RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (500) < ... 146 147 148 149 150 [151] 152 153 154 155 156 ... >   
  Topic: Uncommonly Dense Thread 2, general discussion of Dembski's site< Next Oldest | Next Newest >  
Bob O'H



Posts: 1863
Joined: Oct. 2005

(Permalink) Posted: Dec. 29 2008,14:32   

Quote
The best thing about KF is that we must have all run into a KF in our lives. He is the guy at meetings who insists on a 2 hour presentation with 50 powerpoint slides on some point that could be dealt with in 5 minutes.

Oh, FSM!  I've had flashbacks to mildew and rust meetings.  Imagine doing that with real slides.  That get stuck in the slide projector.

We once let that guy rabbit, just so we could find out what he was doing.  Except that after an hour and a quarter we still had no idea (Kronecker got mentioned at some point), so even the chairman gave up.

--------------
ID theorists don’t postulate a designer for their arguments. - Crandaddy
There is no connection between a peppered moth, natural selection, and religion that I can see. - FtK

   
bystander



Posts: 301
Joined: Oct. 2005

(Permalink) Posted: Dec. 29 2008,14:42   

Quote (Bob O'H @ Dec. 30 2008,07:32)
Quote
The best thing about KF is that we must have all run into a KF in our lives. He is the guy at meetings who insists on a 2 hour presentation with 50 powerpoint slides on some point that could be dealt with in 5 minutes.

Oh, FSM!  I've had flashbacks to mildew and rust meetings.  Imagine doing that with real slides.  That get stuck in the slide projector.

We once let that guy rabbit, just so we could find out what he was doing.  Except that after an hour and a quarter we still had no idea (Kronecker got mentioned at some point), so even the chairman gave up.

They are in all walks of life. In corporate life, you will usually find them in Human Resources and the talks are on the new way to define a "Lost Time Injury" and its 15 sub classifications.

  
bystander



Posts: 301
Joined: Oct. 2005

(Permalink) Posted: Dec. 29 2008,14:42   

Quote (dmso74 @ Dec. 30 2008,07:31)
Quote
fff

POTW

  
someotherguy



Posts: 367
Joined: Aug. 2006

(Permalink) Posted: Dec. 29 2008,14:44   

Quote (oldmanintheskydidntdoit @ Dec. 29 2008,12:48)
Dembski in 2004      
Quote
showing how intelligent design provides better insights into biological systems than the dying Darwinian paradigm.

William J. Murray 2008      
Quote
Fuller says: “After all, what good is a theory of ‘intelligent design’ if it has nothing to say about the nature of the designer? ”

Uh .. it will make testable predictions and will lead to better working understandings of features of the universe and life than the non-foresighted, non-designed model? It will lead to an easier and faster understanding of phenomena, instead of trying to shoehorn everything into the non-foresighted model?

Link
So, four years ago Dembski notes he expects "better insights" from an ID viewpoint, four years later the fans at UD are still talking about these "insights" in the future tense.

ID will lead to an easier and faster understanding of phenomena?

When?  :D

Thinking about Dembski's predictions, I can't help but imagine that he likes to hum this song to himself when times get tough:

The sun'll come out
Tomorrow
Bet your bottom dollar
That tomorrow
There'll be sun!*
Just thinkin' about
Tomorrow
Clears away the cobwebs,
And the sorrow
'Til there's none!


*of a distinctly telic, non-materialistic variety


Caption:  William "Daddy Warbucks" Dembski and his pal Denyse O'Leary (and their plucky mutt, DaveScot) in a soon-to-be-realized future filled with money, respect and frequent trips to the Baylor cafeteria.

--------------
Evolander in training

  
stevestory



Posts: 8326
Joined: Oct. 2005

(Permalink) Posted: Dec. 29 2008,14:48   

Quote (dmso74 @ Dec. 29 2008,15:31)
Quote
fff

somebody want to tell me what this means?

   
midwifetoad



Posts: 3135
Joined: Mar. 2008

(Permalink) Posted: Dec. 29 2008,14:51   

Quote (stevestory @ Dec. 29 2008,14:48)
Quote (dmso74 @ Dec. 29 2008,15:31)
Quote
fff

somebody want to tell me what this means?

Needs its own thread, doesn't it?

--------------
... a poster child for irresponsible and deceitful misrepresentation of design theory on the Internet.
http://tinyurl.com/9axtwbe....9axtwbe

  
sparc



Posts: 1468
Joined: April 2007

(Permalink) Posted: Dec. 29 2008,14:51   

Quote
Imagine doing that with real slides.  That get stuck in the slide projector.
Where's the difference? The only thing that is different today is that rather graduate students are simultanously manipulating the beamer, the cables and the computers while in those golden ages elder professors used the frames of their glasses to dig for stucked slides.
There is one good thing about beamers, though: Physicians can no longer do double projections (I've never seen a biologist do anything like that).

--------------
"[...] the type of information we find in living systems is beyond the creative means of purely material processes [...] Who or what is such an ultimate source of information? [...] from a theistic perspective, such an information source would presumably have to be God."

- William Dembski -

   
dmso74



Posts: 110
Joined: Aug. 2008

(Permalink) Posted: Dec. 29 2008,15:01   

[quote=midwifetoad,Dec. 29 2008,14:51]      
Quote (stevestory @ Dec. 29 2008,14:48)
     
Quote (dmso74 @ Dec. 29 2008,15:31)
       
Quote
fff

somebody want to tell me what this means?


sorry, i was testing quoting and hit "Add" instead of "preview."

on another note, ya'll should check out this thread: RNA getting lengthy

It's brief and full of tardy nuggests.

  
bystander



Posts: 301
Joined: Oct. 2005

(Permalink) Posted: Dec. 29 2008,15:06   

I did engineering and we never had slides. The lazy teacher would have a roll of clear plastic, that they would use on an overhead projector. the roll would contain the whole semester's worth of work. Australia went from imperial to metric units 5 years before I went to uni and one lecturer still taught us with his roll that was in imperial units.
the good lecturers just filled up blackboards with equations. Seems archaic now just spending lecture time copying down information. Does this still happen? In office life you get a printout of the seminar, which you then can mark up with additional notes if you like.

  
J-Dog



Posts: 4301
Joined: Dec. 2006

(Permalink) Posted: Dec. 29 2008,15:17   

I think kf is also the type that went to the Bad Power Point Presentation School....

Print too small, bad graphics, 150 slides where there could be 20...

And worst of all he probably doesn't move when the light turns green.

--------------
Come on Tough Guy, do the little dance of ID impotence you do so well. - Louis to Joe G 2/10

Gullibility is not a virtue - Quidam on Dembski's belief in the Bible Code Faith Healers & ID 7/08

UD is an Unnatural Douchemagnet. - richardthughes 7/11

  
dnmlthr



Posts: 565
Joined: Mar. 2008

(Permalink) Posted: Dec. 29 2008,15:27   

Quote (J-Dog @ Dec. 29 2008,21:17)
I think kf is also the type that went to the Bad Power Point Presentation School....

Print too small, bad graphics, 150 slides where there could be 20...

And worst of all he probably doesn't move when the light turns green.

Don't forget comic sans and printed and rescanned clip art!

--------------
Guess what? I don't give a flying f*ck how "science works" - Ftk

  
darwinoid



Posts: 12
Joined: Jan. 2003

(Permalink) Posted: Dec. 29 2008,16:54   

Quote (Bob O'H @ Dec. 29 2008,01:03)
John Lynch reveals Atom's full identity:

Atom tha Immortal, rapper

atomthaimortal.com is owned by:

     Montanez, George  GuerillaIndustry@hotmail.com
     4526 Lyon Ave
     Riverside, California 92505
     United States
     (909) 785-7048

his LinkedIn account lists him as a software engineer, so I'm willing to bet Mr Immortal is indeed the programmer for the Tardware.

However, an 'Atom' has been posting to my blog from the UK. That could be the same 'Atom' as over at UD.

-john

--------------
john m. lynch
http://blog.jmlynch.org/....nch.org
http://www.public.asu.edu/~jmlync....jmlynch

   
guthrie



Posts: 696
Joined: Jan. 2006

(Permalink) Posted: Dec. 29 2008,17:27   

Is Fuller secretly on our side?  If he does ignite an ID civil war, should we send him a bottle of something?

Although it did take him as long as 5 sentences to get round to selling his books, he needs to learn from the creationists, they generally manage it in the first one.

Bystander, regarding lecture slides, I was at uni 1995 to 2000, (In the UK) and during that period we went from OP slides and blackboard writing to photocpied handouts we could add our own notes to.  Both methods meant there were legibility issues, the latter in the copies, the former in our hastily scribbled notes.

  
guthrie



Posts: 696
Joined: Jan. 2006

(Permalink) Posted: Dec. 29 2008,17:30   

Actually, reading his post on UD, Fuller just renders himself more irrelevant.
Point 1, regarding Darwinism- thats nothing to do with modern evoloutionary biology, therefore nothing to see here, move along.
Point 2- indeed, lets hear more about this designer.  

Quote
But this in turn means that ID will need to be more forthright in advancing scientific theories of God – what ‘theology’ ought to mean. In other words, a persuasive intelligent design theory should provide rational grounds for believing in the existence of God.

So remind me again what Fullers religion is again?

Edioted to add- so how long before yellowshark gets banned?

  
dpheddle



Posts: 5
Joined: Dec. 2008

(Permalink) Posted: Dec. 29 2008,17:46   

dheddle commented on Fuller's post if you're interested.

  
Wesley R. Elsberry



Posts: 4112
Joined: May 2002

(Permalink) Posted: Dec. 29 2008,18:05   

dheddle did a fine job of commenting on Fuller, too.

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
carlsonjok



Posts: 3323
Joined: May 2006

(Permalink) Posted: Dec. 29 2008,18:19   

Quote (Wesley R. Elsberry @ Dec. 29 2008,18:05)
dheddle did a fine job of commenting on Fuller, too.

Wes, do you have any comment on Baylor Bear's latest post?  I don't know anything about ev, but I presume that it measures and returns relative fitness across a population and higher relative fitness means a higher chance of propogating to the next generation.  It looks as if BB* is saying that by measuring relative fitness, that ev is "sneaking information in" and is simulating evolution by doing a random walk without any measure of fitness at all and just waiting until the mutating function finally hits the target.  Is that about right?

* My guess is it is Robert Marks. Not sure why he is writing under a pseudonym.  Is UD that radioactive for a tenured professor?

--------------
It's natural to be curious about our world, but the scientific method is just one theory about how to best understand it.  We live in a democracy, which means we should treat every theory equally. - Steven Colbert, I Am America (and So Can You!)

  
keiths



Posts: 1926
Joined: Jan. 2006

(Permalink) Posted: Dec. 29 2008,18:38   

Atom and Patrick are teetering close to the edge in the EV Ware thread. They've basically admitted that natural selection works just fine given a suitable fitness landscape.  Now their only remaining objection is their belief (hope?) that real-life fitness landscapes probably don't have the required characteristics.

A & P, let's think this through:

1. As you've conceded, natural selection can generate biological diversity given the right fitness landscapes.
2. We observe biological diversity in our world, of exactly the kind that would be produced if natural selection were in operation.
3. Your gut (hope?) tells you that real-life fitness landscapes don't have the right characteristics for this to happen.  You have no evidence for this claim.  It just feels right.

Given the above, what would a rational person conclude?

A. Your intuition about the fitness landscapes is probably wrong, and evolution is an unguided process, just like all the other unguided processes that science has uncovered in the last 400 years, or

B. Your intuition must be right (it has to be!), even though you've never attempted to determine what real-life fitness landscapes look like.  Therefore there must be a superpowerful Designer who poofed all of Earth's biodiversity into existence.

Your call.

--------------
"Unguided evolution (whatever that is) doesn’t predict anything. If it did it wouldn’t be unguided." -- Mung

"Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there." -- KF

  
Zachriel



Posts: 2560
Joined: Sep. 2006

(Permalink) Posted: Dec. 29 2008,18:40   

Quote
Khan: You (and B+S) are mistaken about what constitutes Darwinian processes. Darwinian processes are gradual accumulations of slightly beneficial mutations that produce slightly more fit intermediates (King, J.L. and Jukes, T.H. 1969. Non-Darwinian evolution. Science 164:788–798). The assumption that intermediates are deleterious makes the model non-Darwinian.

Patrick: Ugh, so basically your objection comes down to a word game. If it makes you happy then, yes, by that definition Behe and Snoke’s model did not include “Darwinian processes”. But you should know that when most people on here (UD) say “Darwinism” or “Darwinian” they’re referring to modern evolutionary theory and all related non-foresighted, unguided mechanisms or processes. We’re examining all potential pathways, not just ones we know should work. Sure, it may be imprecise language but this is not just something we do, as referenced on this page here in relation to Margulis.

Quote
Put a Sock In It: “{Margulis} I am definitely a Darwinist though. I think we are missing important information about the origins of variation. I differ from the neo-Darwinian bullies on this point.

Thus, even though Margulis repudiates Neo-Darwinism, she is still a Darwinist.  

Ironically, Patrick quotes Margulis who is using the term "Darwinist" just as Khan did, meaning Evolution by Natural Selection.

Quote
Margulis: Although I greatly admire Darwin's contributions and agree with most of his theoretical analysis and I am a Darwinist, I am not a neo-Darwinist. One of Darwin's major insights is the recognition that all organisms are related by common ancestry. Today direct evidence for common ancestry — genetic, chemical, and otherwise — is overwhelming. Populations of organisms grow and reproduce at rates that are not sustainable in the real world, and therefore many more die or fail to reproduce than actually complete their life histories. The fact that all the organisms that are born or hatched or budded off do not and cannot possibly survive is natural selection. Observable inherited variation appears in all organisms that are hatched, born, budded off, or produced by division, and some variants do outgrow and outreproduce others. These are the tenets of Darwinian evolution and natural selection. All thinking scientists are in complete agreement with these basic ideas, since they're supported by vast amounts of evidence.

Neo-Darwinism is an attempt to reconcile Mendelian genetics, which says that organisms do not change with time, with Darwinism, which claims they do.

So, Margulis rejects orthodox Neodarwinism because it doesn't properly account for the sources of variation. But she considers hereself a Darwinist because she recognizes Natural Selection as the primary mechanism in adaptation.

Quote
Put a Sock In It: And if she is, so is just about every other biologist who holds that teleology ought to play no substantive role in evolutionary theory.

And this is also wrong. Anyone who rejects Natural Selection as the primary mechanism of Evolution is not a Darwinist in this sense.

--------------
The struggle against ignorance is to the end of time. But it is said that if you die in tard, you will be reborn in Tardhalla.

   
keiths



Posts: 1926
Joined: Jan. 2006

(Permalink) Posted: Dec. 29 2008,19:07   

Quote (carlsonjok @ Dec. 29 2008,16:19)
Wes, do you have any comment on Baylor Bear's latest post?  I don't know anything about ev, but I presume that it measures and returns relative fitness across a population and higher relative fitness means a higher chance of propogating to the next generation.  It looks as if BB* is saying that by measuring relative fitness, that ev is "sneaking information in" and is simulating evolution by doing a random walk without any measure of fitness at all and just waiting until the mutating function finally hits the target.  Is that about right?

* My guess is it is Robert Marks. Not sure why he is writing under a pseudonym.  Is UD that radioactive for a tenured professor?

Baylor Bear is saying that an undirected random search will take forever to stumble onto a target.  Translated into biological terms, that means that if every single mutation is neutral (except for the final one that happens to hit the target), then natural selection won't work.

Well, duh.  Of course natural selection depends on differential fitness.  That's the whole idea.  It's hard to know whether BB is being dishonest or just stupid here.

--------------
"Unguided evolution (whatever that is) doesn’t predict anything. If it did it wouldn’t be unguided." -- Mung

"Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there." -- KF

  
Wesley R. Elsberry



Posts: 4112
Joined: May 2002

(Permalink) Posted: Dec. 29 2008,19:44   

I'm still travelling, so I haven't had a chance to look at the latest "ev" bashing in any detail. "keiths" has a good capsule summary just above, it seems to me.

Things got amusing the last time Marks and Dembski took a tilt at "ev". It's likely a good bet that the latest one is of no better quality than their description of "weasel".

--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
keiths



Posts: 1926
Joined: Jan. 2006

(Permalink) Posted: Dec. 29 2008,20:29   

Of course my comment is only 73 words long, so according to KF it can't be any good.

--------------
"Unguided evolution (whatever that is) doesn’t predict anything. If it did it wouldn’t be unguided." -- Mung

"Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there." -- KF

  
dmso74



Posts: 110
Joined: Aug. 2008

(Permalink) Posted: Dec. 29 2008,22:01   

Khan: You (and B+S) are mistaken about what constitutes Darwinian processes. Darwinian processes are gradual accumulations of slightly beneficial mutations that produce slightly more fit intermediates (King, J.L. and Jukes, T.H. 1969. Non-Darwinian evolution. Science 164:788–798). The assumption that intermediates are deleterious makes the model non-Darwinian.

Patrick: Ugh, so basically your objection comes down to a word game. If it makes you happy then, yes, by that definition Behe and Snoke’s model did not include “Darwinian processes”. But you should know that when most people on here (UD) say “Darwinism” or “Darwinian” they’re referring to modern evolutionary theory and all related non-foresighted, unguided mechanisms or processes. We’re examining all potential pathways, not just ones we know should work. Sure, it may be imprecise language but this is not just something we do, as referenced on this page here in relation to Margulis.

Khan responds:

 
Quote
Patrick,

It might seem like a word game but it is critical to the discussion. No one has ever suggested that genetic drift (random fixation of neutral and, rarely, deleterious alleles) is a leading cause of the formation of complex or even simple structures. But this is what B+S were actually testing, while claiming they were testing Darwinian processes. I’m not saying they did so with an intent to deceive, but they made a mistake and were corrected on it. their paper basically shows what everyone already knows- that it’s hard to make new features w genetic drift alone. this is another example of why having good definitions is so critical.


And, I assume, apologizes for overestimating a UD moderator's understanding of evolutionary theory.

  
Sealawr



Posts: 51
Joined: Feb. 2008

(Permalink) Posted: Dec. 29 2008,22:47   

Quote
That will not be a materialist theory of the mind until a plausible materialist theory of the mind arises.



[URL=http://www.uncommondescent.com/science/intelligent-design-and-popular-culture-population-crank-is-now-us-science-and-technology-p

olicy-director/#comment-301007]Denyse O'Leary's mind moves in mysterious ways[/URL]

--------------
DS: "The explantory filter is as robust as the data that is used with it."
David Klinghoffer: ""I'm an IDiot"

  
CeilingCat



Posts: 1489
Joined: Dec. 2007

(Permalink) Posted: Dec. 30 2008,00:36   

O'Dreary:    
Quote
Note: My Salvo 6 column on the ongoing stem cell scam is now online. If you got money for Christmas, take the opportunity to subscribe to Salvo. There you will find out about still more amazing establishment science scams - and many other fascinating details of the collapse of popular materialist culture)
Subscribe to my mag.

--------------
Like every other academic field, philosophy of religion has its share of hacks and mediocrities.   Edward Feser

‘Anything is a “real possibility” in the mind of one seeking to deny the obvious.’ – William J Murray

  
keiths



Posts: 1926
Joined: Jan. 2006

(Permalink) Posted: Dec. 30 2008,06:21   

Gpuccio screws the pooch:
Quote
IMO, the main purpose of design is to express ever new, and higher, functions. In that sense, I completely disagree with the darwinian approach that survival is all. If that were true, “evolution” would have rather stopped to bacteria (still the most successful living organisms on earth), or just to stones, which are very good at survival.


--------------
"Unguided evolution (whatever that is) doesn’t predict anything. If it did it wouldn’t be unguided." -- Mung

"Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there." -- KF

  
keiths



Posts: 1926
Joined: Jan. 2006

(Permalink) Posted: Dec. 30 2008,07:16   

The rest of gpuccio's comment:
Quote
I believe that there is in the biological world a continuous impulse to express new functions, to experiment with them, and to creatively enjoy them. The Designer is not only smart: He is a true artist, and as an artist He enjoys form, and creates it continuously. Let’s say that I believe that flight evolved so many times not because of convergent evolution, or just because it is better for survival, but because it’s beautiful, and interesting, and such fun!

We can all admire the creativity of a Designer who is trying out other beautiful and interesting things like hanging groin, flesh-eating bacteria and polycystic kidney disease.  Fun!

--------------
"Unguided evolution (whatever that is) doesn’t predict anything. If it did it wouldn’t be unguided." -- Mung

"Please stop putting words into my mouth that don’t belong there and thoughts into my mind that don’t belong there." -- KF

  
oldmanintheskydidntdoit



Posts: 4999
Joined: July 2006

(Permalink) Posted: Dec. 30 2008,08:24   

Quote (CeilingCat @ Dec. 30 2008,00:36)
O'Dreary:            
Quote
Note: My Salvo 6 column on the ongoing stem cell scam is now online. If you got money for Christmas, take the opportunity to subscribe to Salvo. There you will find out about still more amazing establishment science scams - and many other fascinating details of the collapse of popular materialist culture)
Subscribe to my mag.

I had to wonder what other things a magazine who (presumably) pay O'Leary were concerned with.
http://www.salvomag.com/index.php
     
Quote
New and Unimproved
Atheism's brash but ineffectual makeover

The Apologist
An interveiw with Dinesh D'Souza, author of What's So Great About Christianity

Our Smear Campaign
Congratulations, my fellow atheists; we have successfully demonized religion (however speciously)

Blinded By Science?
Don't be; that's just the New Atheists masking their faith choice


Seems to me they are simply obsessed with atheists (New Atheists?) . Are they envious perhaps?

And one post by O'Leary ends
     
Quote
The fact that Behe is not a creationist and accepts a role for evolution does nothing to turn aside shock and anger at his views.

Shock? Anger? O'Leary, you forgot boredom, disinterest and humour.

Shock? Anger? O'Leary you do know that anybody is allowed to publish books right? There's no minimum quality barrier there. It's not like that thing that the real scientists do. I mean, even you, O'Leary, have published a book!

--------------
I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies".
FTK

if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand
Gordon Mullings

  
KenGee



Posts: 53
Joined: Oct. 2008

(Permalink) Posted: Dec. 30 2008,09:11   

Sorry couldn't help myself read one of O link farm  rants all I could think of was
www.mindfulhack.com - lha = www.mindfuck.com

--------------
"Proteins are not produced by a chemical reaction, they are manufactured by machinery that is programmed through a base-four digital code. " Frilly Gilly on LIfe

  
sparc



Posts: 1468
Joined: April 2007

(Permalink) Posted: Dec. 30 2008,10:24   

gpuccio on the EV ware thread:
 
Quote
13
gpuccio
12/29/2008
2:37 am
Atom:
Wonderful work! As it is evident from most of the discussions here at UD, demonstrating that algotithms cannot generate CSI remains the main point of ID. While we rely on the work of our theorists (Dembski and Marks) to get ever better theorical demonstrations of that, your practical implementation showing clearly to us non mathematicians what is really at stake is extremely useful. I have often used your weasel ware GUI to help friends who are not familiar with mathematical concepts what is really happening in the different models. The ev ware is another precious tool.
I can’t understand why some people find it difficult to understand the fundamental intuition behind these analysis: these softwares already know the target! They just refrain from giving you immediately the correct answer, because otherwise there would be no game, and give it to you in small pieces. But they know the answer!
The evolutionary process, as it is conceived, does not know the answer. Indeed, it is not even interested in it. Natural selection can only select function, not information. GAs, instead, select information. Their only meaning, in practice, is to sow that: if I already know information, I can select it. What an achievement!
I have always thought that the only true evolutionary simulation should be like that: take a system (a computer) and implement in it simple digital replicators subject to random variation (possibly at an adjustable rate). And then just wait for their “evolution”. We have all that is necessary. One could say: but where is NS? Well, NS is in the same place where it is supposed to be in natural history: it is in the rules of the system and in the rules of the replicator. The replicator has all the chances to become more efficient by random variation and profit of the rules of the system to become something better. So, just wait!
But the moment the programmer, tired of that infinite wait, starts saying: well, let’s help it a bit; after all, we know what we want to achieve.
Well, I suppose that’s exactly what a patient designer has been doing…

 
Quote
15
gpuccio
12/29/2008
3:06 am
Seversky:
You ask:
“The question is, what is meant by “information” in this context? Information in DNA, for example, if it can be said to exist at all, does not appear to be the same as the information being conveyed in these posts. There is no ‘meaning’ in the sense of that which is intended by a sender or that which is apprehended by a recipient.”
Your question shows probably a lack of familiarity with the ID concepts.
Of course there is meaning in DNA, and that meaning corresponds to the specified information. As you probably know, information in the ID theory means that some result is fixed out of all possible theoretical results (in a system). So, if we are talking of a binary string of 130 bits, for instance, like in the example Atom makes commenting the GUI, any single random string is information with a complexity of 1 : 2^130. That kind of information is only a probability, and has nothing to do with meaning. Indeed, in Shannon’s information theory, meaning is not even an issue. Shannon’s theory is a theory about information in this blind sense, and not about meaning.
On the contrary, specified information corresponds broadly to our intuitive concept of meaning. Specified informations is a subset of all possible information, usually a very small one. “Specified” means all information which has some properties which allow us (intelligent observers” to distinguish that information from a generic random information.
There are many ways that information can be specified (see Dembski). Bit for our purpose, only one is important: functional specification. An information is functionally specified when, in the right context, it can do something which would be impossible without it.
Going back to your example (DNA and these posts): both are examples of functionally specified complex information. These posts are information which, in the context of english language, transmit to the reader some specific knowledge or thought. DNA (the protein coding genes) are information which, in the context of the language of the DNA code, transmit to the translation system the correct functional sequence of a protein.
In both cases the meaning is abstract, and is encoded in a symbolic language. Both cases are examples of a functional message being conveyed through a symbolic language. Both cases are CSI.
Just to show you the similarity. I can use this post to send a message to you, a fellow biologist, saying:
Hey friend, this is the protein whose properties you should study. Just synthesize it and study how it folds. Here is the sequence:
GTGCTGTGAACTGCTTCATCAGGCCATCTGGcCCCCTTGTTAATAATCTAATTACeCTAGGTCTAAGTAGAGTTTGACGTCCAATGAGCG



TTT
As you can see, I have used this post exactly to do what DNA does; to convey a specific useful information.
I can agree that these posts can convey a grater variety and complexity of meanings, but after all DNA is only a static mass memory, while we are using these posts to communicate in almost real time. But there is CSI, and therefore meaning, in both.

 
Quote
19
gpuccio
12/29/2008
10:13 am
jdaggs:
This is just a request for information, in order to uderstand better. Indeed, I don’t know in detail the ev program, so I would like to be sure I understand how it works.
I have tried to read the paper, and i am interested to understand how the selection process works, because I think that is the most relevant point.
shorter:
 
Quote
blah, blah, blah [...] blah, blah
I don't have the slightest clue of what I am talking about.


--------------
"[...] the type of information we find in living systems is beyond the creative means of purely material processes [...] Who or what is such an ultimate source of information? [...] from a theistic perspective, such an information source would presumably have to be God."

- William Dembski -

   
  14997 replies since July 17 2008,19:00 < Next Oldest | Next Newest >  

Pages: (500) < ... 146 147 148 149 150 [151] 152 153 154 155 156 ... >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]

Visits since January 19th, 2010: