RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (5) < [1] 2 3 4 5 >   
  Topic: Creating CSI with NS, H T T H H H T H T T H H H H T T T< Next Oldest | Next Newest >  
OgreMkV



Posts: 2922
Joined: Oct. 2009

(Permalink) Posted: Nov. 20 2012,10:48   

Quote (Jerry Don Bauer @ Nov. 20 2012,10:24)
You guys need to take a breather and read the posts...lol....everything you accuse me of NOT doing is right there in black and white...no need to link to anything, I posted it for you directly.....now, you need to directly attack the math I just threw your way...*wink*

What do you need to calculate the CSI of an organism?

It's entire genome?
It's entire genome + associated memories and learned skills?
Every protein sequence that it needed to build the organism?

Since those big numbers are too scary for you, how about this?

Here's a gene sequence, what's the CSI for it?

5' CCTGGGTCACUAUAGGAAGAACACACUAUAGUGACCCAGGAAAAGACAAAUCUGCCCUUAGAGCUUGAGAACAUCUUCGGAUGCACGGGA
GGCAGCUCGCGAUGGAAGUAACGGACCCAGCGUUCUCAACAGUGUUCACAGAACCUUAAUGC 3'

What is the CSI? and was this therefore designed?

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
  128 replies since Oct. 06 2012,18:57 < Next Oldest | Next Newest >  

Pages: (5) < [1] 2 3 4 5 >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]

Visits since January 19th, 2010: