Specified Information (CSI).  This is incorrect, it is perfectly possible for a regular process to create CSI in large amounts as I shall demonstrate.

The "S" in CSI stands for "Specified", so we need to have a specification for our example.  I shall use, "The text of the King James Bible" as the specification for this demonstration.

Here is some text which meets the specification:

Quote
"In the beginning God created the heaven and the earth ... The grace of our Lord Jesus Christ be with you all. Amen."


For practical reasons I have elided much of the actual text.
 
Here is some text of the same length which does not meet the specification:

Quote
"Va gur ortvaavat Tbq perngrq gur urnira naq gur rnegu ... Gur tenpr bs bhe Ybeq Wrfhf Puevfg or jvgu lbh nyy. Nzra."


The first text contains information and also meets the specification, hence it contains specified information.  The complete text, without the elision, would be long enough to be complex and so contain CSI, Complex Specified Information.

The second text contains the same amount of raw information; it is the same length and drawn from the same character set.  The calculation of Shannon information will give the same value.  However the second text is not specified information because it is not the King James Bible.  The second text contains information but it contains zero CSI because it does not meet the specification.  It only contains CUI: Complex Unspecified Information.

Now we will apply a regular process to the second text: an alphabetic barrel shift of 13 places, also known as ROT13.  If we apply this regular process to the second text it changes to:

Quote
"In the beginning God created the heaven and the earth ... The grace of our Lord Jesus Christ be with you all. Amen."


This of course now contains exactly the same amount of CSI as the first text.  Previously it contained zero CSI because it did not meet the specification.  After applying the regular process it meets the specification, so we have increased the amount of CSI present purely by applying a regular process.

Contrary to what Dr Dembski has stated, this simple example shows that a regular process, such as ROT13, can create CSI.  Since a regular process can create CSI it is therefore incorrect to assert that a regular process cannot be the origin of any CSI found in living organisms.  This is a major problem for ID's attempts to use the presence of CSI as a marker of design.  CSI can be generated by non-design processes such as ROT13.


rossum

--------------
The ultimate truth is that there is no ultimate truth.

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 07 2012,07:29   

It's all good. Let's collect it all here.

Made a few changes, now the app will generate a new generation every 60 seconds. Visiting the page will just display the current generation.

I'll have a graph of score/time up soon. Some issues recording each iteration currently, working on that.

Plus I'll put in a special "start with all tails" mode just for Mung as Mung is obviously incapable of programming his own version.  

Mung, if you grow some then by all means tell me on this thread what's wrong with the app I've written.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Wesley R. Elsberry



Posts: 4115
Joined: May 2002

(Permalink) Posted: Oct. 07 2012,08:14   

rossum wrote:

Quote

Contrary to what Dr Dembski has stated, this simple example shows that a regular process, such as ROT13, can create CSI.  [...]  CSI can be generated by non-design processes such as ROT13.


The are ways to demonstrate algorithmic processes generating CSI; Jeff Shallit and I have done that before. However, the example cited is not one of them. In fact, Dembski's "The Design Inference" devotes a chunk of text to the discovery of specifications for encrypted text.

Quote

Since a regular process can create CSI it is therefore incorrect to assert that a regular process cannot be the origin of any CSI found in living organisms.  This is a major problem for ID's attempts to use the presence of CSI as a marker of design.


This part I agree with, but it isn't justified by the ROT13 example.

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 07 2012,08:51   

For the time being here is a pastebin of the source:

http://pastebin.com/QLHPH0W....LHPH0Wf

It's an app engine project. I'll put the whole thing up as a bundle on one of those github soon.

Code is not exactly elegant, but hey, only a few hours in so far...

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
rossum



Posts: 148
Joined: Dec. 2008

(Permalink) Posted: Oct. 07 2012,11:26   

Quote (Wesley R. Elsberry @ Oct. 07 2012,08:14)
The are ways to demonstrate algorithmic processes generating CSI; Jeff Shallit and I have done that before. However, the example cited is not one of them. In fact, Dembski's "The Design Inference" devotes a chunk of text to the discovery of specifications for encrypted text.

It is always possible to find a specification for encrypted text: "The string which when decrypted with the Caesar cypher, key 13, gives the text of the King James Bible."  The problem is knowing the specification in advance.

However, using that specification, the actual text of the KJV does not meet the specification, and so has zero CSI.  The regular process of decryption will destroy CSI, but conversely, the regular process of encryption will create CSI.

If we are allowed to change the specification in mid-calculation then we can effectively set any value of CSI we want to zero; just switch the specification to: "A design for a working perpetual motion machine."  Such a specification cannot be met.  Hence it would be 'easy' to show that nothing at all had any CSI and there was no design to be found anywhere.  Hardly the result that the ID side wants.

Dr Dembski's search for specifications for encrypted text, without knowing the key, is effectively a search for a universal code breaker.  In cryptography, if the output of an encryption algorithm can be distinguished from random, then that encryption is considered to be broken.  A mathematically perfect encryption cannot be distinguished from random, without the key.  I am sure that both the NSA and GCHQ would be very interested indeed if Dr Dembski had made any progress in this area.

I agree that my piece is far from rigorous, but I think that it is at about right level for most internet discussion fora.

rossum

--------------
The ultimate truth is that there is no ultimate truth.

  
midwifetoad



Posts: 3136
Joined: Mar. 2008

(Permalink) Posted: Oct. 07 2012,15:50   

I'm afraid I don't understand the output of this program. My understanding is the fitness score for a 500 bit child is the product of the lengths of runs of ones.

The drop dead halting score is 1060.

I believe Lizzy's program ran for days at a time, doing many generations per second.

But my memory could be faulty.

Edit. After reading this I believe there's a typo in the TSZ thread, and the halting number should be 10^60. Sometimes my brain doesn't engage until after I've posted something.

Edited by midwifetoad on Oct. 07 2012,16:02

--------------
... a poster child for irresponsible and deceitful misrepresentation of design theory on the Internet.
http://tinyurl.com/9axtwbe....9axtwbe

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 07 2012,15:59   

We has chart. http://complexspecifiedinformation.appspot.com/chart......t....rt



 
Quote
My understanding is the fitness score for a 500 bit child is the product of the lengths of runs of ones.


I have not been following the discussion closely. It's an attempt at the pseudo described in the OP in the link above to TSZ

 
Quote
My understanding is the fitness score for a 500 bit child is the product of the lengths of runs of ones.


This is the fitness code:
Code Sample
for toss in r:
           if toss == 'H':
               # As they do so, they record all runs of heads
               counter+=1
           if toss == 'T':
               # so that if they toss H T T H H H T H T T H H H H T T T,
               if counter > 0:
                   #   they will record: 1, 3, 1, 4, representing the number of heads in each run.
                   score.append(counter)
               counter = 0
       round_score.append(score)


So given a string of heads and tails like so:

H,H,T,H,H,H,T,H,H

The score calculated would be

2,3,2

And then the product of that list would be the score, 12 in this example.

If there is now an alternative model being used, the bitstring length of 1's you mention, could you link me to the original description?

Or have I totally misunderstood this: ? Always possible!

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 07 2012,16:01   

Quote (midwifetoad @ Oct. 07 2012,15:50)
I believe Lizzy's program ran for days at a time, doing many generations per second.

Yeah, this is *much* slower but I can make the results available at every iteration and provide charts and that if anyone likes.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 07 2012,16:08   

I can make it run much faster however. Much much faster. I'll probably attempt a mapreduce version or something, just to learn how that all works.

EDIT: I've sped it up some.

But what should the point mutation function be?

Currently (I've just changed it from the 1 in 10 per coin) it's set to one flip per row (set of 500) coin tosses. Probably too noisy 1 in 10 I thought.

Edited by oldmanintheskydidntdoit on Oct. 07 2012,17:06

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 08 2012,04:54   


images

A familiar pattern emerges. ~33135 generations.

What I find amazing is that such a simple construct can get so close to the target despite hardly any, well, anything really.

I implemented the TSP a while ago also (still under wraps for now) and again this procedure works amazingly well.

1) Generate a random population.
2) Sort by fitness (route length for TSP, or score here)
3) Delete the bottom % of the population.
4) Recreate the same % from the rest of the population
5) Throw in the odd mutation
6) Rinse and repeat.

And from the mess comes short TSP routes. From the mess comes high scoring patterns.

I can see why the ID crowd has such a problem with this sort of model. I can't imagine a realistic analogue to a biological population, say of bacteria, where the least fit make room for the fitter and information is exchanged to create the next generation with the odd mutation.

Just not going to happen is it?

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Quack



Posts: 1302
Joined: May 2007

(Permalink) Posted: Oct. 08 2012,07:34   

Quote
Or have I totally misunderstood this: ? Always possible!

How many times > 0 have we heard something like that from a creationist?

--------------
My new avatar is so lovely.
Me.

you are hand waving faster than a one armed NY cabby with crabs.
k.e..

No, I said nothing about mathematics. Anyone can support anything with mathematics.
Ray Martinez

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 08 2012,08:35   

Quote (Quack @ Oct. 08 2012,07:34)
 
Quote
Or have I totally misunderstood this: ? Always possible!

How many times > 0 have we heard something like that from a creationist?

I'm currently in the process of finding out what I don't know about programming by attempting to answer other peoples questions on stackoverflow.

Turns out there are significant gaps in my (self)education, even on topics I really thought I had down pat.

EDIT: Getting corrected by the author of the programming language/system you've answered a question about (and been wrong on) is a novel experience.

Edited by oldmanintheskydidntdoit on Oct. 08 2012,08:36

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
midwifetoad



Posts: 3136
Joined: Mar. 2008

(Permalink) Posted: Oct. 08 2012,08:43   

Last night I did some calculator fiddling and discovered that the highest scoring pattern is runs of four. There may be a specific highest scoring pattern that includes a mixture, but I suspect the optimum is mostly fours with one five.

Math isn't my strongest subject, so it's likely I have screwed this up. But it appears there is a very small set of qualifying strings. Not quite as small as Mung's set of one string. But close.

The fitness function is similar to that used in the travelling salesman problem, and the GA has the ability to sum many variables into one score that has no knowledge of the target.

If it is to be considered a model of reality, then reality must allow fitness gradients. What the model demonstrates is that many dimensions of fitness can be addressed simultaneously.

--------------
... a poster child for irresponsible and deceitful misrepresentation of design theory on the Internet.
http://tinyurl.com/9axtwbe....9axtwbe

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 08 2012,08:52   

Quote (midwifetoad @ Oct. 08 2012,08:43)
Last night I did some calculator fiddling and discovered that the highest scoring pattern is runs of four.

IIRC that's was the result of Lizzie's runs.

Currently mine won't get to that, bug in the distribution of mutations function, will fix and restart. Got it going at about 1 generation a ~second now but should be able to improve on that.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
midwifetoad



Posts: 3136
Joined: Mar. 2008

(Permalink) Posted: Oct. 08 2012,09:47   

To my bemusement, the "winning" patterns are very simple and regular. As if you could have an oracle that sets "weasel" as the target without knowing the target string.

What remains of the ID argument is the unevidenced assertion that that are no fitness gradients or plateaus. Gpuccio in particular, treats fitness as entirely one dimensional, and selection always striving for a particular optimum sequence.

He seems unable conceptually to grasp the idea that natural selection sees all aspects of fitness simultaneously.

--------------
... a poster child for irresponsible and deceitful misrepresentation of design theory on the Internet.
http://tinyurl.com/9axtwbe....9axtwbe

  
k.e..



Posts: 2498
Joined: May 2007

(Permalink) Posted: Oct. 08 2012,10:04   

Quote (midwifetoad @ Oct. 08 2012,17:47)
To my bemusement, the "winning" patterns are very simple and regular. As if you could have an oracle that sets "weasel" as the target without knowing the target string.

What remains of the ID argument is the unevidenced assertion that that are no fitness gradients or plateaus. Gpuccio in particular, treats fitness as entirely one dimensional, and selection always striving for a particular optimum sequence.

He seems unable conceptually to grasp the idea that natural selection sees all aspects of fitness simultaneously.

Indeed.

What those tards don't get is that a GA will generate non conceptual solutions which reach a target (or if you will, create new species) more effectively than most other searches  AND can produce entirely different species accross multiple fitness landscapes.

Simply because designers are not as effective as (a random .....snikker)GA.

--------------
"I get a strong breeze from my monitor every time k.e. puts on his clownDaveTard suit." dogdidit

Abbie Smith (ERV) who's got to be the most obnoxious arrogant snot I've ever seen except for when I look in a mirror. DAVE TARD

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Oct. 08 2012,10:06   

Quote (midwifetoad @ Oct. 08 2012,09:47)
To my bemusement, the "winning" patterns are very simple and regular. As if you could have an oracle that sets "weasel" as the target without knowing the target string.

What remains of the ID argument is the unevidenced assertion that that are no fitness gradients or plateaus. Gpuccio in particular, treats fitness as entirely one dimensional, and selection always striving for a particular optimum sequence.

He seems unable conceptually to grasp the idea that natural selection sees all aspects of fitness simultaneously.

As I recall, there was a machine learning system that learned how to play checkers.  The programmers didn't tell it any rules or even what a winning condition was.  

All they did was, after 5 runs, gave the machine a win/loss ratio.  That's it.

The computer learned the rules of checkers and then learned optimal play.  When the microsoft gaming servers were online, they played the machine against live opponents there and found that it was nearly master level... something like an ELO score around 1480 (with 1500 being master).

So it's possible.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
midwifetoad



Posts: 3136
Joined: Mar. 2008

(Permalink) Posted: Oct. 08 2012,10:52   

I would pay money to see that program play against Gil's I realize it is possible using a database to play a perfect end game, but I suspect the opening and middle would be interesting.

Is there any way to make that happen? I think Gil's can be purchased.

Edited by midwifetoad on Oct. 08 2012,10:53

--------------
... a poster child for irresponsible and deceitful misrepresentation of design theory on the Internet.
http://tinyurl.com/9axtwbe....9axtwbe

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Oct. 08 2012,11:29   

Quote (midwifetoad @ Oct. 08 2012,10:52)
I would pay money to see that program play against Gil's I realize it is possible using a database to play a perfect end game, but I suspect the opening and middle would be interesting.

Is there any way to make that happen? I think Gil's can be purchased.

Gil's uses a database for the end game?  Probably, most of them do.

The machine learning one doesn't.  It very well may have developed it's own database internally, but a endgame database wasn't programmed into it.

Maybe just get on a chat with Gil and run both programs.  That's how the researchers did it.  They acted as an intermediary between the checkers learning program and the on-line gaming system.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Oct. 08 2012,11:32   

Here's the link to the papers (and I had the ELO numbers all screwed up). http://www.natural-selection.com/NSIPubl....ine.htm

The papers are in 2000 and 2001.

Crap... those links are bad.  Here are some good links... http://red.cs.nott.ac.uk/~gxk....001.pdf

http://www.cs.nott.ac.uk/~gxk....ext.pdf

Edited by OgreMkV on Oct. 08 2012,11:35

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Soapy Sam



Posts: 363
Joined: Jan. 2012

(Permalink) Posted: Oct. 08 2012,11:53   

Quote (midwifetoad @ Oct. 08 2012,09:47)
To my bemusement, the "winning" patterns are very simple and regular. As if you could have an oracle that sets "weasel" as the target without knowing the target string.

Yes, the fitnesss function 'smuggles in' something about products! 4x4 is bigger than 3 x 5, 2 x 6, 1 x 7 ... which is, for example, why equal masses give a higher gravitational force (proportional to m1 x m2) than any asymmetric distribution of the same total mass (actually, the cause is the unequal distribution of individual atomic interactions, but proportionality to m1 x m2 is the mathematical result).

So settling on same-sized runs with 1-bit separators maximises the product.

Edited by Soapy Sam on Oct. 08 2012,11:55

--------------
Evolutionists trust entropy for creation of life but are like men who horse a crocodile to get across a river - niwrad.

The organism could already metabolize citrus. Joe G

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 08 2012,12:41   

just playing around with a duplication_error function that takes a random length segment and repeats it, starting where the original segment ends.

It's at generation 290 and it's already beaten the single point mutation version which is on almost 50k iterations.

I turned charting off for speed, will get it back on and compare...

EDIT: Adding duplications makes it complete very quickly. Top15 shown here, not all 500 shown (rows truncated).  

free image hosting
Will have to make a roll your own parameter version of this.

Edited by oldmanintheskydidntdoit on Oct. 08 2012,17:02

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Oct. 13 2012,05:05   

re: compressibility, the hot topic of the moment.

Adding in charts for genome size after gzip compression is applied. More to follow.

photo storage

Edited by oldmanintheskydidntdoit on Oct. 13 2012,05:05

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,11:34   

Well, You guys may be missing the point just a bit.

Complex Specified Information can alway create further Complex Specified Information if by nothing more than rearrangement.

People, computers, software, etc. do this every day. RNA/DNA replicates quite readily.

The kicker is that CSI cannot arise naturally without Intelligent Design somewhere in the process.

Unfortunately for the ID detractors, they have never given an example where this has happened and it is, in fact, mathematically impossible.

That, indeed, is the point...  :p

  
Henry J



Posts: 3734
Joined: Mar. 2005

(Permalink) Posted: Nov. 19 2012,11:49   

But the only way something can be mathematically impossible is for that to be proven as a theorem in a formal mathematical system (i.e., based on axioms).

But before doing that, one has to show that the physical phenomena is actually equivalent to the formal mathematical system.

But that would require first actually defining CSI in a meaningful manner, rather than as a political slogan used only for propaganda.

Henry

  
Jim_Wynne



Posts: 687
Joined: June 2006

(Permalink) Posted: Nov. 19 2012,12:11   

Quote (Jerry Don Bauer @ Nov. 19 2012,11:34)
The kicker is that CSI cannot arise naturally without Intelligent Design somewhere in the process.

Unfortunately for the ID detractors, they have never given an example where this has happened and it is, in fact, mathematically impossible.

Joe Bob,

Did you know that the so-called argument from probability, aka argument from large numbers, pegs those who use it as profoundly ignorant of probability theory, and that it is, ultimately, an argument that assumes its own conclusion?

--------------
Evolution is not about laws but about randomness on happanchance.--Robert Byers, at PT

  
JohnW



Posts: 1929
Joined: Aug. 2006

(Permalink) Posted: Nov. 19 2012,12:46   

Quote (Henry J @ Nov. 19 2012,09:49)
But the only way something can be mathematically impossible is for that to be proven as a theorem in a formal mathematical system (i.e., based on axioms).

But before doing that, one has to show that the physical phenomena is actually equivalent to the formal mathematical system.

But that would require first actually defining CSI in a meaningful manner, rather than as a political slogan used only for propaganda.

Henry

CSI is defined as "that thing which cannot arise naturally without Intelligent Design somewhere in the process".  So: if it looks like GodDesignerdidit to me, then it has CSI.  And since it has CSI, then GodDesignerdidit.  All science so far!

--------------
It always amazes me to no end that people who find the Bible abhorent seem to focus only on the few instances where God commands a city destroyed.
- FTK

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,12:55   

Quote (Henry J @ Nov. 19 2012,11:49)
But the only way something can be mathematically impossible is for that to be proven as a theorem in a formal mathematical system (i.e., based on axioms).

But before doing that, one has to show that the physical phenomena is actually equivalent to the formal mathematical system.

But that would require first actually defining CSI in a meaningful manner, rather than as a political slogan used only for propaganda.

Henry

Borel's law, which was a well accepted tenet of chemistry long before whoever you believe the "evil, science twisting; propagandists" that you think exist, came along, would beg to disagree with you concerning the math.

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI.....

This too is just a take off of Borel's law that all of us who major in science tend to run across at some point as an undergrad.

It's actually not that complicated to comprehend.

  
Henry J



Posts: 3734
Joined: Mar. 2005

(Permalink) Posted: Nov. 19 2012,13:10   

But I am not one of those claiming that CSI has been defined, so I'm not the one who needs to supply a definition.

If it had a definition, you could have supplied it just now, but you didn't.

Keep in mind that it wouldn't work to define CSI simply as something that can't evolve, because that would produce a circular argument.

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Nov. 19 2012,13:10   

Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)
And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI.....

This too is just a take off of Borel's law that all of us who major in science tend to run across at some point as an undergrad.

It's actually not that complicated to comprehend.

Very well.

Please point me to a thing.

Please determine the amount of CSI that that thing has.

Please show how you came to that conclusion.

Now, please point me to two more things. One designed, one not designed.

Show me that there more CSI in the designed thing then the not-designed thing.

You see it's easy to say "Then, if it is both complex and specified it is therefore CSI....." but what you can't do is put a specific value to it.

CSI is like obscenity in that regard. You can't tell me what it is but you'll certanly know it when you see it.

For example, once of the "variants" of CSI is being discussed here:

http://theskepticalzone.com/wp....?....?p=1450

And little has come of it except to show that CSI is not defined in a useful way nor can it do useful things.

I guess it takes someone like you to show them where they are going wrong!

Go for it!

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 19 2012,13:26   

Jerry,

Define CSI and compute, calculate, measure it for the organism of your choice.  Show your work.

Or better yet, provide a detailed series of steps for said measurement or calculation, then pick an organism and let's both do the work and see if we get the same answer.

I've got about 8 mathematicians sitting within 40 feet of me and I can pick up the phone and call no fewer than three people with Ph.D.s in statistical analysis, so don't be afraid to drop the math stuff.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,13:39   

Quote (Henry J @ Nov. 19 2012,13:10)
But I am not one of those claiming that CSI has been defined, so I'm not the one who needs to supply a definition.

If it had a definition, you could have supplied it just now, but you didn't.

Keep in mind that it wouldn't work to define CSI simply as something that can't evolve, because that would produce a circular argument.

Perhaps I didn't define it formally for you because I was making chat in an informal conversation. But I'll be glad to:

CSI: Complex and specified information that when the odds for its existence are calculated and those odds exceed the UPB (upper probability boundary), could not occur by chance.

There you go and it's that simple.

Borel calculated, chemically speaking, that in order for a chemical reaction to occur, the reactants had to have both chemical ability to react and be within close enough proximity in the universe to do so.

Should the odds of those two things occuring be greater than 1 in 10^50 against occurance, that reaction could never happen no matter how much time is given for it to occur.

Borel's UPB was 10^50 -- Dembski thought it should be higher and mused that 10^150 should be the UPB....That seems to be well accepted today in modern ID, certainly by me.

So, we can take this into bits if you wish which usually seems easier to understand in these conversations:

If the information contains over 500 bits of information and that information is specified....it ain't gonna happen in nature without a designer....*wink*

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,13:44   

"I've got about 8 mathematicians sitting within 40 feet of me"

Have you tried an exterminator? *grin*

  
JohnW



Posts: 1929
Joined: Aug. 2006

(Permalink) Posted: Nov. 19 2012,13:49   

Quote (Jerry Don Bauer @ Nov. 19 2012,11:39)
CSI: Complex and specified information that when the odds for its existence are calculated and those odds exceed the UPB (upper probability boundary), could not occur by chance.

There you go and it's that simple.

Go ahead then.  Let's see some odds calculations.  Please show your work, and don't forget to state your assumptions.

--------------
It always amazes me to no end that people who find the Bible abhorent seem to focus only on the few instances where God commands a city destroyed.
- FTK

  
Wesley R. Elsberry



Posts: 4115
Joined: May 2002

(Permalink) Posted: Nov. 19 2012,13:52   

Now that Jerry has decided to post in this forum, he could pick up where his prior discussion of CSI was noted here.

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Nov. 19 2012,13:56   

Hey, Jerry, how'd the juice and fake cigarettes business work out for you?

About as well as the YEC it seems.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 19 2012,13:59   

Quote (Jerry Don Bauer @ Nov. 19 2012,13:39)
Borel calculated, chemically speaking, that in order for a chemical reaction to occur, the reactants had to have both chemical ability to react and be within close enough proximity in the universe to do so.

Should the odds of those two things occuring be greater than 1 in 10^50 against occurance, that reaction could never happen no matter how much time is given for it to occur.

Hydrogen makes up 74% of the known matter in the universe.

Having an oxygen molecule react with two SPECIFIC hydrogen atoms is massively improbable.

However, an oxygen molecule reacting with ANY two hydrogen atoms approaches 1.

You assumptions define CSI.

Besides, recent experimental evidence shows that the formation of long chain amino acids is relatively easy.  Randomly forming a specific human (for example) protein is vastly improbable.  However, only creationists require that all proteins assemble from random amino acids.  It's a strawman argument.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Henry J



Posts: 3734
Joined: Mar. 2005

(Permalink) Posted: Nov. 19 2012,14:02   

Repeat of paragraph that Jerry seems to have missed:

Keep in mind that it wouldn't work to define CSI simply as something that can't evolve, because that would produce a circular argument.

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,14:04   

Quote (Wesley R. Elsberry @ Nov. 19 2012,13:52)
Now that Jerry has decided to post in this forum, he could pick up where his prior discussion of CSI was noted here.

Hello Wesley.

That was an item in 2004 between us...lol...

I'm glad to discuss it, but your original (actually co-authored) paper that begin it all is not posted, nor is my paper on Dembski's forum posted at that link......I highly doubt that anyone but you and I would even know what we were talking about.....

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,14:09   

Quote (Henry J @ Nov. 19 2012,14:02)
Repeat of paragraph that Jerry seems to have missed:

Keep in mind that it wouldn't work to define CSI simply as something that can't evolve, because that would produce a circular argument.

When did I define CSI as something that cannot evolve? Are you not aware of drug resistance in the mutation and hence evolution of certain organisms? Those organisms are certainly CSI.

Please understand the concept that the modern IDist holds before you attempt to debate it.

Evolution is a fact of science.

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,14:21   

*****Besides, recent experimental evidence shows that the formation of long chain amino acids is relatively easy.  Randomly forming a specific human (for example) protein is vastly improbable.  However, only creationists require that all proteins assemble from random amino acids.  It's a strawman argument.*****

Recent? I've known that since I was a kid. What you are referring to here (I think) is homochirality. And I'm afraid that stereochemistry is far from creationism, although you'll have to ask them as I really am not that hep on creationism.

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Nov. 19 2012,14:23   

Quote (Jerry Don Bauer @ Nov. 19 2012,14:09)
Those organisms are certainly CSI.

Ah, they "are" CSI are they?

But a moment ago CSI was "information that calculates out above the upper probability bound".

So which is it?

 
Quote
Please understand the concept that the modern IDist holds before you attempt to debate it.


Why don't you simply demonstrate the calculation of CSI for a range of objects then thereby clarifying it once and for all?
 
Quote
Those organisms are certainly CSI.

Lol, you creationists are all the same. You can't keep all the lies straight and stuff like this slips out.

Tell me Gary, are there *any* organisms that are *not* CSI?
How come?

If not, then what do you add by saying those organisms are certainly CSI as *all* organisms are CSI?

Just another deluded IDiot.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Jim_Wynne



Posts: 687
Joined: June 2006

(Permalink) Posted: Nov. 19 2012,14:24   

Quote (Jerry Don Bauer @ Nov. 19 2012,14:09)
Quote (Henry J @ Nov. 19 2012,14:02)
Repeat of paragraph that Jerry seems to have missed:

Keep in mind that it wouldn't work to define CSI simply as something that can't evolve, because that would produce a circular argument.

When did I define CSI as something that cannot evolve? Are you not aware of drug resistance in the mutation and hence evolution of certain organisms? Those organisms are certainly CSI.

Please understand the concept that the modern IDist holds before you attempt to debate it.

Evolution is a fact of science.

Jim Bob,

There's really no need for no hard 'rithmetic.  All you gotta do is post a copy of the specifications for something that's got CSI and we're done here.  Things that are specified do have specifications, right?

--------------
Evolution is not about laws but about randomness on happanchance.--Robert Byers, at PT

  
Wesley R. Elsberry



Posts: 4115
Joined: May 2002

(Permalink) Posted: Nov. 19 2012,14:34   

Quote (Jerry Don Bauer @ Nov. 19 2012,14:04)
 
Quote (Wesley R. Elsberry @ Nov. 19 2012,13:52)
Now that Jerry has decided to post in this forum, he could pick up where his prior discussion of CSI was noted here.

Hello Wesley.

That was an item in 2004 between us...lol...

I'm glad to discuss it, but your original (actually co-authored) paper that begin it all is not posted, nor is my paper on Dembski's forum posted at that link......I highly doubt that anyone but you and I would even know what we were talking about.....

Your pals may not understand how to keep a website running, but I can assure you that my papers are still available. I just checked both links to my work, and they do deliver the goods.

I don't think anyone will have any difficulty seeing that you were dismissing things without understanding them in 2004, and nothing has changed for you in the interim, apparently.

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,15:17   

Quote (Wesley R. Elsberry @ Nov. 19 2012,14:34)
Quote (Jerry Don Bauer @ Nov. 19 2012,14:04)
   
Quote (Wesley R. Elsberry @ Nov. 19 2012,13:52)
Now that Jerry has decided to post in this forum, he could pick up where his prior discussion of CSI was noted here.

Hello Wesley.

That was an item in 2004 between us...lol...

I'm glad to discuss it, but your original (actually co-authored) paper that begin it all is not posted, nor is my paper on Dembski's forum posted at that link......I highly doubt that anyone but you and I would even know what we were talking about.....

Your pals may not understand how to keep a website running, but I can assure you that my papers are still available. I just checked both links to my work, and they do deliver the goods.

I don't think anyone will have any difficulty seeing that you were dismissing things without understanding them in 2004, and nothing has changed for you in the interim, apparently.

Oh, I absolutely understood them. Your problem, if I recall...is that you failed to fully grasp the logic of Dembski.

I spent most of my paper pointing out "that's not what he meant." My paper: Answering: The advantages of theft over toil: the design inference and arguing from ignorance

Is here: http://www.iscid.org/ubbcgi.....#000000

BTW, to my respondants on this thread, I show how the UPB is arrived at mathematically in this paper as well.

The abstract reads: "Philosopher William Dembski has proposed an "explanatory filter" for distinguishing between events due to chance, lawful regularity or design. Elsberry and Wilkins proposed that if Dembski's filter were adopted as a scientific heuristic, some classical developments in science would not be rational. They further posit in the abstract that if background information changes even slightly, the filter's conclusion will vary wildly and that Dembski fails to overcome Hume's objections to arguments from design, neither posit substantiated in the paper. I will show this paper as not based on science or logic and blatantly erroneous, as peer reviewed herein, in its basal tenets."

Yet you did not show that: "if Dembski's filter were adopted as a scientific heuristic, some classical developments in science would not be rational"

Care to try again??

  
JohnW



Posts: 1929
Joined: Aug. 2006

(Permalink) Posted: Nov. 19 2012,15:24   

Quote (Jerry Don Bauer @ Nov. 19 2012,13:17)
BTW, to my respondants on this thread, I show how the UPB is arrived at mathematically in this paper as well.

That's nice.  Did you calculate the CSI of anything?

--------------
It always amazes me to no end that people who find the Bible abhorent seem to focus only on the few instances where God commands a city destroyed.
- FTK

  
Wesley R. Elsberry



Posts: 4115
Joined: May 2002

(Permalink) Posted: Nov. 19 2012,15:47   

Quote (Jerry Don Bauer @ Nov. 19 2012,15:17)
Quote (Wesley R. Elsberry @ Nov. 19 2012,14:34)
 
Quote (Jerry Don Bauer @ Nov. 19 2012,14:04)
   
Quote (Wesley R. Elsberry @ Nov. 19 2012,13:52)
Now that Jerry has decided to post in this forum, he could pick up where his prior discussion of CSI was noted here.

Hello Wesley.

That was an item in 2004 between us...lol...

I'm glad to discuss it, but your original (actually co-authored) paper that begin it all is not posted, nor is my paper on Dembski's forum posted at that link......I highly doubt that anyone but you and I would even know what we were talking about.....

Your pals may not understand how to keep a website running, but I can assure you that my papers are still available. I just checked both links to my work, and they do deliver the goods.

I don't think anyone will have any difficulty seeing that you were dismissing things without understanding them in 2004, and nothing has changed for you in the interim, apparently.

Oh, I absolutely understood them. Your problem, if I recall...is that you failed to fully grasp the logic of Dembski.

I spent most of my paper pointing out "that's not what he meant." My paper: Answering: The advantages of theft over toil: the design inference and arguing from ignorance

Is here: http://www.iscid.org/ubbcgi.....#000000

BTW, to my respondants on this thread, I show how the UPB is arrived at mathematically in this paper as well.

The abstract reads: "Philosopher William Dembski has proposed an "explanatory filter" for distinguishing between events due to chance, lawful regularity or design. Elsberry and Wilkins proposed that if Dembski's filter were adopted as a scientific heuristic, some classical developments in science would not be rational. They further posit in the abstract that if background information changes even slightly, the filter's conclusion will vary wildly and that Dembski fails to overcome Hume's objections to arguments from design, neither posit substantiated in the paper. I will show this paper as not based on science or logic and blatantly erroneous, as peer reviewed herein, in its basal tenets."

Yet you did not show that: "if Dembski's filter were adopted as a scientific heuristic, some classical developments in science would not be rational"

Care to try again??

I already responded to your misunderstandings years ago.

The ball is in your court.

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 19 2012,16:03   

Interesting that the part you didn't do was in a previous comment.

Do you want to calculate or measure the CSI of an organism or teach me to do so and us compare the results?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,16:04   

Quote (Wesley R. Elsberry @ Nov. 19 2012,15:47)
Quote (Jerry Don Bauer @ Nov. 19 2012,15:17)
Quote (Wesley R. Elsberry @ Nov. 19 2012,14:34)
 
Quote (Jerry Don Bauer @ Nov. 19 2012,14:04)
     
Quote (Wesley R. Elsberry @ Nov. 19 2012,13:52)
Now that Jerry has decided to post in this forum, he could pick up where his prior discussion of CSI was noted here.

Hello Wesley.

That was an item in 2004 between us...lol...

I'm glad to discuss it, but your original (actually co-authored) paper that begin it all is not posted, nor is my paper on Dembski's forum posted at that link......I highly doubt that anyone but you and I would even know what we were talking about.....

Your pals may not understand how to keep a website running, but I can assure you that my papers are still available. I just checked both links to my work, and they do deliver the goods.

I don't think anyone will have any difficulty seeing that you were dismissing things without understanding them in 2004, and nothing has changed for you in the interim, apparently.

Oh, I absolutely understood them. Your problem, if I recall...is that you failed to fully grasp the logic of Dembski.

I spent most of my paper pointing out "that's not what he meant." My paper: Answering: The advantages of theft over toil: the design inference and arguing from ignorance

Is here: http://www.iscid.org/ubbcgi.....#000000

BTW, to my respondants on this thread, I show how the UPB is arrived at mathematically in this paper as well.

The abstract reads: "Philosopher William Dembski has proposed an "explanatory filter" for distinguishing between events due to chance, lawful regularity or design. Elsberry and Wilkins proposed that if Dembski's filter were adopted as a scientific heuristic, some classical developments in science would not be rational. They further posit in the abstract that if background information changes even slightly, the filter's conclusion will vary wildly and that Dembski fails to overcome Hume's objections to arguments from design, neither posit substantiated in the paper. I will show this paper as not based on science or logic and blatantly erroneous, as peer reviewed herein, in its basal tenets."

Yet you did not show that: "if Dembski's filter were adopted as a scientific heuristic, some classical developments in science would not be rational"

Care to try again??

I already responded to your misunderstandings years ago.

The ball is in your court.

Very well, if you want to continue an over 8-year-old debate, please start a new thread and I will oblige you.

I can't seem to do that or even respond to most threads in here.

Please do that and link me to it. I will post all previous papers up to this point and then respond to your last rebuttle.

It DOES seem pretty silly to me to continue this as I do not take these debates personally and have no desire to make you look bad...however, if that is what you want, link the way, my friend...

  
JohnW



Posts: 1929
Joined: Aug. 2006

(Permalink) Posted: Nov. 19 2012,16:12   

Quote (OgreMkV @ Nov. 19 2012,14:03)
Interesting that the part you didn't do was in a previous comment.

Do you want to calculate or measure the CSI of an organism or teach me to do so and us compare the results?

Yet another creationist telling us how simple it is to calculate CSI - so simple there's no need to, well, calculate CSI.

At this point, I'd settle for the CSI of anything at all: gravel, hydrogen, a vacuum at absolute zero, caek...

--------------
It always amazes me to no end that people who find the Bible abhorent seem to focus only on the few instances where God commands a city destroyed.
- FTK

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,16:37   

Quote (OgreMkV @ Nov. 19 2012,16:03)
Interesting that the part you didn't do was in a previous comment.

Do you want to calculate or measure the CSI of an organism or teach me to do so and us compare the results?

You seem so ignorant in this subject (don't mean that as a slur just an observation as we are all ignorant in some subjects).

Why on earth would you want to calculate the CSI of an organism? Just a simple genome is lightyears over the 500 measly bits of information that make something CSI. Many proteins are as well...common sense should tell you that.

Look at the amount of information in the human genome:

Quote
The human genome contains the complete genetic information of the organism as DNA sequences stored in 23 chromosomes (22 autosomal chromosomes and one X or Y sex chromosome), structures that are organized from DNA and protein. A DNA molecule consists of two strands that form the iconic double-helix “twisted ladder”, whose backbone, which made of sugar and phosphate molecules, is connected by rungs of nitrogen-containing bases. DNA is composed of 4 different bases: Adenine (A), Thymine (T), Cytosine ©, and Guanine (G).  These bases are always paired in such a way that Adenine connects to Thymine, and Cytosine connects to Guanine.  These pairings produce 4 different base pair possibilities: A-T, T-A, G-C, and C-G. The haploid human genome (containing only 1 copy of each chromosome) consists of roughly 3 billion of these base pairs grouped into 23 chromosomes. A human being inherits two sets of genomes (one from each parent), and thus two sets of chromosomes, for a total of 46 chromosomes, representing the diploid genome, which contains about 6×10^9 base pairs.

Comparing the genome to computer data storage
In order to represent a DNA sequence on a computer, we need to be able to represent all 4 base pair possibilities in a binary format (0 and 1). These 0 and 1 bits are usually grouped together to form a larger unit, with the smallest being a “byte” that represents 8 bits. We can denote each base pair using a minimum of 2 bits, which yields 4 different bit combinations (00, 01, 10, and 11).  Each 2-bit combination would represent one DNA base pair.  A single byte (or 8 bits) can represent 4 DNA base pairs.  In order to represent the entire diploid human genome in terms of bytes, we can perform the following calculations:

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


http://bitesizebio.com/article....-genome

is 1.5 Gigabytes more than 500 bits? Then why would we want to go any further than this as you already have the answer before you start.

ANY organism will be over 500 bits.

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 19 2012,16:51   

Quote (Jerry Don Bauer @ Nov. 19 2012,16:37)
Quote (OgreMkV @ Nov. 19 2012,16:03)
Interesting that the part you didn't do was in a previous comment.

Do you want to calculate or measure the CSI of an organism or teach me to do so and us compare the results?

You seem so ignorant in this subject (don't mean that as a slur just an observation as we are all ignorant in some subjects).

Why on earth would you want to calculate the CSI of an organism? Just a simple genome is lightyears over the 500 measly bits of information that make something CSI. Many proteins are as well...common sense should tell you that.

Look at the amount of information in the human genome:

 
Quote
The human genome contains the complete genetic information of the organism as DNA sequences stored in 23 chromosomes (22 autosomal chromosomes and one X or Y sex chromosome), structures that are organized from DNA and protein. A DNA molecule consists of two strands that form the iconic double-helix “twisted ladder”, whose backbone, which made of sugar and phosphate molecules, is connected by rungs of nitrogen-containing bases. DNA is composed of 4 different bases: Adenine (A), Thymine (T), Cytosine ©, and Guanine (G).  These bases are always paired in such a way that Adenine connects to Thymine, and Cytosine connects to Guanine.  These pairings produce 4 different base pair possibilities: A-T, T-A, G-C, and C-G. The haploid human genome (containing only 1 copy of each chromosome) consists of roughly 3 billion of these base pairs grouped into 23 chromosomes. A human being inherits two sets of genomes (one from each parent), and thus two sets of chromosomes, for a total of 46 chromosomes, representing the diploid genome, which contains about 6×10^9 base pairs.

Comparing the genome to computer data storage
In order to represent a DNA sequence on a computer, we need to be able to represent all 4 base pair possibilities in a binary format (0 and 1). These 0 and 1 bits are usually grouped together to form a larger unit, with the smallest being a “byte” that represents 8 bits. We can denote each base pair using a minimum of 2 bits, which yields 4 different bit combinations (00, 01, 10, and 11).  Each 2-bit combination would represent one DNA base pair.  A single byte (or 8 bits) can represent 4 DNA base pairs.  In order to represent the entire diploid human genome in terms of bytes, we can perform the following calculations:

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


http://bitesizebio.com/article....-genome

is 1.5 Gigabytes more than 500 bits? Then why would we want to go any further than this as you already have the answer before you start.

ANY organism will be over 500 bits.

OK.  If I am ignorant on the subject, it's because every creationist I've ever talked to has been utterly unable to explain or teach the concept.

Since any organism is over 500 bits... let's try this.

5093413647
5962916509
4066005562
8540770698
8342922442
0194220209
7331543188
7173101712
5811761471
3261216342
2525310538
4613627960
9767559584
8786679179
7022618236
5134707276
1505272783
6020313600
8013081724
2444671310
5268821392
0881048845
1181910939
0754282725
9802869949
3733118584
7969279971
8150134026
7987778049
5178595812
2668421641
8163467125
0645780953
5684243267
1401437548
9391680033
7856973231
7145812146
8632651141
7699167635
0557559516
8611985974
7805273622
9849541633
3279510329
7149754142
7096458973
6301485923
1880042518
4930165865


Is this CSI?  Yes/No  Why?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
fnxtr



Posts: 1805
Joined: June 2006

(Permalink) Posted: Nov. 19 2012,16:55   

... and most organisms have had a billion years or so of evolution -- oh, sorry, changes in allele frequency -- to develop this complexity. (headdesk headdesk headdesk).

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 19 2012,17:02   

Quote (fnxtr @ Nov. 19 2012,16:55)
... and most organisms have had a billion years or so of evolution -- oh, sorry, changes in allele frequency -- to develop this complexity. (headdesk headdesk headdesk).

Which brings us right back to the point that whatshisface has already admitted to

Quote
*****Besides, recent experimental evidence shows that the formation of long chain amino acids is relatively easy.  Randomly forming a specific human (for example) protein is vastly improbable.  However, only creationists require that all proteins assemble from random amino acids.  It's a strawman argument.*****

Recent? I've known that since I was a kid.


So, he admits that his entire concept here is completely made up.  Of course, I'd be really curious as to "when I as a kid" means.

eta: Let me explain further.

If you KNOW that amino acids can self assemble, then you have just admitted that non-intelligence can form complex systems that are capable of catalytic functions (which they were not before).  This is a massive increase in "complexity" however you would like to define it.  

It is up to your and yours to show that intelligence is involved.  Since there have been many experiments that show that amino acids can self assemble, please grab one or two of those experiments and who us exactly where the intelligence appeared, what tools it used to manipulate the amino acids into a form that was capable of a catalytic function, and why the researchers doing the experiment missed it, but you managed to catch it.

If you cannot do this, then there is no evidence that intelligence is required.

Two points:
1) Stating "non-intelligence can't do it" is not evidence
2) Yes, human designers designed an experiment to have amino acids self assemble.  If you can't understand why this is not an objection to these experiments, then I will explain it to you and you will be forever ignored as someone who doesn't understand the most basic (i.e. 5th grade) concepts of the scientific process.

Edited by OgreMkV on Nov. 19 2012,17:11

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 19 2012,17:12   

Quote (Jerry Don Bauer @ Nov. 19 2012,14:21)
*****Besides, recent experimental evidence shows that the formation of long chain amino acids is relatively easy.  Randomly forming a specific human (for example) protein is vastly improbable.  However, only creationists require that all proteins assemble from random amino acids.  It's a strawman argument.*****

Recent? I've known that since I was a kid. What you are referring to here (I think) is homochirality. And I'm afraid that stereochemistry is far from creationism, although you'll have to ask them as I really am not that hep on creationism.

No.  I'm not referring to homochirality.

Read what I said.  If it's unclear, then I suggest you ask questions before assuming something.  I know that's hard to do for creationists, but if you did that, then it would be much less embarrassing for you.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 19 2012,17:35   

Quote (OgreMkV @ Nov. 19 2012,16:51)
Quote (Jerry Don Bauer @ Nov. 19 2012,16:37)
Quote (OgreMkV @ Nov. 19 2012,16:03)
Interesting that the part you didn't do was in a previous comment.

Do you want to calculate or measure the CSI of an organism or teach me to do so and us compare the results?

You seem so ignorant in this subject (don't mean that as a slur just an observation as we are all ignorant in some subjects).

Why on earth would you want to calculate the CSI of an organism? Just a simple genome is lightyears over the 500 measly bits of information that make something CSI. Many proteins are as well...common sense should tell you that.

Look at the amount of information in the human genome:

 
Quote
The human genome contains the complete genetic information of the organism as DNA sequences stored in 23 chromosomes (22 autosomal chromosomes and one X or Y sex chromosome), structures that are organized from DNA and protein. A DNA molecule consists of two strands that form the iconic double-helix “twisted ladder”, whose backbone, which made of sugar and phosphate molecules, is connected by rungs of nitrogen-containing bases. DNA is composed of 4 different bases: Adenine (A), Thymine (T), Cytosine ©, and Guanine (G).  These bases are always paired in such a way that Adenine connects to Thymine, and Cytosine connects to Guanine.  These pairings produce 4 different base pair possibilities: A-T, T-A, G-C, and C-G. The haploid human genome (containing only 1 copy of each chromosome) consists of roughly 3 billion of these base pairs grouped into 23 chromosomes. A human being inherits two sets of genomes (one from each parent), and thus two sets of chromosomes, for a total of 46 chromosomes, representing the diploid genome, which contains about 6×10^9 base pairs.

Comparing the genome to computer data storage
In order to represent a DNA sequence on a computer, we need to be able to represent all 4 base pair possibilities in a binary format (0 and 1). These 0 and 1 bits are usually grouped together to form a larger unit, with the smallest being a “byte” that represents 8 bits. We can denote each base pair using a minimum of 2 bits, which yields 4 different bit combinations (00, 01, 10, and 11).  Each 2-bit combination would represent one DNA base pair.  A single byte (or 8 bits) can represent 4 DNA base pairs.  In order to represent the entire diploid human genome in terms of bytes, we can perform the following calculations:

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


http://bitesizebio.com/article....-genome

is 1.5 Gigabytes more than 500 bits? Then why would we want to go any further than this as you already have the answer before you start.

ANY organism will be over 500 bits.

OK.  If I am ignorant on the subject, it's because every creationist I've ever talked to has been utterly unable to explain or teach the concept.

Since any organism is over 500 bits... let's try this.

5093413647
5962916509
4066005562
8540770698
8342922442
0194220209
7331543188
7173101712
5811761471
3261216342
2525310538
4613627960
9767559584
8786679179
7022618236
5134707276
1505272783
6020313600
8013081724
2444671310
5268821392
0881048845
1181910939
0754282725
9802869949
3733118584
7969279971
8150134026
7987778049
5178595812
2668421641
8163467125
0645780953
5684243267
1401437548
9391680033
7856973231
7145812146
8632651141
7699167635
0557559516
8611985974
7805273622
9849541633
3279510329
7149754142
7096458973
6301485923
1880042518
4930165865


Is this CSI?  Yes/No  Why?

Ok, I wasn't being rude and you are not taking it that way...Good.

But are the numbers you posted CSI? No. Unless I'm missing something.....How are they even specified information at all?

Of course, I don't know what they represent but they just seem like a random listing of numbers to me at this point.

Have you read any of my or Dembski's writings using an archer to define specificity and calculating it?

It would seem germain to the subject should you want to learn that.

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 19 2012,18:29   

Quote (Jerry Don Bauer @ Nov. 19 2012,17:35)
OK.  If I am ignorant on the subject, it's because every creationist I've ever talked to has been utterly unable to explain or teach the concept.

Since any organism is over 500 bits... let's try this.

5093413647
5962916509
4066005562
8540770698
8342922442
0194220209
7331543188
7173101712
5811761471
3261216342
2525310538
4613627960
9767559584
8786679179
7022618236
5134707276
1505272783
6020313600
8013081724
2444671310
5268821392
0881048845
1181910939
0754282725
9802869949
3733118584
7969279971
8150134026
7987778049
5178595812
2668421641
8163467125
0645780953
5684243267
1401437548
9391680033
7856973231
7145812146
8632651141
7699167635
0557559516
8611985974
7805273622
9849541633
3279510329
7149754142
7096458973
6301485923
1880042518
4930165865


Is this CSI?  Yes/No  Why?[/quote]
Ok, I wasn't being rude and you are not taking it that way...Good.

But are the numbers you posted CSI? No. Unless I'm missing something.....How are they even specified information at all?

Of course, I don't know what they represent but they just seem like a random listing of numbers to me at this point.

Have you read any of my or Dembski's writings using an archer to define specificity and calculating it?

It would seem germain to the subject should you want to learn that.

Interesting.  Because if you had the correct algorithm you would find these number to be very, very specific.

In other words, you can't use CSI to tell the difference between a random series of numbers and a series of non-random numbers.

So, what's the point in CSI?  It doesn't mean anything.  It doesn't tell us anything unique or useful about the real world.  

You do realize that any amino acid chain longer than 250 AAs is, by your definition "CSI" and therefore requiring intelligence. Do you realize that AA chains of nearly that length have been developed in the lab using the random attachments that you deplore as not being capable of forming CSI.

While we're at it, can you explain the 500 bit limit?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Henry J



Posts: 3734
Joined: Mar. 2005

(Permalink) Posted: Nov. 19 2012,21:41   

Quote
When did I define CSI as something that cannot evolve? Are you not aware of drug resistance in the mutation and hence evolution of certain organisms? Those organisms are certainly CSI.


You defined it this way:

Quote
CSI: Complex and specified information that when the odds for its existence are calculated and those odds exceed the UPB (upper probability boundary), could not occur by chance.


The stuff in that sentence was designed to say "it can't have evolved" without saying it in those words.

The phrase "odds for its existence" could mean either the odds for this exact result, or the odds for any result that we might call "alive". The problem with that is that calculations of odds can only be made for particular results, but the more general case is the one you're trying to say is improbable to the point of impossibility.

Henry

  
The whole truth



Posts: 899
Joined: Jan. 2012

(Permalink) Posted: Nov. 20 2012,04:28   

Jerry, who or what is the specifier? Where, when, and how did the specifier originally specify complex information?

Is there any 'CSI' in an atom, a rock, a star, a black hole, or a fossilized trilobite?

You say that all organisms exceed the (arbitrary) 500 bit line. Name a part of an organism that has less than 500 bits of 'CSI'. Also name a part that has 1500 bits of 'CSI'. Show your calculations.

--------------
Fellatio is in fact a type of sodomy - gordon e mullings

I don't even know what that means- "study CSI". - joe g

Joe G is the only person I have ever encountered who could start a fight in an empty room and still manage to lose. - Amadan

   
Cubist



Posts: 262
Joined: Oct. 2007

(Permalink) Posted: Nov. 20 2012,09:15   

Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

  
Jim_Wynne



Posts: 687
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,09:38   

Quote (Cubist @ Nov. 20 2012,09:15)
Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

This one's easy.  If it's not *obvious* that something is complex and specified, it's obviously *not* complex and specified.  And Modern ID Theorists don't need to calculate things that are obvious and easy to see for anyone not wearing the blinders of hidebound methological naturalism and goo-to-zoo-to-you "science."  Any fool can figure that out, so maybe you'd just better learn a little about Modern ID Theory® before you make a fool of yourself.  :angry:

--------------
Evolution is not about laws but about randomness on happanchance.--Robert Byers, at PT

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,09:49   

Quote (Jim_Wynne @ Nov. 20 2012,09:38)
This one's easy.  If it's not *obvious* that something is complex and specified, it's obviously *not* complex and specified.  And Modern ID Theorists don't need to calculate things that are obvious and easy to see for anyone not wearing the blinders of hidebound methological naturalism and goo-to-zoo-to-you "science."  Any fool can figure that out, so maybe you'd just better learn a little about Modern ID Theory® before you make a fool of yourself.  :angry:

DI : 7.0
AIG: 5.5
UD: 9.5

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
rossum



Posts: 148
Joined: Dec. 2008

(Permalink) Posted: Nov. 20 2012,09:56   

Quote (Cubist @ Nov. 20 2012,09:15)
So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

That is a very significant thing to do.  The NSA/GCHQ would be very interested in a distinguisher like that, which could tell the difference between an encoded message and junk.  It defeats one of the obvious ways to block traffic analysis -- just fill up the comm link with junk when it is not being used, so it always appears to be running at the same capacity.

The first attack against a cypher is often a distinguisher, that is a way to tell the output of the cypher from true random.  One of the attacks against the RC4 keystream (due to Mantin and Shamir) showed that the second byte of the keystream was 0x00 with a frequency of 1/128 instead of the expected 1/256.  Obviously that attack only works for RC4 and not for other cyphers.  What the Discovery Institute claims to have is a general distinguisher, valid for all current and future cyphers.  Hence they are in effect claiming to have a way to attack any cypher whatsoever.

If CSI really is such a distinguisher, then the Discovery Institute is being very unpatriotic in not offering it to the NSA immediately.

--------------
The ultimate truth is that there is no ultimate truth.

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:02   

Quote (OgreMkV @ Nov. 19 2012,18:29)
Quote (Jerry Don Bauer @ Nov. 19 2012,17:35)
OK.  If I am ignorant on the subject, it's because every creationist I've ever talked to has been utterly unable to explain or teach the concept.

Since any organism is over 500 bits... let's try this.

5093413647
5962916509
4066005562
8540770698
8342922442
0194220209
7331543188
7173101712
5811761471
3261216342
2525310538
4613627960
9767559584
8786679179
7022618236
5134707276
1505272783
6020313600
8013081724
2444671310
5268821392
0881048845
1181910939
0754282725
9802869949
3733118584
7969279971
8150134026
7987778049
5178595812
2668421641
8163467125
0645780953
5684243267
1401437548
9391680033
7856973231
7145812146
8632651141
7699167635
0557559516
8611985974
7805273622
9849541633
3279510329
7149754142
7096458973
6301485923
1880042518
4930165865


Is this CSI?  Yes/No  Why?

Ok, I wasn't being rude and you are not taking it that way...Good.

But are the numbers you posted CSI? No. Unless I'm missing something.....How are they even specified information at all?

Of course, I don't know what they represent but they just seem like a random listing of numbers to me at this point.

Have you read any of my or Dembski's writings using an archer to define specificity and calculating it?

It would seem germain to the subject should you want to learn that.

Interesting.  Because if you had the correct algorithm you would find these number to be very, very specific.

In other words, you can't use CSI to tell the difference between a random series of numbers and a series of non-random numbers.

So, what's the point in CSI?  It doesn't mean anything.  It doesn't tell us anything unique or useful about the real world.  

You do realize that any amino acid chain longer than 250 AAs is, by your definition "CSI" and therefore requiring intelligence. Do you realize that AA chains of nearly that length have been developed in the lab using the random attachments that you deplore as not being capable of forming CSI.

While we're at it, can you explain the 500 bit limit?[/quote]
Let's start over with some VERY basic premises........

Here is a number: 53739901284746603....is it CSI?

NO!

It's just a number that doesn't represent anything at all...I just made it up so how is it even information? Information communicates something to the observer.

Numbers in themselves aren't information.....one would have to know what the numbers are calculating....what do they represent? Then one can begin to make sense of it all.

the number 10 doesn't really mean anything...10 what? 10 pebbles, 10 planets, 10 good looking ladies, 10 drinks I had of my favorite whiskey last night? I have to know for 10 to mean anything to me as these "number 10s" have quite different meanings as I process information about them.

So let's start with numbers representing things. I have a pile of 2 pebbles, another pile of 10 pebbles and another pile of 100 pebbles....so how big a pile of pebbles would I have to have before I can calculate CSI?

Well, it might be argued that the bigger piles are more complex because, if we are viewing a pebble as information, 100 bits of information is certainly larger than one one bit and the whole of the parts seem more complex than the sum of one unit that comprise them.

But the truth is, it doesn't matter if I accumulate a billion pebbles in a pile, even if that pile might, by sheer volume be more complex, there is no specificity involved with the pile, therefore a pile of pebbles can never be CSI.

So is a simple pebble information?

Yes. I can be walking down a path, see some pebble laying in it and record in my mind that there are pebbles present. In fact, all matter is information, energy is information because it is also matter.....Einstein taught us that E=MC^2, therefore E=M=I.

But it is specificity and the intelligence it involves that CSI hinges on.......So, let's look at specificity, how it calculates out and how intelligence comes into play with that concept.

I have an archer. I blindfold him and place him in the middle of a huge stadium and tell him to shoot an arrow into the wall. He draws an arrow and plugs it into the wall quite handily.

Am I surprised? Of course not. The wall is so large, it surrounds him, I would be surprised if he DIDN'T hit the wall.

Now I paint the wall into a checkerboard with black and white squares and tell him to hit a black square. Now his odds go down in accomplishing this.

In fact, there is a 50% chance he will and a 50% chance he won't. But he does. I'm still not surprised any more than I would be if I flipped a coin and it comes up heads.

Then I paint the checkboard into 4 colors, then 8, then 16....but wait a minute, the archer is STILL hitting the color I tell him to? The odds of him doing so are becoming so high against him doing it that I'm beginning to suspect something here.

So, on the enormous wall of that giant stadium, I draw a little one inch circle, spin the archer around a few times and tell him to try to hit the tiny circle. He nails it dead center.

OK, only an idiot whould not begin to suspect that intelligence is involved here. Maybe he can see through the blindfold, maybe someone has a walkie talkie and he has a tiny receiver in his ear......Maybe he has ESP..SOMETHING..I don't know....but the odds are so low of him hitting that circle that, if he does, intelligence HAS to be involved somewhere in there.

In fact, once those odds get to be more than 1:10^150 against him (the UPB is reached) it becomes mathematically impossible that he will accomplish the task without intelligence somewhere in there.

So, can you also see how specificity is calculated? With one color he had a 1:1 chance, with 2 a 1:2 chance, with 16 colors a 1:16 chance etc. all the way up to 1:10^150 where he would have no chance at all.

Another post will follow to clarify more.....thanks for your interest

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:12   

So, and I'm not sure why, but there are those on here repeatedly requesting that I calculate the CSI of an organism as if that is some big deal.

In fact, many, including myself have accomplished this many times.

Here is an excerpt from some of my writings in that area doing exactly that:

If I flip a coin what are the odds of me getting heads or tails? 1:2. If I flip 50 coins and I get 25 heads and 25 tails, what are the odds when I flip that 51st coin that I will receive head or tails? 1:2. If I have flipped 99 coins and 47 have come up heads and 52 have come up tails, what are the odds for heads or tails in that 100th coin? 1:2.

Well what are the odds if I flip 100 coins they all will come up heads? 1:(.5^100). But what if I have already flipped 50 of the coins and 25 of them are tails and 25 of them are heads. Now what are the odds that all 100 coins will come up heads? They’re still the same 1:(.5^100). I’m not getting all heads, but with odds against me of getting them, I’m not surprised at the result.

So let’s place all 100 coins in a bag, shake them up all at once and see how many heads I get. What are these odds? 1:(.5^100). So it doesn’t really matter if I flip the coins all at once (a ‘poof’ as in spontaneous generation) or I flip them one at a time (individual, incremental steps), the odds in the big picture do not change.

Of course, chemical reactions are not coins and this happens a bit different in the real world.

For two atoms to “bond” (join together into a molecule) they must be within an “interacting neighborhood.” In fact, in order for two atoms to react together, they must be in the area of about 100 picometers (10 to the -10 power meters) in distance from one another.

The universe is big. And atoms must be moving in order to come into the “neighborhood” of another atom. The faster they are moving, the more opportunities they have to form a bond.

But this gets a little hairy because if they are moving too fast, the momentum will shoot them past each other before they can bond.

And, the temperature can‘t be too cold as reactions will not effectively occur and if it is too hot more bonds will be broken than are formed, and even when the temperatures are perfect, “bonds” of a long molecular chain may be broken simply because a random high energy atom or molecule knocks it loose. The point is, there is a certain finite number of opportunities available, even in 50 billion years for a reaction to occur in reality

For these reasons, Brewster and Morris concluded, based upon the size of the universe, the temperatures under which bonding occurs, the surmised age of the universe, the nature of bonds and how they form and break-- that 10 to the 67th power is the ultimate upper threshold for any chemical event to happen--anytime, anywhere in the universe, even in 50 billion years.

Dembski defines a universal probability bound of 10^-150, based on an estimate of the total number of processes that could have occurred in the universe since its beginning. Estimating the total number of particles in the universe at 10^80, the number of physical state transitions a particle can make at 10^45 per second (Planck time, the smallest physically meaningful unit of time) and the age of the universe at 10^25 seconds, thus the total number of processes involving at least one elementary particle is at most 1:10^150. Anything with a probability of less than 10^150 is unlikely to have occurred by chance. Previous to Dembski, statisticians concluded through Borel’s Law that 1:10^50 was the upper limit odds in which anything could actually happen.

The smallest known bacteria I’m aware of consists of around 500 proteins but I don’t think anyone would disagree with me that I am safe in using a 100 protein scenario in order to form an organism that could remotely be called life.

Proteins from which all of life is based are formed from amino acids. And these proteins are usually chains of from 50 to 50,000 amino acids.

Chemist, Stanley Miller showed long ago that under the correct conditions we can create amino acids in a beaker.

A chirality problem exists in that they come out completely “racemized.” The amino acids produced by Miller consisted of equal amounts of “right-handed” and “left-handed” molecules. The atoms that react to form amino acids bond together into cork-screw shapes--these cork-screws can curve to the right (right-handed) or to the left (left-handed). But a useable protein for life has to be composed entirely of left-handed molecules.

So, when an amino acid adds itself to a protein chain, the odds are one in two that it will be left-handed. That’s not a big deal if the protein chain is extremely short--say three amino acids long. Our probability would be one chance in 2 to the 3rd power or 1:8. That’s not bad odds for this type of thing.

So, let’s look at this primeval ooze from which that first protist popped and we are going to surmise that this ooze was racemized amino acids that had occurred naturally.

The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.

Well shoot, we are already past the Borel’s Law barrier with one tiny protein and we are nowhere near our organism. It would only take one more to catch up with Dembski’s UPB.

And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Now we can see why some Idists calculate that the odds against a fully functioning, much more complex human cell occurring by chance is one chance in 10 to the 100 billionth power. That’s one hundred billion zeroes. Us computer geeks can think of it as a 100 gigabyte hard drive full of nothing but zeroes.

And whether or not this cell forms one step at a time, or all at once, these odds don’t change.

Enjoy, my new friends.... :)

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Nov. 20 2012,10:13   

Quote
In fact, once those odds get to be more than 1:10^150 against him (the UPB is reached) it becomes mathematically impossible that he will accomplish the task without intelligence somewhere in there.

Relate this in a meaningful way to biology then.

As that's what ID is all about, biology and how it had a designer.

So how do you get from UPB  to life was designed?

HINT: No biologist (Darwinst or otherwise) claims that cells/proteins all assembled "all at once" in their current form.

The chances of that, all are already agreed, are well beyond the UPB.

Yet that's going to be your claim, that a protein used in biology must have been designed because the chances of finding that protein in protein possibility space is too low.

Yet nobody makes that claim. It's a strawman that people like you create in order to knock down to fool the credulous into believing that what you are doing is science.

It's just bad math is all. Nothing to do with biology at all.

So, go on, get from "UPB" to "life is designed" without invoking the "tornado in a junkyard" strawman.

Bet you can't. You and yours have never been able to understand the claims of modern biology. It's like you are a stuck record, stuck back when YEC was not quite the dodo it is now.

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:16   

I'm sorry, post before last did not post correctly and I see no way to edit it. My reply starts about 6 pararaphs into where you THINK it starts.

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,10:17   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
In fact, many, including myself have accomplished this many times.

Link to it.

Even a PDF that shows your work.

I bet you can't.  In fact, I KNOW that you can't.

Let me go farther.  You've never calculated the CSI of anything.

I've asked you several times now and you can't even tell me the basic process, much a process sufficiently robust that any person, anywhere in the world, could do the same thing and get the same result.

You can't even tell me what units CSI is measured in.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Nov. 20 2012,10:24   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

Bingo! Exactly as I predicted.

Your understanding of biology is woeful.

Your point is only valid if you assume that these proteins formed all at once.

What evidence do you have that is in fact the case?

Quote
So, and I'm not sure why, but there are those on here repeatedly requesting that I calculate the CSI of an organism as if that is some big deal.


Yet there is no list that says

Organism A has X CSI.
Organism B has Y CSI.

Is there?

I wonder why.....

Quote
In fact, many, including myself have accomplished this many times.

So where is the list?
Quote
The smallest known bacteria I’m aware of consists of around 500 proteins but I don’t think anyone would disagree with me that I am safe in using a 100 protein scenario in order to form an organism that could remotely be called life.

Your assumption that the first self-replicator resembled bacteria is unwarranted.

Unless, of course, you were there?

On what basis do you make this claim?
Quote
The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.


Tell me, what biological process is this related to? When you say "assemble" what biological process is it that you refer to?

When you say "usable" what do you mean? Usable for what? If I have two proteins that differ only slightly is one more "usable" then the other? What for?
Quote
Well shoot, we are already past the Borel’s Law barrier with one tiny protein and we are nowhere near our organism. It would only take one more to catch up with Dembski’s UPB.


This is not a problem, the problem is that your examples are not related to biology. Biology does not "assemble" 50,000 chained amino acids all in one go.
Quote
To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Yes, and nobody disagrees with you. You are quite right. But at the same time you are "not even wrong".

This organism will "never form" by all it's component pieces coming together all at once. What biologist is actually making the claim this is how life originated?

You are simply ignorant about the claims of modern biology  and I know this from a simple fact. You won't respond by relating your "The odds of assembling a protein that long are 1:10^15,000" example to actual biology.

Anyway, your IDiocy has been refuted in many places many times already. Nobody is fooled. In fact we're laughing at you.
Quote
When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Yet you have no problem "in reality" with a designer that hangs around for billions of years and behaves exactly as one would expect evolution to.

If the odds against a simplistic organism forming are 1:10^7400 then what are the odds of a designer forming that could create that organism? They must be higher? Yet that's what you believe happened!

LOL!

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:24   

You guys need to take a breather and read the posts...lol....everything you accuse me of NOT doing is right there in black and white...no need to link to anything, I posted it for you directly.....now, you need to directly attack the math I just threw your way...*wink*

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,10:32   

Quote (Cubist @ Nov. 20 2012,09:15)
Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

Hey Cubist:

It's correct...random garbage is not CSI...CSI must communicate.....

Language is not REALLY germain to CSI either unless we are somehow relating language to matter/energy....

And yes, we can distinguish meaningful information from garbage by honing into it's specificity....No specificity....no CSI...

The rest of that post pretty much shows a lack of understanding of the CSI concept......But you admit that up front and it's OK as I'm used to it......This will hopefully become clearer as we progress.

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,10:33   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:02)
Quote
Interesting.  Because if you had the correct algorithm you would find these number to be very, very specific.

In other words, you can't use CSI to tell the difference between a random series of numbers and a series of non-random numbers.

So, what's the point in CSI?  It doesn't mean anything.  It doesn't tell us anything unique or useful about the real world.  

You do realize that any amino acid chain longer than 250 AAs is, by your definition "CSI" and therefore requiring intelligence. Do you realize that AA chains of nearly that length have been developed in the lab using the random attachments that you deplore as not being capable of forming CSI.

While we're at it, can you explain the 500 bit limit?

Let's start over with some VERY basic premises........

Here is a number: 53739901284746603....is it CSI?

NO!

It's just a number that doesn't represent anything at all...I just made it up so how is it even information? Information communicates something to the observer.


You are confusing the "meaning" of the information with the "information" itself.  This is a fundamental mistake.

If you are only interested in the meaning of the information, then none of the mathematical treatments used for information can apply.  Why?

Let's look at a common phrase.

"The quick brown fox jumped over the lazy dog."

This is a highly complex sequence and, informationally speaking, it is difficult to compress because there are few repeated letters.  But in French...

"Le rapide goupil brun sauta par dessus le chien paresseux."

You see that the phrase is much longer and also contains many more repeated letters.  This is easier to compress than the English version.

Do these two versions have the same AMOUNT of CSI?  Yes/No... why?

Quote

Numbers in themselves aren't information.....one would have to know what the numbers are calculating....what do they represent? Then one can begin to make sense of it all.


Wrong.  This is the basic premise of cryptology.  You can perform informational functions on random numbers, pseudo-random numbers, and non-random numbers.

However, you can't extract meaning from random numbers.  You cannot extract meaning from pseudo-random numbers without additional information.

This continues to show that you don't even know what information you're talking about.

Quote

the number 10 doesn't really mean anything...10 what? 10 pebbles, 10 planets, 10 good looking ladies, 10 drinks I had of my favorite whiskey last night? I have to know for 10 to mean anything to me as these "number 10s" have quite different meanings as I process information about them.

So let's start with numbers representing things. I have a pile of 2 pebbles, another pile of 10 pebbles and another pile of 100 pebbles....so how big a pile of pebbles would I have to have before I can calculate CSI?


Let's say you have 1 pebble of feldspar.  Can you calculate the CSI of that highly ordered, very complex, and very, very specific mineral?

I bet you can't.

Quote

Well, it might be argued that the bigger piles are more complex because, if we are viewing a pebble as information, 100 bits of information is certainly larger than one one bit and the whole of the parts seem more complex than the sum of one unit that comprise them.

But the truth is, it doesn't matter if I accumulate a billion pebbles in a pile, even if that pile might, by sheer volume be more complex, there is no specificity involved with the pile, therefore a pile of pebbles can never be CSI.

So is a simple pebble information?

Yes. I can be walking down a path, see some pebble laying in it and record in my mind that there are pebbles present. In fact, all matter is information, energy is information because it is also matter.....Einstein taught us that E=MC^2, therefore E=M=I.

But it is specificity and the intelligence it involves that CSI hinges on.......So, let's look at specificity, how it calculates out and how intelligence comes into play with that concept.


Man, this is just babbling.

CSI is evidence of intelligence because CSI requires intelligence.

Do the words "circular reasoning" have any meaning for you or is just information?

Quote

I have an archer. I blindfold him and place him in the middle of a huge stadium and tell him to shoot an arrow into the wall. He draws an arrow and plugs it into the wall quite handily.

Am I surprised? Of course not. The wall is so large, it surrounds him, I would be surprised if he DIDN'T hit the wall.

Now I paint the wall into a checkerboard with black and white squares and tell him to hit a black square. Now his odds go down in accomplishing this.

In fact, there is a 50% chance he will and a 50% chance he won't. But he does. I'm still not surprised any more than I would be if I flipped a coin and it comes up heads.

Then I paint the checkboard into 4 colors, then 8, then 16....but wait a minute, the archer is STILL hitting the color I tell him to? The odds of him doing so are becoming so high against him doing it that I'm beginning to suspect something here.

So, on the enormous wall of that giant stadium, I draw a little one inch circle, spin the archer around a few times and tell him to try to hit the tiny circle. He nails it dead center.

OK, only an idiot whould not begin to suspect that intelligence is involved here.


Nice analogy, utterly meaningless.  I bet I could come up with a similar analogy that doesn't use any intelligence to pick out a single 1 cm^2 area inside the area of a football field... even an area within a football field filled with noise (in the information sense of the word, not the sound sense of the word).  And no intelligence required.

Want to bet that I can?

Quote

Maybe he can see through the blindfold, maybe someone has a walkie talkie and he has a tiny receiver in his ear......Maybe he has ESP..SOMETHING..I don't know....but the odds are so low of him hitting that circle that, if he does, intelligence HAS to be involved somewhere in there.


Saying it again and again doesn't make it true.  

There is no evidence here.  None.  Just claims of the incredulous.

Quote

In fact, once those odds get to be more than 1:10^150 against him (the UPB is reached) it becomes mathematically impossible that he will accomplish the task without intelligence somewhere in there.


Again, you are mistaken.  Because, again, within the entire universe the odds of a oxygen atom reacted with two specific hydrogens is way higher than your UPB.  However, the odds of an oxygen atom reacting with any two hydrogens approaches unity.

You are making a logical fallacy here.

Quote

So, can you also see how specificity is calculated? With one color he had a 1:1 chance, with 2 a 1:2 chance, with 16 colors a 1:16 chance etc. all the way up to 1:10^150 where he would have no chance at all.

Another post will follow to clarify more.....thanks for your interest

Here's the problem.

The protein for human hemoglobin, alpha 1 is about 30 kilobytes long.  Way beyond the UPB.

However, no biologist, no scientist thinks that human hemoglobin, alpha 1 just appeared, by chance.

If there were only two options (chance and intelligent design), then I think we could concede that something else was involved.

But there's not two options is there?  There's a third option, which you dismiss out of hand with no evidence.  That is evolution: common descent, selection, mutation.

Actually, there are only two options, but not the ones you think.  The only two options are chance and evolution.  Because there is no evidence that an intelligent designer even exists, much less is actually capable of performing actions claimed for him.

So, again, you have several logical fallacies in your statement here.  You have several fundamental errors in both fact and reasoning.  And you can't actually do the things you claim to do (and claim to have done).

edit to fix quotes

Edited by OgreMkV on Nov. 20 2012,10:36

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,10:48   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:24)
You guys need to take a breather and read the posts...lol....everything you accuse me of NOT doing is right there in black and white...no need to link to anything, I posted it for you directly.....now, you need to directly attack the math I just threw your way...*wink*

What do you need to calculate the CSI of an organism?

It's entire genome?
It's entire genome + associated memories and learned skills?
Every protein sequence that it needed to build the organism?

Since those big numbers are too scary for you, how about this?

Here's a gene sequence, what's the CSI for it?

5' CCTGGGTCACUAUAGGAAGAACACACUAUAGUGACCCAGGAAAAGACAAAUCUGCCCUUAGAGCUUGAGAACAUCUUCGGAUGCACGGGA
GGCAGCUCGCGAUGGAAGUAACGGACCCAGCGUUCUCAACAGUGUUCACAGAACCUUAAUGC 3'

What is the CSI? and was this therefore designed?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jim_Wynne



Posts: 687
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,10:57   

I'm really, really excited because I've just seen solid evidence of the occurence of a miracle!!  

I picked up a deck of cards and browsed through it, and realized that there is only a 1:8.06582E+67 chance that the cards could be in that particular order.  

PRAISE JEBUS!!!!

--------------
Evolution is not about laws but about randomness on happanchance.--Robert Byers, at PT

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:07   

Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

If you don't grasp what the term means in its most simplistic usage, there will be way to discuss the subject intelligently.

Where is the specificity in a random number, or a random sequence of nucleotides or the random order of a deck of cards?

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

Are there ANY on here who have ever actually studied the concept and rejected it out of science, math and logic rather than just poo-poo it because it makes them insecure in their religious beliefs?

I hope I haven't entered a cult hang-out here...*wink*

  
Robin



Posts: 1358
Joined: Sep. 2009

(Permalink) Posted: Nov. 20 2012,11:14   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

--------------
we IDists rule in design for the flagellum and cilium largely because they do look designed.  Bilbo

The only reason you reject Thor is because, like a cushion, you bear the imprint of the biggest arse that sat on you. Louis

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,11:14   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

If you don't grasp what the term means in its most simplistic usage, there will be way to discuss the subject intelligently.

Where is the specificity in a random number, or a random sequence of nucleotides or the random order of a deck of cards?

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

Are there ANY on here who have ever actually studied the concept and rejected it out of science, math and logic rather than just poo-poo it because it makes them insecure in their religious beliefs?

I hope I haven't entered a cult hang-out here...*wink*

Funny, all I see is someone who makes lots of claims, yet can't actually do the things he claims.  

I see someone who has had numerous logical, mathematical, and content errors pointed out to them.  I see that person refusing to even acknowledge those errors, much less try to understand and correct them.

I see someone who very well may understand CSI, but cannot explain the concept clearly and then blames others for his inability to teach.

Guess what, Jerry.  They are all you.

I predict a flounce pretty soon...

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:26   

Quote (Robin @ Nov. 20 2012,11:14)
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:28   

Quote (Robin @ Nov. 20 2012,11:14)
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

  
Southstar



Posts: 148
Joined: Nov. 2011

(Permalink) Posted: Nov. 20 2012,11:38   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.

And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Sorry your maths is way off... ever study statistics? You should look into that before doing probability calculations.

The odds against  a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” the power. Yes... and what happened to all the other variables? did the cat eat 'em?

One of the fundamental variables is the number of amino acids evolved. I.e. how many acids are singularly playing the game. It's all fine and dandy to say that it's very hard to win the lottery but if your chances of winning are 1:1 million you can bet that if one million people play someone's going to win. What you have to ask yourself is how many amino acids can fit in a square meter of primal pond then ask yourself how many cubic kilometres of pond you have.

The second variable is time. How many attempts at combining are being played per second and how much time do they have to hit a meaningful combination... you haven't put this in your equation.

Third you don't need to get the complete sequence in the first shot you could have a cumulative sequence which would mean that you don’t reset the game if say on first time you get a string of 5 amino acids.

Now why don't you rewrite your math and add these variables in...

--------------
"Cows who know a moose when they see one will do infinitely better than a cow that pairs with a moose because they cannot see the difference either." Gary Gaulin

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,11:38   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:26)
Quote (Robin @ Nov. 20 2012,11:14)
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
Thus far I have not received a single post that shows an understanding of the specificity in complex specified information.

...

Almost every post I have received thus far shows no understanding of the concept to a level that can even be addressed intelligently.

That may well be the case, Jerry, but if it is, whose fault is it? If none of us "CSI Skeptics" can demonstrate a real understanding of this "specificity in complex specified information", perhaps it's because you proponents aren't doing a good job of actually defining and expressing it.

Do let us know when you have a definition that we simpletons can actually grasp. One, preferably, that adheres to the scientific method.

I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

Because...

1) It's an ANALOGY
2) It doesn't actually have the steps needed to calculate the CSI of something alive (e.g. what do you need to know)
3) There are fundamental issues with the concepts you have presented that you have yet to deal with.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Southstar



Posts: 148
Joined: Nov. 2011

(Permalink) Posted: Nov. 20 2012,11:47   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:28)
I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

The analogy is NOT correct...

You need to multiply the number of archers, define the time per shot, set a total time available, allow for partial "close shots" that summed up give a hit (so as to allow for cumulative aggregation of the acids)

--------------
"Cows who know a moose when they see one will do infinitely better than a cow that pairs with a moose because they cannot see the difference either." Gary Gaulin

  
Richardthughes



Posts: 9472
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,11:54   

Jerry Don Bauer - you are a bullshitter. And not a very good one. That is all.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,11:55   

Are there any scientists in here other than Wesley? Thus far it seems, I'm only getting posts (with a couple exceptions, maybe) from religionists from whom I glean I'm offending by attempting to discuss thought with them.....

Never met so many religionists on what I thought was a science forum...oh well...

  
Richardthughes



Posts: 9472
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,11:56   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:55)
Are there any scientists in here other than Wesley? Thus far it seems, I'm only getting posts (with a couple exceptions, maybe) from religionists from whom I glean I'm offending by attempting to discuss thought with them.....

Never met so many religionists on what I thought was a science forum...oh well...



--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Richardthughes



Posts: 9472
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,11:58   

Put up or shut up.

Calculate the CSI of something organic. If you can. If you can't, we'll take that as evidence that you don't understand or can't apply CSI, or that CSI itself is unusable.

Thanks for playing.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Richardthughes



Posts: 9472
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,12:00   

Bonus:

http://forums.carm.org/vbb....27.html

"Are there any real scientists here?" LOL you fucking tard.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
fnxtr



Posts: 1805
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,12:08   

Quote (Southstar @ Nov. 20 2012,09:47)
 
Quote (Jerry Don Bauer @ Nov. 20 2012,11:28)
I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?

In fact, it's just a take off of the same analogy the inventor of the term CSI used....

But on that, I didn't receive a single comment..LOL....

What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).

The analogy is NOT correct...

You need to multiply the number of archers, define the time per shot, set a total time available, allow for partial "close shots" that summed up give a hit (so as to allow for cumulative aggregation of the acids)

So specificity is (AI)*(FLW). *

Got it. Thanks.

* Argument from incredulity multiplied by the lottery winner fallacy.

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
Robin



Posts: 1358
Joined: Sep. 2009

(Permalink) Posted: Nov. 20 2012,12:09   

[quote=Jerry Don Bauer,Nov. 20 2012,11:28][/quote]
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?


The archer analogy is terrible! Why? Because it's erroneous. First, the archer analogy doesn't even offer a scenario in which intelligence is required, so it fails outright. But even as a rebuttal to evolution it's inane because it relies on the fallacy of large numbers and the failure to take "genetic memory" (heredity) into account. The fact is, successful biological compounds are remembered; the archer's successful hits are not. Bottom line, your concept thus far makes no sense because too much of it is erroneous.

Quote
What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).


You may think you've defined it precisely, but you are wholly mistaken on that count. Your analogies are fallacious and do not in fact reflect reality. To make matters worse, you've yet to provide any substantiation for the base claims - that you can actually calculate CSI. Thus far, I can only conclude that this "CSI" has no value to anything, never mind just science.

--------------
we IDists rule in design for the flagellum and cilium largely because they do look designed.  Bilbo

The only reason you reject Thor is because, like a cushion, you bear the imprint of the biggest arse that sat on you. Louis

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,12:09   

Quote (Jerry Don Bauer @ Nov. 20 2012,11:55)
Are there any scientists in here other than Wesley? Thus far it seems, I'm only getting posts (with a couple exceptions, maybe) from religionists from whom I glean I'm offending by attempting to discuss thought with them.....

Never met so many religionists on what I thought was a science forum...oh well...

Anything to get out of having to actually explain or do, huh?

That's OK.  We get that a lot.  We totally understand that you are incapable of supporting your claims.  We understand that you are incapable of explaining your notions, assumptions, and 'calculations'.

We also understand that really don't understand what we're talking about.  We understand that you don't know what evidence is and how science actually works.

We don't like it, but we understand it.

Now, you have numerous questions and many, many requests for a calculation to be done.  You've said that you've done so many times, but refuse to create a hyperlink to a place that has such information.  You refuse to perform such measurements or calculations here for us.  You refuse to even explain how one would begin to gather the information needed for such an event.

Several people (including myself) have provided you with information (not meaning, but information) in order that you calculate or measure CSI.  You have not done so.

You can't identify strings with CSI or without CSI without being told what the function of those strings are.  You "looked" at my list of numbers and decided that they were random.  You didn't calculate the CSI of those numbers to determine if an intelligence was involved in creating them.

There is an RNA sequence a few posts above this, go ahead, determine the CSI of that RNA sequence.  You won't do it.  We all know you won't do it.  You are smart enough to realize that it's a trap.  

If you guess wrong, then your entire worldview about ID and CSI and the like will come crashing down around your ears.  You can't stomach that idea.  If you guess right (and it will be a guess), then you probably think (with good reason) that I have an ace up my sleeve about that particular sequence.  You don't know what it is, but you know it's a trap.

And that's only one reason that ID is utterly without value.  You can't afford to actually do anything with it, because deep down, you know the entire concept is riddled with error, inconsistency, and crap.  You know you will be challenged, that's how science works.  But you can't let yourself be pinned on something because you know that science and math actually do work and ID doesn't.

So, again, you have a lot of fundamental errors in your work so far.  You have a lot of logical fallacies in your work so far.  You claim that analogies are equivalent to calculations.  You think that there are only two choices (random or designed).  You think that information = meaning.

So, anytime you would like to actually do something, let me know.  Or you can keep on exposing your utter and complete ignorance by ignoring what we are asking and continuing your 'insults' (or whatever they are) instead of actually talking to us.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
stevestory



Posts: 8332
Joined: Oct. 2005

(Permalink) Posted: Nov. 20 2012,12:21   

Quote (Southstar @ Nov. 20 2012,12:38)
Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.

And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Sorry your maths is way off... ever study statistics? You should look into that before doing probability calculations.

The odds against  a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” the power. Yes... and what happened to all the other variables? did the cat eat 'em?

One of the fundamental variables is the number of amino acids evolved. I.e. how many acids are singularly playing the game. It's all fine and dandy to say that it's very hard to win the lottery but if your chances of winning are 1:1 million you can bet that if one million people play someone's going to win. What you have to ask yourself is how many amino acids can fit in a square meter of primal pond then ask yourself how many cubic kilometres of pond you have.

The second variable is time. How many attempts at combining are being played per second and how much time do they have to hit a meaningful combination... you haven't put this in your equation.

Third you don't need to get the complete sequence in the first shot you could have a cumulative sequence which would mean that you don’t reset the game if say on first time you get a string of 5 amino acids.

Now why don't you rewrite your math and add these variables in...

He would also have to include quite a bit of additional work because not all amino acids are equally likely to bond with a given amino acid. So he's got about n!/(r!(n-r)!) = (21*20)/2 =210 reactions he needs to separately consider in his dumbass 'calculation'.

Get to work Jerry! Lots of fake science to keep you busy. When you're done you should submit it to PCID. After the Kitzmiller trial, for some reason they ran out of 'research' to publish. Damnedest thing I've ever seen. Almost like it wasn't actual research, but propaganda that was suddenly useless....

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,13:03   

Quote (Robin @ Nov. 20 2012,12:09)
Quote (Jerry Don Bauer @ Nov. 20 2012,11:28)

 
Quote (Jerry Don Bauer @ Nov. 20 2012,11:07)
I just walked you through the analogy of the archer along with how specificity is calculated....how can you guys not grasp that?


The archer analogy is terrible! Why? Because it's erroneous. First, the archer analogy doesn't even offer a scenario in which intelligence is required, so it fails outright. But even as a rebuttal to evolution it's inane because it relies on the fallacy of large numbers and the failure to take "genetic memory" (heredity) into account. The fact is, successful biological compounds are remembered; the archer's successful hits are not. Bottom line, your concept thus far makes no sense because too much of it is erroneous.

 
Quote
What is it you wish me to do, I've defined it precisely and showed the thread in very simplistic terms how to use it and what people do with it....It's a very simple concept using high school mathematics (or lower).


You may think you've defined it precisely, but you are wholly mistaken on that count. Your analogies are fallacious and do not in fact reflect reality. To make matters worse, you've yet to provide any substantiation for the base claims - that you can actually calculate CSI. Thus far, I can only conclude that this "CSI" has no value to anything, never mind just science.

Well, at least you are responding with intelligence and civility........

1) The archer scenario shows the specificity of the information of arrows hitting a target. It was the FIRST analogy used, to my knowledge, to show the initiator's intentions when he proposed the concept of CSI.

Forget the complexity factor in the term....that's what you people seem hung up on...the way you are viewing complexity in the term: complex specified information is just muddling your understanding of the entire concept because it is the specificity that is calculated.

And can you get off the "rebuttle to evolution", genetic memory, biological compounds, the fact that some seem to think I'm calculating the return of Jesus or maybe that Moses wore sideburns? LOL...I never even mentioned any of that..I'm just attempting to get you guys to understand what the heck you are talking about on the basal level. Then maybe we can expand on it.

I also wonder what you are discussing in the other threads when you throw around these big words...I would wager you don't know what any of the other terms mean either.

As to your accusation that that I'm just throwing out meaningless data...I gave you actual calculations...where are all those mathematicians that were crowding that guy in another post....LOL...I calculated CSI in an organism. To attempt to pretend I didn't is simply intellectual dishonesty although I will withhold judgement on the latter for another time..

  
Richardthughes



Posts: 9472
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,13:15   

Mathematical example?

Thanks.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
Robin



Posts: 1358
Joined: Sep. 2009

(Permalink) Posted: Nov. 20 2012,13:25   

Quote (Jerry Don Bauer @ Nov. 20 2012,13:03)

Quote (Jerry Don Bauer @ Nov. 20 2012,11:28)
1) The archer scenario shows the specificity of the information of arrows hitting a target. It was the FIRST analogy used, to my knowledge, to show the initiator's intentions when he proposed the concept of CSI.


You're missing the point Jerry. The analogy fails because it doesn't actually demonstrate a requirement of specificity. There in lies the problem. It's basically a circular analogy - it relies upon the assumption of specificity to try to show that specificity is required.

Quote
And can you get off the "rebuttle to evolution", genetic memory, biological compounds...


No, I can't. You see, those things are part of the reason your claims are erroneous.

Quote
As to your accusation that that I'm just throwing out meaningless data...I gave you actual calculations...where are all those mathematicians that were crowding that guy in another post....LOL...I calculated CSI in an organism. To attempt to pretend I didn't is simply intellectual dishonesty although I will withhold judgement on the latter for another time.


Sorry Jerry, but I don't see it. I've gone back through the thread and see nothing that even remotely looks like a calculation of the CSI of an organism. Feel free to reference the specific calculation in your response.

--------------
we IDists rule in design for the flagellum and cilium largely because they do look designed.  Bilbo

The only reason you reject Thor is because, like a cushion, you bear the imprint of the biggest arse that sat on you. Louis

  
fnxtr



Posts: 1805
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,13:41   

Quote
6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


Ok, so...  those long stretches of repeats, those all count as individual bits, right?

What's the CSI of one gram of table salt?

You know, if you measured the chances of each particular phosphorus atom ending up in my DNA, you'd get a way bigger number, why not use that instead? Or the chances of my parents meeting?

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
The whole truth



Posts: 899
Joined: Jan. 2012

(Permalink) Posted: Nov. 20 2012,14:13   

Quote (Robin @ Nov. 20 2012,11:25)
[quote=Jerry Don Bauer,Nov. 20 2012,13:03][/quote]
Quote (Jerry Don Bauer @ Nov. 20 2012,11:28)
1) The archer scenario shows the specificity of the information of arrows hitting a target. It was the FIRST analogy used, to my knowledge, to show the initiator's intentions when he proposed the concept of CSI.


You're missing the point Jerry. The analogy fails because it doesn't actually demonstrate a requirement of specificity. There in lies the problem. It's basically a circular analogy - it relies upon the assumption of specificity to try to show that specificity is required.

Quote
And can you get off the "rebuttle to evolution", genetic memory, biological compounds...


No, I can't. You see, those things are part of the reason your claims are erroneous.

Quote
As to your accusation that that I'm just throwing out meaningless data...I gave you actual calculations...where are all those mathematicians that were crowding that guy in another post....LOL...I calculated CSI in an organism. To attempt to pretend I didn't is simply intellectual dishonesty although I will withhold judgement on the latter for another time.


Sorry Jerry, but I don't see it. I've gone back through the thread and see nothing that even remotely looks like a calculation of the CSI of an organism. Feel free to reference the specific calculation in your response.

I also don't see a calculation of the 'CSI' of an organism. I just see some unsubstantiated assertions about probabilities and other irrelevant stuff, and avoidance of relevant questions.

--------------
Fellatio is in fact a type of sodomy - gordon e mullings

I don't even know what that means- "study CSI". - joe g

Joe G is the only person I have ever encountered who could start a fight in an empty room and still manage to lose. - Amadan

   
Cubist



Posts: 262
Joined: Oct. 2007

(Permalink) Posted: Nov. 20 2012,14:16   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:32)
     
Quote (Cubist @ Nov. 20 2012,09:15)
       
Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

Hey Cubist:

It's correct...random garbage is not CSI...CSI must communicate.....

Language is not REALLY germain to CSI either unless we are somehow relating language to matter/energy....

Hold it.
Language is "not REALLY germain" to something that, according to you, "must communicate"? How in the name of Klono's curving carballoy claws can language NOT be "germain" to anything for which "communication" is necessary?
Do you actually read any of the verbiage you type, Jerry?

 
Quote
And yes, we can distinguish meaningful information from garbage by honing into it's specificity....No specificity....no CSI...

Yes, and one of those two strings is very specific indeed, being that it's an encrypted version of a particular English text. So according to this "honing into its specificity" schtick, yes, a CSI-detecting protocol should be able to distinguish between encrypted text and random garbage.
So. Since you assert that you are, indeed, able to "distinguish meaningful information from garbage by honing into its specificity", would you care to actually, like, you know, distinguish meaningful information from garbage by honing into its specificity? By, let us say, identifying which of two apparently-random strings is, in fact, not random at all, but, rather, is encrypted text?

 
Quote
The rest of that post pretty much shows a lack of understanding of the CSI concept... But you admit that up front and it's OK as I'm used to it......This will hopefully become clearer as we progress.

Since language is, apparently, "not REALLY germain" to this CSI thingie that "must communicate"… and since you didn't even pretend to use this CSI thingie to determine which of the two strings was the encrypted text… I strongly doubt that further discussion will arrive at any outcome even vaguely reminiscent of 'clearer'. Except perhaps in the sense that it will become increasingly more clear that you ain't got nothin' but bullshit…

  
RumraketR



Posts: 2
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,14:32   

Quote (Jerry Don Bauer @ Nov. 19 2012,16:37)
Comparing the genome to computer data storage. In order to represent a DNA sequence on a computer, we need to be able to represent all 4 base pair possibilities in a binary format (0 and 1). These 0 and 1 bits are usually grouped together to form a larger unit, with the smallest being a “byte” that represents 8 bits. We can denote each base pair using a minimum of 2 bits, which yields 4 different bit combinations (00, 01, 10, and 11).  Each 2-bit combination would represent one DNA base pair.  A single byte (or 8 bits) can represent 4 DNA base pairs.  In order to represent the entire diploid human genome in terms of bytes, we can perform the following calculations:

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


http://bitesizebio.com/article....-genome

is 1.5 Gigabytes more than 500 bits? Then why would we want to go any further than this as you already have the answer before you start.

ANY organism will be over 500 bits.[/quote]
Hello everyone, I've been a lurker here for a few years now and I just have to respond because this could be historical stuff.

I want to make sure I understand you correctly here, Jerry Don Bauer, because according to what I have quoted, you seem to be saying that the quantity of information in a string of symbols is equal to the length of the string divided by the number of possible symbols at each locus? As in the information content is measured in bits and is thus proportional to the length of the sequence?

You refer to the example of a 6 billion base-pair diploid genome, divided by the number of possibilities pr site (4):

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!

In other words, the information content of a sequence of DNA, for example 12 base-pairs in length, AUGAATAUGTTA, is equal to 12 base pairs x 1 byte/4 base pairs = 3 bytes.

Am I correct in my understanding here?

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,15:02   

[quote=Robin,Nov. 20 2012,13:25][/quote]
Quote
You're missing the point Jerry. The analogy fails because it doesn't actually demonstrate a requirement of specificity. There in lies the problem. It's basically a circular analogy - it relies upon the assumption of specificity to try to show that specificity is required.


There is NO assumptions and it readily demonstrates specificity in a manner that is easily calculated. As the archer's chances of hitting an assigned target decreases, specificity increases...that is what specificity IS.....I'm just trying to show what it is at this point as no one on here seems to know.

It DOESN'T say anything about specificity being required for anything and indeed specificity is not even present in some systems. I have never hinted otherwise.

In fact, I've yet to be presented anything by the posters in here as an example that contained specificity to consider to begin with...that's why I've reverted to some middle school level examples here...

Quote
No, I can't. You see, those things are part of the reason your claims are erroneous.


I haven't MADE any claims....if you think I have, please link to them and I will clarify. I'm trying to get everyone on the same page as to what CSI even IS before we discuss it.  It's not calculations of Jesus coming, that you did or didn't magically morph from an ape, that Darwinsim is science or a crock or anything similar. It's just very simple statistics.

 
Quote
As to your accusation that that I'm just throwing
Sorry Jerry, but I don't see it. I've gone back through the thread and see nothing that even remotely looks like a calculation of the CSI of an organism. Feel free to reference the specific calculation in your response.


Well, in response to several accusations (out of ignorance, I suppose) I was challenged to show how one would go about calculating the CSI of living tissue and I simply posted some of my own writings:

"The smallest known bacteria I’m aware of consists of around 500 proteins but I don’t think anyone would disagree with me that I am safe in using a 100 protein scenario in order to form an organism that could remotely be called life.

Proteins from which all of life is based are formed from amino acids. And these proteins are usually chains of from 50 to 50,000 amino acids.

Chemist, Stanley Miller showed long ago that under the correct conditions we can create amino acids in a beaker.

A chirality problem exists in that they come out completely “racemized.” The amino acids produced by Miller consisted of equal amounts of “right-handed” and “left-handed” molecules. The atoms that react to form amino acids bond together into cork-screw shapes--these cork-screws can curve to the right (right-handed) or to the left (left-handed). But a useable protein for life has to be composed entirely of left-handed molecules.

So, when an amino acid adds itself to a protein chain, the odds are one in two that it will be left-handed. That’s not a big deal if the protein chain is extremely short--say three amino acids long. Our probability would be one chance in 2 to the 3rd power or 1:8. That’s not bad odds for this type of thing.

So, let’s look at this primeval ooze from which that first protist popped and we are going to surmise that this ooze was racemized amino acids that had occurred naturally.

The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.

Well shoot, we are already past the Borel’s Law barrier with one tiny protein and we are nowhere near our organism. It would only take one more to catch up with Dembski’s UPB.

And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Now we can see why some Idists calculate that the odds against a fully functioning, much more complex human cell occurring by chance is one chance in 10 to the 100 billionth power. That’s one hundred billion zeroes. Us computer geeks can think of it as a 100 gigabyte hard drive full of nothing but zeroes.

And whether or not this cell forms one step at a time, or all at once, these odds don’t change."

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,15:04   

Quote (fnxtr @ Nov. 20 2012,13:41)
Quote
6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


Ok, so...  those long stretches of repeats, those all count as individual bits, right?

What's the CSI of one gram of table salt?

You know, if you measured the chances of each particular phosphorus atom ending up in my DNA, you'd get a way bigger number, why not use that instead? Or the chances of my parents meeting?

There is NO specificity in a gram of table salts...you guys are just lost.....*grin*

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,15:11   

Quote (Cubist @ Nov. 20 2012,14:16)
Quote (Jerry Don Bauer @ Nov. 20 2012,10:32)
       
Quote (Cubist @ Nov. 20 2012,09:15)
         
Quote (Jerry Don Bauer @ Nov. 19 2012,12:55)

And why do you have trouble defining CSI? It is a well defined concept of modern ID thought.... is it information that calculates out above the upper probability bound? Is it specified information? Then, if it is both complex and specified it is therefore CSI...

Since you seem to think CSI is, in fact, a well-defined concept, Jerry, I have a question for you. But before I ask my question, I have to explain a bit of background.
Now, I don't pretend to be fully au courant with all the niceties of this CSI thingie, but if my limited understanding is correct,
  • Random garbage doesn't have any CSI
  • Meaningful language does have CSI
  • Converting a statement from one format to another (as, for instance, using an encryption algorithm to make a meaningful statement difficult to read) does not alter the statement's CSI.

So if this CSI thingie genuinely is the sure-fire Design-detection tool which you ID-pushers assert it to be, it seems to me that you should be able to use it to distinguish random garbage from meaningful text that only appears to be random garbage.

Background explained. Here's the question:

Which of the following character strings, String A or String B, is the encrypted text, and which is the garbage? And please show your work, so we know you're not just guessing.
Character string A:
Code Sample
={¡†¿ ¬&={‹ +ZrKU hg"Ix œgFZ" uaM?j œ?Uhg
>”H¿œ jCZrK ,MjRœ Lu"gF ZœKZ¢ g[)Zh Z"KXM
gcR"K XMgaX -KcZY [†lœX œ??U? ?waR, XmŒwM
Zvœ>Z ngo”_ v”U’T XV Xv Zuyw… y ,.! ¡‡!…&

String B:
Code Sample
jk?2J ^'VE¡ ?hS-c Z†“(# ]'6"8 0‹cWd Yfv”
BlGæB “a”?" B2#“_ 9‹g¡y £B…?J @Se&y ¬œ4Sp
…'T4? #ƒq”- 6[¢Of 1#3?} œ-§”÷ UTe…T Fdg›“
O÷iŒ. H¬^¿- ¢?Jv= ±1Q^o ‘O];v :?QE( 5qŒ3L

Hey Cubist:

It's correct...random garbage is not CSI...CSI must communicate.....

Language is not REALLY germain to CSI either unless we are somehow relating language to matter/energy....

Hold it.
Language is "not REALLY germain" to something that, according to you, "must communicate"? How in the name of Klono's curving carballoy claws can language NOT be "germain" to anything for which "communication" is necessary?
Do you actually read any of the verbiage you type, Jerry?

   
Quote
And yes, we can distinguish meaningful information from garbage by honing into it's specificity....No specificity....no CSI...

Yes, and one of those two strings is very specific indeed, being that it's an encrypted version of a particular English text. So according to this "honing into its specificity" schtick, yes, a CSI-detecting protocol should be able to distinguish between encrypted text and random garbage.
So. Since you assert that you are, indeed, able to "distinguish meaningful information from garbage by honing into its specificity", would you care to actually, like, you know, distinguish meaningful information from garbage by honing into its specificity? By, let us say, identifying which of two apparently-random strings is, in fact, not random at all, but, rather, is encrypted text?

   
Quote
The rest of that post pretty much shows a lack of understanding of the CSI concept... But you admit that up front and it's OK as I'm used to it......This will hopefully become clearer as we progress.

Since language is, apparently, "not REALLY germain" to this CSI thingie that "must communicate"… and since you didn't even pretend to use this CSI thingie to determine which of the two strings was the encrypted text… I strongly doubt that further discussion will arrive at any outcome even vaguely reminiscent of 'clearer'. Except perhaps in the sense that it will become increasingly more clear that you ain't got nothin' but bullshit…

OK stop.........Do you really think that probability statistics apply to words we use? How would one go about calculating this? There is NO specificity in a string of words.......how would the use of previous words dictate the probable origin or use of future ones?

CSI, as I have previously pointed out, deals with matter/energy and its information content....What got you off into languages?

  
Richardthughes



Posts: 9472
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,15:28   

Quote (Jerry Don Bauer @ Nov. 20 2012,15:11)
[snip]
OK stop.........Do you really think that probability statistics apply to words we use? How would one go about calculating this? There is NO specificity in a string of words.......how would the use of previous words dictate the probable origin or use of future ones?

CSI, as I have previously pointed out, deals with matter/energy and its information content....What got you off into languages?

You are massively ignorant:

https://www.google.com/#q=natu....bih=673

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,15:33   

OK, let's try this analogy crap.

Jerry,  there are two barns.  Both of the barns have an arrow sticking the wall.  Both of those arrows are in the center of a bull's eye with no fewer than 3 concentric circles drawn around them.

How do you know that these aren't Texas sharpshooter fallacies?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,15:34   

[quote=RumraketR,Nov. 20 2012,14:32][/quote]
Quote
Hello everyone, I've been a lurker here for a few years now and I just have to respond because this could be historical stuff.


Welcome...I do tend to bring em out of the back bleachers...*wink*

Quote
I want to make sure I understand you correctly here, Jerry Don Bauer, because according to what I have quoted, you seem to be saying that the quantity of information in a string of symbols is equal to the length of the string divided by the number of possible symbols at each locus? As in the information content is measured in bits and is thus proportional to the length of the sequence?


No...not quite right. While I'm comfortable discussing information theory and often do (and we may get there), I haven't really up to this point other than a brief mention of bits courtesy of Claude Shannon.

We are discussing Complex Specified Information and what makes certain information complex, or not and/or specified or not.

This has little to do with the length of anything or the amount of loci it harbors.

Quote
You refer to the example of a 6 billion base-pair diploid genome, divided by the number of possibilities pr site (4):

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!

In other words, the information content of a sequence of DNA, for example 12 base-pairs in length, AUGAATAUGTTA, is equal to 12 base pairs x 1 byte/4 base pairs = 3 bytes.

Am I correct in my understanding here?


You are referring to a link I referrenced. The purpose of that link was to show that even a genome contains much more information than the 500 bits upper probability boundary. Therefore, an entire organism most certainly would be over 500 bits and therefore CSI.....

That was all I was pointing out.....I certainly did not want to get into genomic entropy and the like at this point.

  
fnxtr



Posts: 1805
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,15:43   

Quote (Jerry Don Bauer @ Nov. 20 2012,13:04)
Quote (fnxtr @ Nov. 20 2012,13:41)
Quote
6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


Ok, so...  those long stretches of repeats, those all count as individual bits, right?

What's the CSI of one gram of table salt?

You know, if you measured the chances of each particular phosphorus atom ending up in my DNA, you'd get a way bigger number, why not use that instead? Or the chances of my parents meeting?

There is NO specificity in a gram of table salts...you guys are just lost.....*grin*

Quote
CSI: Complex and specified information that when the odds for its existence are calculated and those odds exceed the UPB (upper probability boundary), could not occur by chance.


Then it should be easy for you to show that one gram of salt does not meet this criterion.

To show that, you must know the concentration of the original chemicals, ambient temperature, energy of reaction, dilution, and so on.

Clearly, not a realistic expectation.

Then you have to know the same conditions for whatever it is that you claim has CSI.

Again, clearly not a realistic expectation.

So we're back to "Wow, that sure looks complicated, must be designed."

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,15:51   

Quote (fnxtr @ Nov. 20 2012,15:43)
Quote (Jerry Don Bauer @ Nov. 20 2012,13:04)
 
Quote (fnxtr @ Nov. 20 2012,13:41)
 
Quote
6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!


Ok, so...  those long stretches of repeats, those all count as individual bits, right?

What's the CSI of one gram of table salt?

You know, if you measured the chances of each particular phosphorus atom ending up in my DNA, you'd get a way bigger number, why not use that instead? Or the chances of my parents meeting?

There is NO specificity in a gram of table salts...you guys are just lost.....*grin*

 
Quote
CSI: Complex and specified information that when the odds for its existence are calculated and those odds exceed the UPB (upper probability boundary), could not occur by chance.


Then it should be easy for you to show that one gram of salt does not meet this criterion.

To show that, you must know the concentration of the original chemicals, ambient temperature, energy of reaction, dilution, and so on.

Clearly, not a realistic expectation.

Then you have to know the same conditions for whatever it is that you claim has CSI.

Again, clearly not a realistic expectation.

So we're back to "Wow, that sure looks complicated, must be designed."

What on earth are you talking about....LOL

A pile of salt is not CSI no matter what you do to it....

Can you explain how this has ANYTHING to do with what we're talking about?

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,16:02   

Jerry, let me tell you a story.

I'm doing some work right now and one of the things I had to do was compute the escape velocity for the asteroid Vesta4.  So, I got the mean radius and the approximate mass and ended up with an escape velocity of 363 and change m/s.  I thought, that's way to high, I must have made a mistake.

I figured and a looked up G and verified it.  I verified the equation I was using.  I got some other people to check my math and they agreed with me.  

We fussed on this for three days.

Then, I got a bright idea.  I looked up the escape velocity for Vesta.  Amazingly, NASA recently sent a mission there.  Turns out, the math was right... it was my thinking that was wrong.

The moral of the story is that thinking can be wrong.  So, why don't you give us the formulas so we can actually do the math.

Oh wait, you can't do that because we all know IT DOESN'T EXIST.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
fnxtr



Posts: 1805
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,16:08   

Okay, either you have not explained it clearly, or I misunderstood you.

Perhaps you meant there is no complexity in salt, because it is most definitely specified, not just any molecules will do.

Quote
CSI: Complex and specified information that when the odds for its existence are calculated and those odds exceed the UPB (upper probability boundary), could not occur by chance.


So, CSI only applies to organic chemistry, then?

Help me out here.

Which organic molecules have CSI and which do not?

Is CSI just calcuated by the size of the genome? (Do replication errors affect CSI? Why or why not?) Or do proteins show CSI, too? What about the carbohydrates?  Long chain polymers?  Membranes?

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
The whole truth



Posts: 899
Joined: Jan. 2012

(Permalink) Posted: Nov. 20 2012,16:09   

"A pile of salt is not CSI no matter what you do to it...."

How do you know that? What did you measure/analyze in salt that enabled you to arrive at your conclusion?

I notice that you said "is not CSI" rather than has no CSI. Is that wording significant, and does it matter if it's a "pile of salt" versus a gram of table salt?

What if the salt (whether 'table' or otherwise) is in an organism? Would that have any effect on whether the salt has any CSI? And would the amount of salt in an organism affect the amount of CSI in the organism?

--------------
Fellatio is in fact a type of sodomy - gordon e mullings

I don't even know what that means- "study CSI". - joe g

Joe G is the only person I have ever encountered who could start a fight in an empty room and still manage to lose. - Amadan

   
RumraketR



Posts: 2
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,16:18   

Quote (Jerry Don Bauer @ Nov. 20 2012,15:34)
Quote (Jerry Don Bauer @ Nov. 20 2012,15:51)
We are discussing Complex Specified Information and what makes certain information complex, or not and/or specified or not.

This has little to do with the length of anything or the amount of loci it harbors.

Quote
You refer to the example of a 6 billion base-pair diploid genome, divided by the number of possibilities pr site (4):

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!

In other words, the information content of a sequence of DNA, for example 12 base-pairs in length, AUGAATAUGTTA, is equal to 12 base pairs x 1 byte/4 base pairs = 3 bytes.

Am I correct in my understanding here?

You are referring to a link I referrenced. The purpose of that link was to show that even a genome contains much more information than the 500 bits upper probability boundary. Therefore, an entire organism most certainly would be over 500 bits and therefore CSI.....


That was all I was pointing out.....I certainly did not want to get into genomic entropy and the like at this point.

Quote (Jerry Don Bauer @ Nov. 20 2012,15:51)
We are discussing Complex Specified Information and what makes certain information complex, or not and/or specified or not.

This has little to do with the length of anything or the amount of loci it harbors.

Quote
You refer to the example of a 6 billion base-pair diploid genome, divided by the number of possibilities pr site (4):

6×10^9 base pairs/diploid genome x 1 byte/4 base pairs = 1.5×10^9 bytes or 1.5 Gigabytes, about 2 CDs worth of space!

In other words, the information content of a sequence of DNA, for example 12 base-pairs in length, AUGAATAUGTTA, is equal to 12 base pairs x 1 byte/4 base pairs = 3 bytes.

Am I correct in my understanding here?

You are referring to a link I referrenced. The purpose of that link was to show that even a genome contains much more information than the 500 bits upper probability boundary. Therefore, an entire organism most certainly would be over 500 bits and therefore CSI.....

Okay, fair enough, I think I understand. But just to be sure, you agree the quantity of information in the genome there is 1.5 gigabytes? Not CSI, not Entropy, just 1.5 gigabytes of information, and 1.5 gigabytes is more than 500 bits(and 500 bits would be the bound above with the quantity of information would qualify as being CSI). Right?

If my understanding is not correct, could you clarify:
A): How to calculate the quantity of information in an arbitrary string of DNA, for example?

You can use any stretch of DNA you want, like a real world promoter sequence(or mRNA transcript or whatever you like), or just use a small random string for the purpose, like the one I supplied. Anything is fine with me, I just want to make sure that we agree on how to calculate the quantity of information in a string of symbols, like DNA, in bytes.

I understand that the quantity itself is not what makes it Complex or Specified. I just want to make sure we agree on how to calculate the quantity.

Quote (Jerry Don Bauer @ Nov. 20 2012,15:51)
That was all I was pointing out.....I certainly did not want to get into genomic entropy and the like at this point.

That's absolutely fine with me, we don't have to delve into entropy or anything. I just want to reach an agreement on the basics, like how to calculate information quantity in stretches of DNA.

That's why I brought up the example you quoted earlier, because you seemed to be using a method that corresponded to length of string divided by number of symbols and reporting the result in bytes.

If this is not how you would calculate information content in a string of symbols, how else? Give an example and I would be most grateful.

Thanks again for your time :)

  
Jerry Don Bauer



Posts: 135
Joined: Nov. 2012

(Permalink) Posted: Nov. 20 2012,16:22   

Quote (OgreMkV @ Nov. 20 2012,16:02)
Jerry, let me tell you a story.

I'm doing some work right now and one of the things I had to do was compute the escape velocity for the asteroid Vesta4.  So, I got the mean radius and the approximate mass and ended up with an escape velocity of 363 and change m/s.  I thought, that's way to high, I must have made a mistake.

I figured and a looked up G and verified it.  I verified the equation I was using.  I got some other people to check my math and they agreed with me.  

We fussed on this for three days.

Then, I got a bright idea.  I looked up the escape velocity for Vesta.  Amazingly, NASA recently sent a mission there.  Turns out, the math was right... it was my thinking that was wrong.

The moral of the story is that thinking can be wrong.  So, why don't you give us the formulas so we can actually do the math.

Oh wait, you can't do that because we all know IT DOESN'T EXIST.

Again...A post that shows you are simply lost in this discussion...the formulas to what? We are not dealing with anything that uses formulas.

And WHAT doesn't exist, probablility mathematics? If you think this you might consider another vocation....

  
Richardthughes



Posts: 9472
Joined: Jan. 2006

(Permalink) Posted: Nov. 20 2012,16:25   

Quote (Jerry Don Bauer @ Nov. 20 2012,16:22)
Quote (OgreMkV @ Nov. 20 2012,16:02)
Jerry, let me tell you a story.

I'm doing some work right now and one of the things I had to do was compute the escape velocity for the asteroid Vesta4.  So, I got the mean radius and the approximate mass and ended up with an escape velocity of 363 and change m/s.  I thought, that's way to high, I must have made a mistake.

I figured and a looked up G and verified it.  I verified the equation I was using.  I got some other people to check my math and they agreed with me.  

We fussed on this for three days.

Then, I got a bright idea.  I looked up the escape velocity for Vesta.  Amazingly, NASA recently sent a mission there.  Turns out, the math was right... it was my thinking that was wrong.

The moral of the story is that thinking can be wrong.  So, why don't you give us the formulas so we can actually do the math.

Oh wait, you can't do that because we all know IT DOESN'T EXIST.

Again...A post that shows you are simply lost in this discussion...the formulas to what? We are not dealing with anything that uses formulas.

And WHAT doesn't exist, probablility mathematics? If you think this you might consider another vocation....

I LOVE THESE CSI IS REAL BUT MUST DO DO ANY MATH SHITFESTS.

--------------
"Richardthughes, you magnificent bastard, I stand in awe of you..." : Arden Chatfield
"You magnificent bastard! " : Louis
"ATBC poster child", "I have to agree with Rich.." : DaveTard
"I bow to your superior skills" : deadman_932
"...it was Richardthughes making me lie in bed.." : Kristine

  
fnxtr



Posts: 1805
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,16:26   

Quote (Jerry Don Bauer @ Nov. 20 2012,14:22)
We are not dealing with anything that uses formulas.

Erm..  so how do you measure CSI, then? Eyeball it?

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
The whole truth



Posts: 899
Joined: Jan. 2012

(Permalink) Posted: Nov. 20 2012,16:42   

Quote (Jerry Don Bauer @ Nov. 20 2012,13:02)
Quote (Robin @ Nov. 20 2012,13:25)

 
Quote
You're missing the point Jerry. The analogy fails because it doesn't actually demonstrate a requirement of specificity. There in lies the problem. It's basically a circular analogy - it relies upon the assumption of specificity to try to show that specificity is required.


There is NO assumptions and it readily demonstrates specificity in a manner that is easily calculated. As the archer's chances of hitting an assigned target decreases, specificity increases...that is what specificity IS.....I'm just trying to show what it is at this point as no one on here seems to know.

It DOESN'T say anything about specificity being required for anything and indeed specificity is not even present in some systems. I have never hinted otherwise.

In fact, I've yet to be presented anything by the posters in here as an example that contained specificity to consider to begin with...that's why I've reverted to some middle school level examples here...

 
Quote
No, I can't. You see, those things are part of the reason your claims are erroneous.


I haven't MADE any claims....if you think I have, please link to them and I will clarify. I'm trying to get everyone on the same page as to what CSI even IS before we discuss it.  It's not calculations of Jesus coming, that you did or didn't magically morph from an ape, that Darwinsim is science or a crock or anything similar. It's just very simple statistics.

   
Quote
As to your accusation that that I'm just throwing
Sorry Jerry, but I don't see it. I've gone back through the thread and see nothing that even remotely looks like a calculation of the CSI of an organism. Feel free to reference the specific calculation in your response.


Well, in response to several accusations (out of ignorance, I suppose) I was challenged to show how one would go about calculating the CSI of living tissue and I simply posted some of my own writings:

"The smallest known bacteria I’m aware of consists of around 500 proteins but I don’t think anyone would disagree with me that I am safe in using a 100 protein scenario in order to form an organism that could remotely be called life.

Proteins from which all of life is based are formed from amino acids. And these proteins are usually chains of from 50 to 50,000 amino acids.

Chemist, Stanley Miller showed long ago that under the correct conditions we can create amino acids in a beaker.

A chirality problem exists in that they come out completely “racemized.” The amino acids produced by Miller consisted of equal amounts of “right-handed” and “left-handed” molecules. The atoms that react to form amino acids bond together into cork-screw shapes--these cork-screws can curve to the right (right-handed) or to the left (left-handed). But a useable protein for life has to be composed entirely of left-handed molecules.

So, when an amino acid adds itself to a protein chain, the odds are one in two that it will be left-handed. That’s not a big deal if the protein chain is extremely short--say three amino acids long. Our probability would be one chance in 2 to the 3rd power or 1:8. That’s not bad odds for this type of thing.

So, let’s look at this primeval ooze from which that first protist popped and we are going to surmise that this ooze was racemized amino acids that had occurred naturally.

The odds against assembling a protein chain consisting of only left-handed amino acids by chance is 2 to the “n” th power. And “n” is the number of attached amino acids in the protein. So its not difficult to calculate that the odds against assembling a useable protein of only 250 left-handed amino acids from a racemized mixture is one chance in 2 to the 250th power. This is about 1 chance in 10 to the 74th power.

Well shoot, we are already past the Borel’s Law barrier with one tiny protein and we are nowhere near our organism. It would only take one more to catch up with Dembski’s UPB.

And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000

These were designed.

To calculate the organism, we have to multiply together the odds of each one of our amino acids. When we do we come out with a 1:10^7400 chance that this tiny, highly unrealistic and overly simplistic organism could ever form. These are staggering odds that could not occur in reality.

Now we can see why some Idists calculate that the odds against a fully functioning, much more complex human cell occurring by chance is one chance in 10 to the 100 billionth power. That’s one hundred billion zeroes. Us computer geeks can think of it as a 100 gigabyte hard drive full of nothing but zeroes.

And whether or not this cell forms one step at a time, or all at once, these odds don’t change."

Actually, you've "MADE" many claims, including "These were designed."

Deliberately designed things require a designer. Who or what is the designer? Where, when, and how did the alleged designer design whatever it allegedly designed? What all did it design and what didn't it design? And how did the things it didn't design come about?

--------------
Fellatio is in fact a type of sodomy - gordon e mullings

I don't even know what that means- "study CSI". - joe g

Joe G is the only person I have ever encountered who could start a fight in an empty room and still manage to lose. - Amadan

   
fnxtr



Posts: 1805
Joined: June 2006

(Permalink) Posted: Nov. 20 2012,16:58   

(shrug) Oh well. That's it then. God did it. Everybody go home.

Seriously, say you're right.

Then what?

It's like GinGout's little VB program.

Now that you've got it, what're you going to do with it?

--------------
"But it's disturbing to think someone actually thinks creationism -- having put it's hand on the hot stove every day for the last 400 years -- will get a different result tomorrow." -- midwifetoad

   
The whole truth



Posts: 899
Joined: Jan. 2012

(Permalink) Posted: Nov. 20 2012,17:01   

Jerry, who or what is the specifier? Where, when, and how did the specifier originally specify complex information?

Is there any 'CSI' in an atom, a rock, a star, a black hole, or a fossilized trilobite?

You say that all organisms exceed the (arbitrary) 500 bit line. Name a part of an organism that has less than 500 bits of 'CSI'. Also name a part that has 1500 bits of 'CSI'. Show your calculations.

--------------
Fellatio is in fact a type of sodomy - gordon e mullings

I don't even know what that means- "study CSI". - joe g

Joe G is the only person I have ever encountered who could start a fight in an empty room and still manage to lose. - Amadan

   
JohnW



Posts: 1929
Joined: Aug. 2006

(Permalink) Posted: Nov. 20 2012,17:30   

Quote (fnxtr @ Nov. 20 2012,14:26)
Quote (Jerry Don Bauer @ Nov. 20 2012,14:22)
We are not dealing with anything that uses formulas.

Erm..  so how do you measure CSI, then? Eyeball it?

Yes.  Eyeball it.  "Does it look designed to me?"

You know it.  I know it.  Jerry knows it.

--------------
It always amazes me to no end that people who find the Bible abhorent seem to focus only on the few instances where God commands a city destroyed.
- FTK

  
Soapy Sam



Posts: 363
Joined: Jan. 2012

(Permalink) Posted: Nov. 20 2012,19:07   

JDB:  
Quote
And some of the proteins found in nature are 50,000 chained amino acids. The odds of assembling a protein that long are 1:10^15,000


In one step. You realise no-one is saying it happens in one step? Or even two.

   
Quote
These were designed.


How long does it take a designer to determine that this specific version of the protein from the 1:10^15,000 possibilities at its disposal had the properties desired, using only the power of thought? Or even a rilly big computer?

--------------
Evolutionists trust entropy for creation of life but are like men who horse a crocodile to get across a river - niwrad.

The organism could already metabolize citrus. Joe G

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,21:20   

Quote (fnxtr @ Nov. 20 2012,16:26)
Quote (Jerry Don Bauer @ Nov. 20 2012,14:22)
We are not dealing with anything that uses formulas.

Erm..  so how do you measure CSI, then? Eyeball it?

Dang Jerry.  Then what's the point of a MATHEMATICIAN inventing the concept eh?

This is hilarious.

I notice that you are running as fast as you can to avoid doing anything with the RNA sequence I provided.  Why is that?

Why won't you just see if it has CSI or not.  Just look at it, that's all you have to do.  After all, "There's no formula" or anything that would tell us if there are 500 bits of information or anything like that.

HAHAHAHAHAHAHAHAHAHAHA

I didn't even have to actually bring out the big guns.  He just walked right out and admitted it.  This is awesome.

BTW: Now is when you start backpedaling and start talking about how you and others have calculated CSI before.  

Oh wait, to calculate something, you need a FORMULA.  HAHAHAHAHAHAHAHAHAHA

BTW: My vocation is just fine thank you.  Part of my job is to analyze statistical data.  Just a part, most of the rest is science content.  I do this just for the lulz.

I think this may go on my blog.  An ardent ID defender admits that there is no formula to calculate CSI.  What will Dembski say?  Oh yeah, he doesn't have one either...

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
Kattarina98



Posts: 1188
Joined: Sep. 2009

(Permalink) Posted: Nov. 21 2012,09:13   

I have it on good authority* that there is no reliable instrument to detect design:    
Quote
The filter was never designed to detect any and all cases of design (it is not a universal decoder algorithm, and we have good reason to believe such are not feasible), just those that are unequivocal per tested and reliable signs.

*Spoiler: It's KF

Edit: Typo

Edited by Kattarina98 on Nov. 21 2012,09:15

--------------
Barry Arrington is a bitch.

  
Cubist



Posts: 262
Joined: Oct. 2007

(Permalink) Posted: Nov. 21 2012,19:02   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:12)
So, and I'm not sure why, but there are those on here repeatedly requesting that I calculate the CSI of an organism as if that is some big deal.

It's like this, Jerry: If you want to assert that organisms have CSI, you're gonna have to do more than just say that organisms have CSI.
   
Quote
Here is an excerpt from some of my writings in that area doing exactly that:

Okay, this should be good…
   
Quote
If I flip a coin what are the odds of me getting heads or tails? 1:2. If I flip 50 coins and I get 25 heads and 25 tails, what are the odds when I flip that 51st coin that I will receive head or tails? 1:2. If I have flipped 99 coins and 47 have come up heads and 52 have come up tails, what are the odds for heads or tails in that 100th coin? 1:2.

True. Assuming it's an ungimmicked coin (which I'm going to do all throughout this comment, unless I explicitly state otherwise), there's a 50% chance of that coin coming up heads when it's flipped, and that probability is completely independent of how many other coins may or may not have come up heads when they (those other coins) were flipped.
 
Quote
Well what are the odds if I flip 100 coins they all will come up heads? 1:(.5^100).

True. Given 100 unflipped coins, each individual coin of that unflipped 100 has a 50% chance of coming up heads, so the chances of all 100 of those unflipped coins coming up heads, when they're flipped, is, indeed, (1/2)100. And presuming my copy of Maple 7 can be trusted, that works out to a touch under 1:1030.
 
Quote
But what if I have already flipped 50 of the coins and 25 of them are tails and 25 of them are heads.

In that case, you're not talking about 100 unflipped coins. Instead, you're talking about 100 coins, of which 25 have already been flipped and came up heads; another 25 have already been flipped and came up tails; and the remaining 50 are still unflipped. For any one unflipped coin, the probability that it will come up heads is 50%; for any flipped coin that came up tails, the chance of that coin being heads is 0%; for any flipped coin that came up heads, the chance of that coin being heads is 100%.
 
Quote
Now what are the odds that all 100 coins will come up heads?

Zero, because you're now talking about a situation in 25 of those 100 coins have already come up tails, which means it's not possible for all 100 of those coins to come up heads.
 
Quote
They’re still the same 1:(.5^100).

False, as explained above. But if you believe you're right, I have a proposition for you, Jerry: I have 100 coins, 99 of which have already been flipped and come up heads, and the 100th of which is as yet unflipped. My proposition is that we bet on the results of flipping that 100th coin; if it comes up tails, I give you $5, and if it comes up heads, you give me $100,000. Since the chances of 100 coins all coming up heads is (1/2)100, this proposition is clearly a free $5 for you, right? And you'll be okay with making this bet with me multiple times, won't you?
 
Quote
So let’s place all 100 coins in a bag, shake them up all at once and see how many heads I get. What are these odds? 1:(.5^100).

Right, because you've shifted back from 25 flipped coins that came up heads, plus 25 flipped coins that came up tails, plus 50 unflipped coins to 100 unflipped coins.
 
Quote
So it doesn’t really matter if I flip the coins all at once (a ‘poof’ as in spontaneous generation) or I flip them one at a time (individual, incremental steps), the odds in the big picture do not change.

False. If you already have 99 flipped coins that came up heads, you have 99 flipped coins that came up heads, and the probability of that occurring doesn't negate the fact that you have those 99 coins.
Apart from that, you're depending on the implicit presumption that each coin is flipped exactly one time. What if you're allowed to flip a coin ten times, and count it as heads if any of those ten flips came up heads? In that case, that chance of a coin coming up heads is 1,023/1/024, and the chance of 100 coins all coming up heads is (1,023/1,024)100. Which is a summat different kettle of fish…
 
Quote
For two atoms to “bond” (join together into a molecule) they must be within an “interacting neighborhood.” In fact, in order for two atoms to react together, they must be in the area of about 100 picometers (10 to the -10 power meters) in distance from one another.

True, and what of it? Seeing as how atoms do, in fact, "bond"—they're famous for it—I'm not sure what the problem is.
 
Quote
The universe is big. And atoms must be moving in order to come into the “neighborhood” of another atom. The faster they are moving, the more opportunities they have to form a bond.

Yep. But again, atoms do "bond", so what's your point?
 
Quote
But this gets a little hairy because if they are moving too fast, the momentum will shoot them past each other before they can bond.

And yet, atoms somehow do manage to "bond" anyway. So?
 
Quote
And, the temperature can‘t be too cold as reactions will not effectively occur and if it is too hot more bonds will be broken than are formed, and even when the temperatures are perfect, “bonds” of a long molecular chain may be broken simply because a random high energy atom or molecule knocks it loose. The point is, there is a certain finite number of opportunities available, even in 50 billion years for a reaction to occur in reality

Yes. So what?
 
Quote
For these reasons, Brewster and Morris concluded, based upon the size of the universe, the temperatures under which bonding occurs, the surmised age of the universe, the nature of bonds and how they form and break-- that 10 to the 67th power is the ultimate upper threshold for any chemical event to happen--anytime, anywhere in the universe, even in 50 billion years.

Hold it. How did Brewster and Morris come up with this "1067" figure? Citation needed…
 
Quote
Dembski defines a universal probability bound of 10^-150, based on an estimate of the total number of processes that could have occurred in the universe since its beginning. Estimating the total number of particles in the universe at 10^80, the number of physical state transitions a particle can make at 10^45 per second (Planck time, the smallest physically meaningful unit of time) and the age of the universe at 10^25 seconds, thus the total number of processes involving at least one elementary particle is at most 1:10^150. Anything with a probability of less than 10^150 is unlikely to have occurred by chance. Previous to Dembski, statisticians concluded through Borel’s Law that 1:10^50 was the upper limit odds in which anything could actually happen.

Statisticians didn't conclude anything of the kind. Obvious counterexample: If you shuffle a standard 52-card deck and deal out all the cards face-up, you'll get one of the (52! =) roughly 6*1068 possible 52-card sequences, so the odds of your having gotten the particular card-sequence you actually did get, is 1:(6*1068). Since this is clearly an even smaller probability than the 1:10^50 'upper limit odds in which anything could actually happen', either the 52-card sequence you got was necessarily Designed, or else 1:10^50 is not the 'upper limit odds in which anything could actually happen'.
 
Quote
The smallest known bacteria I’m aware of consists of around 500 proteins but I don’t think anyone would disagree with me that I am safe in using a 100 protein scenario in order to form an organism that could remotely be called life.

I'd disagree. You're talking about the origin of life, and I would strenuously disagree that anything like a contemporary life-form was involved in that event. The question isn't whether a contemporary life-form was created in the origin of life; rather, the question is whether or not some kind of self-reproducing whatzit (perhaps no more than a single molecule that catalyzed chemical reactions which generated copies of itself?) was created in the origin of life.
Since the remainder of your comment is basically repeating errors I've already called you on, I see no reason to extend this reply any further…

  
Soapy Sam



Posts: 363
Joined: Jan. 2012

(Permalink) Posted: Nov. 21 2012,19:05   

? page

--------------
Evolutionists trust entropy for creation of life but are like men who horse a crocodile to get across a river - niwrad.

The organism could already metabolize citrus. Joe G

  
OgreMkV



Posts: 2916
Joined: Oct. 2009

(Permalink) Posted: Nov. 21 2012,23:46   

Dear Jerry is saying the same thing I jumped on him for many pages ago.

The odds that two particular atoms in the universe interacting are infinitesimal.

The odds that ANY two atoms in the universe interacting are 100%.

He (and other IDiots) are the ones thinking that humans must appear, fully formed, wearing the latest Paris fashion and since evolution can't explain Paris fashion, therefore God.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
The whole truth



Posts: 899
Joined: Jan. 2012

(Permalink) Posted: Nov. 22 2012,12:09   

Quote (Kattarina98 @ Nov. 21 2012,07:13)
I have it on good authority* that there is no reliable instrument to detect design:          
Quote
The filter was never designed to detect any and all cases of design (it is not a universal decoder algorithm, and we have good reason to believe such are not feasible), just those that are unequivocal per tested and reliable signs.

*Spoiler: It's KF

Edit: Typo

Hmm, let's see, there's no feasible, universal decoder algorithm (test) "to detect any and all cases of design" yet somehow design has been tested via "reliable signs"? How was/is design tested if there's no feasible, universal test? (my bold)

The only intentional design that is unequivocal per tested and reliable signs is design that has been done by known, real, living things such as spiders, bees, beavers, birds, and people. No one has ever tested or shown that any designer-god-sky-daddy has designed anything.

gordo -the messiah wannabe- mullings is just pushing the same old, lame old 'it looks designed to me so it must be designed by my sky-daddy' crap, because he is desperately trying to convince himself and others that his imaginary sky daddy isn't imaginary, and by admitting that there's no feasible, universal decoder algorithm (test) to detect sky-daddy-design he's also admitting that the so-called 'ID inference' doesn't have a scientific leg to stand on and never will. sky-daddy-design 'detection' by IDiots is strictly an assertion of their thoroughly biased opinion based on their fairy tale religious beliefs.

--------------
Fellatio is in fact a type of sodomy - gordon e mullings

I don't even know what that means- "study CSI". - joe g

Joe G is the only person I have ever encountered who could start a fight in an empty room and still manage to lose. - Amadan

   
Henry J



Posts: 3734
Joined: Mar. 2005

(Permalink) Posted: Nov. 22 2012,18:13   

Quote
The odds that ANY two atoms in the universe interacting are 100%.

Especially hydrogen - that stuff is all over the place! H2O, NH3, CH4, C2H5OH, etc.

(Well, perhaps aside from inside the remains of a yellow dwarf after it's used up all its fuel. I'm sure there's a name for a star at that stage, but not sure what it is. Black dwarf, maybe? )

---------

Quote
I have it on good authority* that there is no reliable instrument to detect design:

Why would that need authority, good or otherwise, anyway? It's common sense that identification of designs is done by comparing an object to other objects known to have been constructed by somebody.

(Or is "common sense" an oxymoron?)

---------

Quote
If you shuffle a standard 52-card deck and deal out all the cards face-up, you'll get one of the (52! =) roughly 6*10<sup>68</sup> possible 52-card sequences, so the odds of your having gotten the particular card-sequence you actually did get, is 1:(6*10<sup>68</sup>).

Ah, but if God doesn't play dice, then maybe She doesn't play cards, either!!!111!!!eleven!!!!

---------

Quote
And yet, atoms somehow do manage to "bond" anyway. So?

Especially when shaken and not stirred.

Henry

  
Cubist



Posts: 262
Joined: Oct. 2007

(Permalink) Posted: Nov. 22 2012,19:08   

Quote (The whole truth @ Nov. 22 2012,12:09)
 
Quote (Kattarina98 @ Nov. 21 2012,07:13)
I have it on good authority* that there is no reliable instrument to detect design:              
Quote
The filter was never designed to detect any and all cases of design (it is not a universal decoder algorithm, and we have good reason to believe such are not feasible), just those that are unequivocal per tested and reliable signs.

*Spoiler: It's KF

Edit: Typo

Hmm, let's see, there's no feasible, universal decoder algorithm (test) "to detect any and all cases of design" yet somehow design has been tested via "reliable signs"? How was/is design tested if there's no feasible, universal test? (my bold)

I don't have a problem with that, myself. 'Reliable' isn't an absolute; something can be 'reliable' for most practical purposes, and yet still not be 100% applicable to everything. So the dude's saying he's got a decently useful design-detection thingie (which just doesn't happen to be universally applicable), fine. Not a problem. However what is a problem…
Quote
gordo -the messiah wannabe- mullings is just pushing the same old, lame old 'it looks designed to me so it must be designed by my sky-daddy' crap, because he is desperately trying to convince himself and others that his imaginary sky daddy isn't imaginary,

…is right here. He does not, in fact, have the decently useful design-detection thingie he claims to have. Dude's lying.

  
Kattarina98



Posts: 1188
Joined: Sep. 2009

(Permalink) Posted: Nov. 22 2012,20:08   

That's why I quoted him - as we say where I live: "The cat bites its own tail."  :-))

Edit: Typo

Edited by Kattarina98 on Nov. 22 2012,20:09

--------------
Barry Arrington is a bitch.

  
Kattarina98



Posts: 1188
Joined: Sep. 2009

(Permalink) Posted: Nov. 23 2012,03:49   

... and I realised that I need to work on my sarcasm as it obviously didn't come through.

--------------
Barry Arrington is a bitch.

  
  128 replies since Oct. 06 2012,18:57 < Next Oldest | Next Newest >  

Pages: (5) < [1] 2 3 4 5 >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]

Visits since January 19th, 2010: