RSS 2.0 Feed

» Welcome Guest Log In :: Register

Pages: (272) < [1] 2 3 4 5 6 ... >   
  Topic: Joe G.'s Tardgasm, How long can it last?< Next Oldest | Next Newest >  
OgreMkV



Posts: 3335
Joined: Oct. 2009

(Permalink) Posted: Oct. 16 2012,13:42   

Quote (OgreMkV @ Mar. 07 2012,17:15)
Hmm.. interesting.. so, Joe, before the knowledge of stall speed and wing vortexes... bees really couldn't fly?  

The laws ARE Joe.  We don't have to know how they work to make use of them.  No one knows exactly how mass warps spacetime to create what we call gravity.  As has been stated several times, that doesn't stop anyone from using the known principles of gravity to determine a result.

Speaking of which, hey Joe.  has anyone ever used a principle of ID to determine a result (other than 'it looks designed').

Since you have absolutely failed chemistry and brought up the concept of "information", I guess it's time to begin the test.  Are you ready.  This is going to be so much fun.

Joe, here are two DNA sequences.  Since I know how big you are on context, I'll tell you a little bit about them.  Both of the sequences are exactly the same length.  Indeed, except for the bolded nucleotide, they are exactly the same.  Both produce a protein that is required for humans to live.  Both produce a slightly different form of that protein, but a person with either one will live a long live (all other things being equal... this protein won't prevent you from tearing you anus and bleeding to death while kicking yourself in the ass).

What I'd like is you to use some principles of ID to tell me something about these two sequences.  Which came first?  Which is more functional, etc.

However, because we both know that you will never do this.  What I'd like you to do is define information and then tell us which sequence has more information.  You get to pick which kind of information we talk about.  We just need a definition so that we're all on the same page.

So, define information and which one has more information.

Sequence the first:
ATG GTG GAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
GAG AAC TTC AGG GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA
TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA
GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT
GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT
CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA
TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA
ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA

Sequence the second

ATG GTG GAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
GAG AAC TTC AGG GTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA
TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA
GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT
GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT
CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA
TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA
ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA

Feel free to compare them using grep (you do know what grep is right?)

BTW: While we're talking about it.  I would like to remind you that using the known laws of science...

There is NOTHING that would prevent life from arising from non-live.  Believe me, I've studied this for years.  There's a lot of exciting research coming out.  Not only is it possible, it is likely to have happened via multiple pathways.

Again, this is how science works.  You make a claim, you support it.

My claim is that there is nothing in the laws of the universe that would prevent life coming from non-life.  So far, 50 years of research and thousands of scientific papers support my views.

Your claim is that it is impossible.  However, your requirements are hypocritical in that you demand stuff from science that you don't demand from your own notions.  Again, you are making the claim that thousands of experiments are wrong.  You support it.

All it takes is one experiment to prove me wrong, yet it hasn't ever happened yet.  Why don't you learn what a mole is, get a degree in chemistry, and then do the experimental world to prove me wrong.

Oh that's right, your too scared it will alter your world view.  You aren't interested in science, you are just interested in playing internet tough guy.

I fully expect you to run away from this challenge too.

Just out of curiosity Joe, you've had this to work on for about 6 months now.  Any progress?

Just tell us ANYTHING about what ID says about these two (human) DNA sequences and how you determined it.  

Anything at all
1) Which came first?
2) Which contains more information?
3) Which one was designed?
4) Which one is a mutated version of the other one?
5) Which one has the greatest survival advantage?

Careful, there are more trick questions in there... (snicker)

--------------
Ignored by those who can't provide evidence for their claims.

http://skepticink.com/smilodo....retreat

   
  8136 replies since Feb. 24 2010,12:00 < Next Oldest | Next Newest >  

Pages: (272) < [1] 2 3 4 5 6 ... >   


Track this topic Email this topic Print this topic

[ Read the Board Rules ] | [Useful Links] | [Evolving Designs]