RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (527) < ... 222 223 224 225 226 [227] 228 229 230 231 232 ... >   
  Topic: Uncommonly Dense Thread 5, Return To Teh Dingbat Buffet< Next Oldest | Next Newest >  
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 12 2016,17:41   

Quote
In the States, it’s got so bad that even though Darwin invented scientific racism, a major US political party, deafeningly committed to fighting racism, is still pushing for a Darwin Day.

-dense o'leary
linky

   
Cubist



Posts: 559
Joined: Oct. 2007

(Permalink) Posted: July 12 2016,17:43   

Quote (JohnW @ July 11 2016,18:25)
Quote (Cubist @ July 11 2016,15:40)
UD only notices Dodgen's death more than two months after the fact? Hm. Curious.

To be fair, I don't think "We must tell Denyse and Gordon" was top concern for the Dodgen family.

No doubt. But still… two months of no blog comments from a respected, semi-prolific commenter like Gil, you know? Seems like somebody might have wondered, maybe even looked into the matter. [shrug]

  
Wesley R. Elsberry



Posts: 4991
Joined: May 2002

(Permalink) Posted: July 12 2016,17:51   

OK, insert the usual boilerplate about it being sad when people die young. Gil Dodgen was not a good interlocutor about things to do with biological evolution, but pulmonary embolism is a shocking exit.  It certainly can abbreviate the time one can spend in getting through the standard stages of death.

That said, I found the following comment on UD more than a bit ironic given the Dodgenator 3000:

Quote

I have missed his contributions although, I think it’s true to say that he said everything he wanted and needed to say.


--------------
"You can't teach an old dogma new tricks." - Dorothy Parker

    
Woodbine



Posts: 1218
Joined: June 2007

(Permalink) Posted: July 12 2016,18:52   

Quote (Cubist @ July 12 2016,23:43)
No doubt. But still… two months of no blog comments from a respected, semi-prolific commenter like Gil, you know? Seems like somebody might have wondered, maybe even looked into the matter. [shrug]

I hadn't realised he was still around - I thought he had drifted (glided?) away from UD years ago.

Edited by Woodbine on July 13 2016,00:52

  
Glen Davidson



Posts: 1100
Joined: May 2006

(Permalink) Posted: July 12 2016,19:19   

Quote (Woodbine @ July 12 2016,18:52)
Quote (Cubist @ July 12 2016,23:43)
No doubt. But still… two months of no blog comments from a respected, semi-prolific commenter like Gil, you know? Seems like somebody might have wondered, maybe even looked into the matter. [shrug]

I hadn't realised he was still around - I thought he had drifted (glided?) away from UD years ago.

He certainly seems to have drifted away from UD.  But he was still an associate researcher for the Evolutionary Informatics Lab, and you might think they'd at least know if their "researchers" were dead or alive--unless, that is, it were as dead and meaningless a "lab" as one would suspect an "ID lab" to be.

I'm pretty much guessing that it was that kind of "lab," one that didn't even know if its "researchers" were living or not.  Their output hasn't really been overwhelming, or, you know, visible.

Glen Davidson

--------------
http://tinyurl.com/mxaa3p....p

Nothing in biology makes sense except in the light of coincidence---ID philosophy

   
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 12 2016,19:28   

Quote (Glen Davidson @ July 12 2016,20:19)
 But he was still an associate researcher for the Evolutionary Informatics Lab, and you might think they'd at least know if their "researchers" were dead or alive--unless, that is, it were as dead and meaningless a "lab" as one would suspect an "ID lab" to be.

isn't that the "Lab" that d/b/a a ministry?

   
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 12 2016,19:33   

freshest thing i see on their webpage is from 2014.

   
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 12 2016,20:04   

daniel king having fun with Upright Biped

   
midwifetoad



Posts: 4003
Joined: Mar. 2008

(Permalink) Posted: July 12 2016,21:44   

I know what you are, but what am I?

--------------
Any version of ID consistent with all the evidence is indistinguishable from evolution.

  
JohnW



Posts: 3217
Joined: Aug. 2006

(Permalink) Posted: July 13 2016,11:20   

Robert Byers, Poet Laureate of Tard:
Quote
I use the fish to fisherman CLAIMS of evolutionists to point out what they are saying. I understand they always have “some fishthing’ crawling onto the land and soon a hippo.
Anyways snakes having vestiges of former legs is not evidence of anything but former legs. ITS NOT Evidence for process or common descent. a YEC creationist welcomes snakes with these vestiges as evidence of GENESIS claim snakes lost their legs. I would insist its one of the few cases in biology. Its not GOOD sampling to use them to prove evolution. naughty.

Anyways.
I think embryology has no evidence for evolution. it only shows life in stages of serious early development.
Any likeness to biology out there is just because of limited options at such levels.
What should embryology look like if evolution was not true?
If there is a common blueprint and there is THEN it would also be that those stages have likeness because of common design.
Why not?
The idea that the history of creatures evolution remaining in the fetus stages is very strange and 19th century thinking.
Its simplistic hunching.
Comparativeness in nature must not be proof of common descent.
There are more and better options and obviously evolutionism only can use embryology if there is no other option for looks.
Think harder evos.

If anyone out there is forming a band, "And soon a hippo" would be a splendid name.  With "Simplistic hunching" as the first album.

--------------
Math is just a language of reality. Its a waste of time to know it. - Robert Byers

There isn't any probability that the letter d is in the word "mathematics"...  The correct answer would be "not even 0" - JoeG

  
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 13 2016,11:26   

Quote (JohnW @ July 13 2016,12:20)
Robert Byers, Poet Laureate of Tard:
Quote
I use the fish to fisherman CLAIMS of evolutionists to point out what they are saying. I understand they always have “some fishthing’ crawling onto the land and soon a hippo.
Anyways snakes having vestiges of former legs is not evidence of anything but former legs. ITS NOT Evidence for process or common descent. a YEC creationist welcomes snakes with these vestiges as evidence of GENESIS claim snakes lost their legs. I would insist its one of the few cases in biology. Its not GOOD sampling to use them to prove evolution. naughty.

Anyways.
I think embryology has no evidence for evolution. it only shows life in stages of serious early development.
Any likeness to biology out there is just because of limited options at such levels.
What should embryology look like if evolution was not true?
If there is a common blueprint and there is THEN it would also be that those stages have likeness because of common design.
Why not?
The idea that the history of creatures evolution remaining in the fetus stages is very strange and 19th century thinking.
Its simplistic hunching.
Comparativeness in nature must not be proof of common descent.
There are more and better options and obviously evolutionism only can use embryology if there is no other option for looks.
Think harder evos.

If anyone out there is forming a band, "And soon a hippo" would be a splendid name.  With "Simplistic hunching" as the first album.

"And soon a hippo" is delightful!

   
Woodbine



Posts: 1218
Joined: June 2007

(Permalink) Posted: July 13 2016,12:11   

Quit yer simplistic hunching, morans!

  
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 13 2016,16:55   

Quote
23
Robert ByersJuly 12, 2016 at 10:28 pm
People who give in the rejections of yEC are simply not the sharpest people.


linky

ETA: Hear me now and believe me later, that comment actually gets worse from there.

Edited by stevestory on July 13 2016,17:56

   
Ptaylor



Posts: 1180
Joined: Aug. 2006

(Permalink) Posted: July 13 2016,19:48   

Quote (Woodbine @ July 13 2016,11:52)
               
Quote (Cubist @ July 12 2016,23:43)
No doubt. But still… two months of no blog comments from a respected, semi-prolific commenter like Gil, you know? Seems like somebody might have wondered, maybe even looked into the matter. [shrug]

I hadn't realised he was still around - I thought he had drifted (glided?) away from UD years ago.


The volume of Gil's posts at UD dropped significantly after his experience following his first, and only, guest post at TSZ. It could well be coincidence, of course, but I think his experience there really shook him. Imagine being able to state the Darwinian evolution is wrong because "simple probability calculations demonstrate that this proposition is fallacious" many times unchecked at UD only to have it immediately challenged in a different forum (first comment: "Which “simple probability calculations” do you have in mind? Name some names."). With more challenges following Gil lasted only a few more days at TSZ, announcing his permanent departure on a follow up thread (citing big meaniness!).

I think his reputation at UD took a knock, too, Gil having been seen entering the enemy's lair as Sir Lancelot the Brave only to exit as not-so-brave Sir Robin, running away. His relative absence was rarely mentioned, and my personal impression of the reaction to the recent news of his death at UD is not the ground shaking news it would have once been.

But that's just my interpretation of events; I could be wrong.
Many of you here know the story, but here is Gil's OP at TSZ, and his flounce is here.

Edited by Ptaylor on July 14 2016,15:05

--------------
We no longer say: “Another day; another bad day for Darwinism.” We now say: “Another day since the time Darwinism was disproved.”
-PaV, Uncommon Descent, 19 June 2016

  
Starbuck



Posts: 26
Joined: July 2011

(Permalink) Posted: July 14 2016,11:10   

I feel like I've walked into a memorial from hell.

  
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 14 2016,11:30   

1) Upright Biped Says dumb things
2) Daniel King explains why he's wrong.
3) Matspirit chimes in, further explaining why UB is wrong.
4) Barry creates an OP to express incredulity at both of them, not once even trying to address the arguments.

ETA bonus feaure: watch Barry say "implications of biological semiotics" like he is a growed-up scientist man!

Edited by stevestory on July 14 2016,12:32

   
Acartia_Bogart



Posts: 2927
Joined: Sep. 2014

(Permalink) Posted: July 14 2016,17:14   

Quote (stevestory @ July 14 2016,11:30)
1) Upright Biped Says dumb things
2) Daniel King explains why he's wrong.
3) Matspirit chimes in, further explaining why UB is wrong.
4) Barry creates an OP to express incredulity at both of them, not once even trying to address the arguments.

ETA bonus feaure: watch Barry say "implications of biological semiotics" like he is a growed-up scientist man!

MatSpirit responds to Barry's OP:
Quote
Barry, thanks for the good sound arguments. Informative and to the point. That’s so much better than the childish name calling you see so much of these days....
...
...
I am confident that when you do disagree you will give cogent reason for your disagreement, as above, and not childish name calling and I thank you for it.

What is most amusing about this is that Barry is so full of himself that he probably won't perceive the sarcasm.

  
Glen Davidson



Posts: 1100
Joined: May 2006

(Permalink) Posted: July 14 2016,18:12   

Quote
Yep. Us engineers wanna know the details. And not even “impossible” details. Just plausible pathways.

They hate that.


Bravely ignoring design details

Ha ha, atheist materialists, we care about the details.  You know, except for what's actually claimed to be design, which we observe all of the time, unlike evolutionary developments a couple billions years ago.

But admirable concern about the mote...

Glen Davidson

ETA, I guess it's more about the origin of life, but same principle, they're very keen on details of abiogenesis, not at all about details of design.

--------------
http://tinyurl.com/mxaa3p....p

Nothing in biology makes sense except in the light of coincidence---ID philosophy

   
Lethean



Posts: 292
Joined: Jan. 2014

(Permalink) Posted: July 15 2016,12:44   

Quote (JohnW @ July 13 2016,11:20)
Robert Byers, Poet Laureate of Tard:
       
Quote
I use the fish to fisherman CLAIMS of evolutionists to point out what they are saying. I understand they always have “some fishthing’ crawling onto the land and soon a hippo.
Anyways snakes having vestiges of former legs is not evidence of anything but former legs. ITS NOT Evidence for process or common descent. a YEC creationist welcomes snakes with these vestiges as evidence of GENESIS claim snakes lost their legs. I would insist its one of the few cases in biology. Its not GOOD sampling to use them to prove evolution. naughty.

Anyways.
I think embryology has no evidence for evolution. it only shows life in stages of serious early development.
Any likeness to biology out there is just because of limited options at such levels.
What should embryology look like if evolution was not true?
If there is a common blueprint and there is THEN it would also be that those stages have likeness because of common design.
Why not?
The idea that the history of creatures evolution remaining in the fetus stages is very strange and 19th century thinking.
Its simplistic hunching.
Comparativeness in nature must not be proof of common descent.
There are more and better options and obviously evolutionism only can use embryology if there is no other option for looks.
Think harder evos.

If anyone out there is forming a band, "And soon a hippo" would be a splendid name.  With "Simplistic hunching" as the first album.




Canatard Records Presents Simplistic Hunching
The Debut Album From The Biological Rock Group And Soon A Hippo
Includes Their #1 Single Pickaxes & Dynamite



Edited by stevestory on July 15 2016,15:15

--------------
"So I'm a pretty unusual guy and it's not stupidity that has gotten me where I am. It's brilliance."

"My brain is one of the very few independent thinking brains that you've ever met. And that's a thing of wonder to you and since you don't understand it you criticize it."


~Dave Hawkins~

  
JohnW



Posts: 3217
Joined: Aug. 2006

(Permalink) Posted: July 15 2016,13:36   

Quote (Lethean @ July 15 2016,10:44)
Quote (JohnW @ July 13 2016,11:20)
Robert Byers, Poet Laureate of Tard:
       
Quote
I use the fish to fisherman CLAIMS of evolutionists to point out what they are saying. I understand they always have “some fishthing’ crawling onto the land and soon a hippo.
Anyways snakes having vestiges of former legs is not evidence of anything but former legs. ITS NOT Evidence for process or common descent. a YEC creationist welcomes snakes with these vestiges as evidence of GENESIS claim snakes lost their legs. I would insist its one of the few cases in biology. Its not GOOD sampling to use them to prove evolution. naughty.

Anyways.
I think embryology has no evidence for evolution. it only shows life in stages of serious early development.
Any likeness to biology out there is just because of limited options at such levels.
What should embryology look like if evolution was not true?
If there is a common blueprint and there is THEN it would also be that those stages have likeness because of common design.
Why not?
The idea that the history of creatures evolution remaining in the fetus stages is very strange and 19th century thinking.
Its simplistic hunching.
Comparativeness in nature must not be proof of common descent.
There are more and better options and obviously evolutionism only can use embryology if there is no other option for looks.
Think harder evos.

If anyone out there is forming a band, "And soon a hippo" would be a splendid name.  With "Simplistic hunching" as the first album.




Canatard Records Presents Simplistic Hunching
The Debut Album From The Biological Rock Group And Soon A Hippo
Includes Their #1 Single Pickaxes & Dynamite

POTW.

Where did you find the picture of JoeG?

--------------
Math is just a language of reality. Its a waste of time to know it. - Robert Byers

There isn't any probability that the letter d is in the word "mathematics"...  The correct answer would be "not even 0" - JoeG

  
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 15 2016,18:00   

Quote
9
john_a_designerJuly 15, 2016 at 3:50 pm
For the naturalists, physicalists and materialists commenting here at UD, here is a coded strand of DNA:

CAAGTAGGGAGTTGATAAGGGATATAATCACAAGTAGTACAAGTATCAGGG…
TCTAAAACTGGGAGTTGATAAGGGACAGCAAGATAA

(A=adenine, G=guanine, T=thymine & C=cytosine)

How did the code get there?

I can absolutely prove to you that an intelligence of some kind was the source of the code.


What's the point, John? Didn't ID destroy evolution on June 19? You're like the guy who proved special relativity in 1906. Too bad so sad.

There's no prize for being Number 2. And at UD, every day you're Number 2.

Edited by stevestory on July 15 2016,19:01

   
Acartia_Bogart



Posts: 2927
Joined: Sep. 2014

(Permalink) Posted: July 16 2016,10:40   

Barry at his stand up comedy best:
Quote

Sev, if I felt compelled to set up straw men every time I addressed my opponent’s argument, it would probably give me pause. That’s just me — ya know, committed to logic and evidence and all.

  
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 16 2016,11:53   

Quote
46
GBDixonJuly 16, 2016 at 9:53 am
Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section.

I tried to figure it out but have run out of time.

There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it.
what?

   
stevestory



Posts: 13407
Joined: Oct. 2005

(Permalink) Posted: July 16 2016,16:20   

Quote
6
George E.July 16, 2016 at 1:49 pm
Make no mistake, the Ark Encounter is a scientific experiment, the positive results of which will not be buried in some obscure academic journal, but will be visually impressed upon the minds of all the young people who visit the theme park.

The hypothesis of this experiment, of course, is that a vessel with the dimensions of that of the ark found in the Book of Genesis could contain all the basic types or kinds of animals found in the world that would need to be in the ark in order to survive a global flood. And the proof of this hypothesis? Well, Ken Ham invites you to buy a ticket and see for yourself.

I take my hat off to Ken Ham. In my opinion, he and those like him have done more to prevent young people from being absorbed into the Darwinist Borg than any other group… although the ID movement has also had a great impact.


lol

   
k.e..



Posts: 5432
Joined: May 2007

(Permalink) Posted: July 17 2016,09:24   

Quote (stevestory @ July 17 2016,00:20)
Quote
6
George E.July 16, 2016 at 1:49 pm
Make no mistake, the Ark Encounter is a scientific experiment, the positive results of which will not be buried in some obscure academic journal, but will be visually impressed upon the minds of all the young people who visit the theme park.

The hypothesis of this experiment, of course, is that a vessel with the dimensions of that of the ark found in the Book of Genesis could contain all the basic types or kinds of animals found in the world that would need to be in the ark in order to survive a global flood. And the proof of this hypothesis? Well, Ken Ham invites you to buy a ticket and see for yourself.

I take my hat off to Ken Ham. In my opinion, he and those like him have done more to prevent young people from being absorbed into the Darwinist Borg than any other group… although the ID movement has also had a great impact.


lol

Barry must be spitting at his screen after that faint praise.

--------------
"I get a strong breeze from my monitor every time k.e. puts on his clown DaveTard suit" dogdidit
"ID is deader than Lenny Flanks granmaws dildo batteries" Erasmus
"I'm busy studying scientist level science papers" Galloping Gary Gaulin

  
OgreMkV



Posts: 3668
Joined: Oct. 2009

(Permalink) Posted: July 17 2016,09:32   

Quote (stevestory @ July 16 2016,11:53)
Quote
46
GBDixonJuly 16, 2016 at 9:53 am
Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section.

I tried to figure it out but have run out of time.

There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it.
what?

Because God... I mean, The Designer... wrote in English.

The arrogance of these people is simply astounding.

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
k.e..



Posts: 5432
Joined: May 2007

(Permalink) Posted: July 17 2016,10:15   

Quote (OgreMkV @ July 17 2016,17:32)
Quote (stevestory @ July 16 2016,11:53)
Quote
46
GBDixonJuly 16, 2016 at 9:53 am
Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section.

I tried to figure it out but have run out of time.

There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it.
what?

Because God... I mean, The Designer... wrote in English.

The arrogance of these people is simply astounding.

Never mind that if they can find someone smart enough to decode the designer's code maybe they can find out why the designer is giving AIDS to babies in Africa.

--------------
"I get a strong breeze from my monitor every time k.e. puts on his clown DaveTard suit" dogdidit
"ID is deader than Lenny Flanks granmaws dildo batteries" Erasmus
"I'm busy studying scientist level science papers" Galloping Gary Gaulin

  
Acartia_Bogart



Posts: 2927
Joined: Sep. 2014

(Permalink) Posted: July 17 2016,10:33   

Quote (k.e.. @ July 17 2016,10:15)
Quote (OgreMkV @ July 17 2016,17:32)
Quote (stevestory @ July 16 2016,11:53)
 
Quote
46
GBDixonJuly 16, 2016 at 9:53 am
Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section.

I tried to figure it out but have run out of time.

There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it.
what?

Because God... I mean, The Designer... wrote in English.

The arrogance of these people is simply astounding.

Never mind that if they can find someone smart enough to decode the designer's code maybe they can find out why the designer is giving AIDS to babies in Africa.

Didn't you know, it's all about the gift of free will that God gave to us. We are all free to disobey his edicts. Of course, disobeying will result in unmentionable suffering for you and your family to the sixth generation. But at least we have free will.

  
k.e..



Posts: 5432
Joined: May 2007

(Permalink) Posted: July 17 2016,12:25   

Quote (Acartia_Bogart @ July 17 2016,18:33)
Quote (k.e.. @ July 17 2016,10:15)
Quote (OgreMkV @ July 17 2016,17:32)
 
Quote (stevestory @ July 16 2016,11:53)
 
Quote
46
GBDixonJuly 16, 2016 at 9:53 am
Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section.

I tried to figure it out but have run out of time.

There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it.
what?

Because God... I mean, The Designer... wrote in English.

The arrogance of these people is simply astounding.

Never mind that if they can find someone smart enough to decode the designer's code maybe they can find out why the designer is giving AIDS to babies in Africa.

Didn't you know, it's all about the gift of free will that God gave to us. We are all free to disobey his edicts. Of course, disobeying will result in unmentionable suffering for you and your family to the sixth generation. But at least we have free will.

Ha! Their designer is a 12 year old boy with an ant farm. The fundies just can't accept that their fictional overlord is just a figment of their collective imagination. What did Freud call it, the superego?

--------------
"I get a strong breeze from my monitor every time k.e. puts on his clown DaveTard suit" dogdidit
"ID is deader than Lenny Flanks granmaws dildo batteries" Erasmus
"I'm busy studying scientist level science papers" Galloping Gary Gaulin

  
Acartia_Bogart



Posts: 2927
Joined: Sep. 2014

(Permalink) Posted: July 17 2016,12:49   

Quote (k.e.. @ July 17 2016,12:25)
Quote (Acartia_Bogart @ July 17 2016,18:33)
Quote (k.e.. @ July 17 2016,10:15)
 
Quote (OgreMkV @ July 17 2016,17:32)
 
Quote (stevestory @ July 16 2016,11:53)
   
Quote
46
GBDixonJuly 16, 2016 at 9:53 am
Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section.

I tried to figure it out but have run out of time.

There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it.
what?

Because God... I mean, The Designer... wrote in English.

The arrogance of these people is simply astounding.

Never mind that if they can find someone smart enough to decode the designer's code maybe they can find out why the designer is giving AIDS to babies in Africa.

Didn't you know, it's all about the gift of free will that God gave to us. We are all free to disobey his edicts. Of course, djisobeying will result in unmentionable suffering for you and your family to the sixth generation. But at least we have free will.

Ha! Their designer is a 12 year old boy with an ant farm. The fundies just can't accept that their fictional overlord is just a figment of their collective imagination. What did Freud call it, the superego?

Well, superego is certainly a good description of Barry, William and Gordon.

  
  15792 replies since Dec. 29 2013,11:01 < Next Oldest | Next Newest >  

Pages: (527) < ... 222 223 224 225 226 [227] 228 229 230 231 232 ... >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]