OgreMkV
Posts: 2922
Joined: Oct. 2009
|
| Quote (Jerry Don Bauer @ Nov. 20 2012,10:24) | | You guys need to take a breather and read the posts...lol....everything you accuse me of NOT doing is right there in black and white...no need to link to anything, I posted it for you directly.....now, you need to directly attack the math I just threw your way...*wink* |
What do you need to calculate the CSI of an organism?
It's entire genome?
It's entire genome + associated memories and learned skills?
Every protein sequence that it needed to build the organism?
Since those big numbers are too scary for you, how about this?
Here's a gene sequence, what's the CSI for it?
5' CCTGGGTCACUAUAGGAAGAACACACUAUAGUGACCCAGGAAAAGACAAAUCUGCCCUUAGAGCUUGAGAACAUCUUCGGAUGCACGGGA
GGCAGCUCGCGAUGGAAGUAACGGACCCAGCGUUCUCAACAGUGUUCACAGAACCUUAAUGC 3'
What is the CSI? and was this therefore designed?
--------------
Ignored by those who can't provide evidence for their claims.
http://skepticink.com/smilodo....retreat
|
